Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M509292200 on February 8, 2006

J. Biol. Chem., Vol. 281, Issue 17, 11792-11804, April 28, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/17/11792    most recent
M509292200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Syeda, F.
Right arrow Articles by Wheeler-Jones, C. P. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Syeda, F.
Right arrow Articles by Wheeler-Jones, C. P. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Cyclooxygenase-2 Induction and Prostacyclin Release by Protease-activated Receptors in Endothelial Cells Require Cooperation between Mitogen-activated Protein Kinase and NF-{kappa}B Pathways*

Farisa Syeda{ddagger}, Jennifer Grosjean§, Rebecca A. Houliston{ddagger}, Rosemary J. Keogh{ddagger}, Tom D. Carter, Ewa Paleolog§, and Caroline P. D. Wheeler-Jones{ddagger}1

From the {ddagger}Department of Veterinary Basic Sciences, Royal Veterinary College, Royal College Street, London NW1 0TU, United Kingdom, §Kennedy Institute of Rheumatology and Division of Surgery, Oncology, Reproductive Biology, and Anaesthetics, Faculty of Medicine, Imperial College, London W6 8LH, United Kingdom, and National Institute for Medical Research, Mill Hill, London NW7 1AA, United Kingdom

Received for publication, August 23, 2005 , and in revised form, February 7, 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The functional significance of protease-activated receptors (PARs) in endothelial cells is largely undefined, and the intracellular consequences of their activation are poorly understood. Here, we show that the serine protease thrombin, a PAR-1-selective peptide (TFLLRN), and SLIGKV (PAR-2-selective peptide) induce cyclooxygenase-2 (COX-2) protein and mRNA expression in human endothelial cells without modifying COX-1 expression. COX-2 induction was accompanied by sustained production of 6-keto-PGF1{alpha}, the stable hydrolysis product of prostacyclin, and this was inhibited by indomethacin and the COX-2-selective inhibitor NS398. PAR-1 and PAR-2 stimulation rapidly activated both ERK1/2 and p38MAPK, and pharmacological blockade of MEK with either PD98059 or U0126 or of p38MAPK by SB203580 or SB202190 strongly inhibited thrombin- and SLIGKV-induced COX-2 expression and 6-keto-PGF1{alpha} formation. Thrombin and peptide agonists of PAR-1 and PAR-2 increased luciferase activity in human umbilical vein endothelial cells infected with an NF-{kappa}B-dependent luciferase reporter adenovirus, and this, as well as PAR-induced 6-keto-PGF1{alpha} synthesis, was inhibited by co-infection with adenovirus encoding wild-type or mutated (Y42F) I{kappa}B{alpha}. Thrombin- and SLIGKV-induced COX-2 expression and 6-keto-PGF1{alpha} generation were markedly attenuated by the NF-{kappa}B inhibitor PG490 and partially inhibited by the proteasome pathway inhibitor MG-132. Activation of PAR-1 or PAR-2 promoted nuclear translocation and phosphorylation of p65-NF-{kappa}B, and thrombin-induced but not PAR-2-induced p65-NF-{kappa}B phosphorylation was reduced by inhibition of MEK or p38MAPK. Activation of PAR-4 by AYPGKF increased phosphorylation of ERK1/2 and p38MAPK without modifying NF-{kappa}B activation or COX-2 induction. Our data show that PAR-1 and PAR-2, but not PAR-4, are coupled with COX-2 expression and sustained endothelial production of vasculoprotective prostacyclin by mechanisms that depend on ERK1/2, p38MAPK, and I{kappa}B{alpha}-dependent NF-{kappa}B activation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The principal mechanism through which serine proteases regulate cell behavior is by activation of a unique family of G-protein-coupled receptors, referred to as protease-activated receptors (PARs)2 (1, 2). These receptors are activated by the proteolytic activities of their ligands, which unmask a cryptic N-terminal receptor sequence that binds to and triggers receptor function while remaining tethered. Molecular cloning has identified four subtypes of the PAR family that exhibit differential tissue expression as well as selectivity in activation by serine proteases and by peptides that mimic the tethered ligand sequences. PAR-1 is a ubiquitously expressed receptor and is activated by the multifunctional serine protease, thrombin, and by the synthetic PAR-1 peptide TFLLRN. PAR-4 is a second thrombin receptor that binds thrombin with low affinity and can be activated by the polypeptide sequence AYPGKF (3, 4). Signaling through PAR-2, in contrast, is preferentially stimulated by trypsin, tryptase, and membrane-type serine protease-1 (5) and can be activated independently of proteolysis by the selective PAR-2 peptide SLIGKV. Cellular responses to thrombin and to other proteases are therefore determined in part by the expression of PARs as well as by the differential recruitment of signaling pathways following ligand binding.

Endothelial cells respond to PAR-1 activation by thrombin with a number of functional responses including secretion of von Willebrand factor (6), up-regulation of IL-8 synthesis (7), and expression of adhesion molecules (8). Thrombin also causes endothelial cell proliferation, which is essential for wound healing and angiogenesis (9). However, whereas this protease clearly promotes both proinflammatory and prothrombotic events in the vascular wall, thrombin also increases endothelial expression of complement inhibitory proteins (e.g. decay-accelerating factor) (3) and enhances the release of vasodilator molecules that have vasculoprotective properties (6, 11). In particular, we have shown that thrombin exposure induces rapid and sustained phases of prostacyclin (PGI2) synthesis by human endothelial cells (12). PGI2 contributes to the acute inflammatory response by promoting vasodilation and increased vascular permeability, is a potent antiplatelet agent, and has antiproliferative and antifibrotic effects mediated by paracrine actions on vascular smooth muscle and fibroblasts, respectively (13, 14). The potential effects of PAR-2 activation on endothelial prostanoid production have received little attention, but there is some evidence that PAR-2 can mediate protective anti-inflammatory responses in vivo (15) as well as contributing to inflammation (16). PAR-2 is strongly induced in endothelial cells following cytokine challenge (17), and it has been suggested that activation of this receptor is functionally significant only in the context of inflammation. We have recently shown, however, that human endothelial cells respond to PAR-2 activation with increased prostanoid synthesis without the requirement for cytokine exposure (12), suggesting that PAR-2 is also a physiologically relevant receptor. Understanding how signaling through distinct PARs regulates endothelial production of PGI2 therefore has important implications for both normal and pathophysiological control of the vasculature.

Prostaglandins are synthesized through the activities of two isoforms of cyclooxygenase (COX), designated COX-1 and COX-2 (18). COX-1 is a constitutive enzyme present in most tissues. In contrast, COX-2, the product of a related gene, is strongly up-regulated by cytokines and growth factors (19, 20) and is now recognized to be constitutively expressed in several tissues (20). Regulation of COX-2 occurs at both transcriptional and post-transcriptional levels, and mitogen-activated protein kinases (MAPKs) are known to be involved in regulating COX-2 expression in response to cytokines (21-23). ERK1/2 and p38MAPK have been implicated in both acute and chronic responses to extracellular stimuli in endothelial cells and we have shown that both of these MAPK families are capable of regulating acute thrombin-stimulated PGI2 synthesis through their direct and indirect effects on Group IV phospholipase A2{alpha} activation (24). We have also previously shown that COX-2 expression in primary human endothelial cells is enhanced by exposure to thrombin and the PAR-1-selective peptide TFLLRN and have provided evidence that activation of PAR-2 by SLIGKV promotes increased COX-2 expression with kinetics distinct from those evident in thrombin-stimulated cells (12). The signaling events that link PAR-1 and PAR-2 with COX-2 expression and sustained prostanoid production are not defined, but the ERK1/2 and p38MAPK families may play important roles.

The COX-2 gene contains numerous cis-acting promoter elements, including NF-{kappa}B sites (25). NF-{kappa}B is a sequence-specific transcription factor that regulates expression of numerous genes and can exert protective or detrimental effects, depending upon the cellular context (26-28). In resting cells, NF-{kappa}B is complexed in the cytoplasm with its inhibitory subunit I{kappa}B{alpha}. Agonist stimulation promotes serine phosphorylation of I{kappa}B{alpha}, which triggers its proteasomal degradation and subsequently activates NF-{kappa}B. NF-{kappa}B can also be activated by an alternative mechanism that involves phosphorylation of I{kappa}B{alpha} on Tyr42 (27). In addition, optimal induction of NF-{kappa}B-dependent genes may require agonist-mediated phosphorylation of NF-{kappa}B proteins within their transactivation domain (29). There is some evidence that thrombin and a PAR-2-selective peptide can activate NF-{kappa}B in vascular cells (30, 31), suggesting that the NF-{kappa}B pathway may be an important component of PAR-mediated signaling. However, whereas COX-2 expression in several cell types is at least partly dependent on NF-{kappa}B activity, the molecular details of its activation in response to ligand binding to PARs are unknown, and hence its significance as a regulator of endothelial PGI2 synthesis remains to be determined.

We have investigated the molecular signaling mechanisms underlying PAR-induced COX-2 expression and PGI2 synthesis in human endothelial cells. We show for the first time that activation of endothelial PAR-1 and PAR-2, but not PAR-4, promotes COX-2 induction and sustained formation of the vasculoprotective mediator PGI2 through mechanisms that require activation of ERK1/2 and p38MAPK as well as I{kappa}B{alpha}-dependent NF-{kappa}B activation. We further show that phosphorylation of the p65 subunit of NF-{kappa}B is a component of both PAR-1- and PAR-2-mediated endothelial activation. These findings have important implications for understanding the vascular effects of therapeutic interventions that target COX-2 and upstream activators of NF-{kappa}B.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents—Human {alpha}-thrombin, bovine serum albumin (BSA; fraction V), and polyvinylidene difluoride membranes (Immobilon-PTM) were all purchased from Sigma. The PAR-1-selective peptide TFLLRN and the PAR-2 peptide SLIGKV were obtained from Bachem (St. Helens, Merseyside, UK), and 2F-LIGRLO was from Peptides International Inc. (Louisville, KY). These peptides have been extensively characterized with respect to their selectivity of action at PARs (e.g. see Ref. 32). Human recombinant IL-1{alpha} was from R&D Systems (Oxford, UK), and the bicinchoninic acid (BCA) protein assay was from Pierce. PG490 (triptolide), PD98059, SB203580, SB202190, and U0126 were from Calbiochem. Reagents for SDS-PAGE were purchased from Bio-Rad (Hemel Hempstead, Hertfordshire, UK) and National Diagnostics (Hessle, Hull, UK). [3H]6-keto-PGF1{alpha} was obtained from Amersham Biosciences. The RNeasy Mini kit and the Superscript II reverse transcriptase were from Qiagen Ltd. (Crawley, West Sussex, UK) and Invitrogen, respectively. The DyNAmo SYBR Green quantitative PCR kit was purchased from Finnzymes (Espoo, Finland). Other molecular biology reagents were all obtained from Promega (Southampton, UK). Culture media were purchased from Sigma or Invitrogen. All other reagents were obtained from Sigma or BDH (Poole, Dorset, UK) at the equivalent of AnalaR grade.

Antibodies—Polyclonal COX-1, COX-2, and phospho-p65-NF-{kappa}B (Ser536) antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Polyclonal antibodies against phospho-ERK1/2, ERK1/2, p38MAPK, and p65-NF-{kappa}B were from New England Biolabs (Beverly, MA). Anti-phospho-p38MAPK antibodies were from either New England Biolabs or BIOSOURCE (Nivelles, Belgium). The I{kappa}B{alpha} antibody was from Active Motif (Rixensart, Belgium). Fluorescein isothiocyanate-conjugated goat anti-rabbit secondary antibodies were obtained from Sigma. Horseradish peroxidase-conjugated goat anti-rabbit and rabbit anti-goat immunoglobulins were from Pierce.

Cell Culture—Human umbilical vein endothelial cells (HUVEC) were isolated and cultured as previously described (12, 24). Briefly, cells were grown in medium M199 (Sigma) supplemented with 20% (v/v) fetal calf serum, 4 mM glutamine, 100 units/ml penicillin, 100 units/ml streptomycin, and 20 mM NaHCO3 and cultured at 37 °C in a 5% CO2, 95% air atmosphere in 25-mm2 tissue culture flasks (BD Biosciences) precoated with 1% (w/v) gelatin. At confluence, cells were passaged into 75-mm2 tissue culture flasks and cultured in the presence of 20 mg/ml endothelial cell growth factor. Experiments were performed on confluent passage 2 cells grown in the appropriate gelatin-coated cell culture dishes.

Western Blotting—HUVEC monolayers in 60-mm2 dishes (~1 x 106 cells/dish) were serum- and endothelial cell growth factor-deprived for 16 h. Quiescent cells were then subjected to treatments as detailed in the legends to Figs. 1, 4, 5, 7, and 9. Whole cell lysates were prepared, and immunoblotting analyses were performed as previously described (24). Blots initially probed with antibodies against either COX-2, phospho-ERK1/2, or phospho-p38MAPK (1:1000) were stripped by incubation in 62.5 mM Tris-HCl (pH 6.7), 2% (w/v) SDS, and 0.7% (v/v) beta-mercaptoethanol for 30 min at 50 °C. Following extensive washing, blots were reprobed with COX-1, total ERK1/2, or total p38MAPK (1:1000) antibodies. Immunoreactive proteins were visualized by enhanced chemiluminescence. Where indicated, densitometric analyses of immunoblots were performed using a Bio-Rad scanning densitometer and Quantity One analyzing software.

RNA Extraction and Real Time Reverse Transcription-PCR—Quiescent HUVEC were treated as described in the legends to Figs. 2 and 5, and RNA was extracted using a Qiagen RNeasy minikit according to the manufacturer's instructions. Total HUVEC RNA was reverse transcribed by incubating 1 µg of RNA with 0.5 µg of oligo(dT)15 primer and 200 units of M-Superscript reverse transcriptase for 1 h at 37°C, 15 min at 42°C, and 3 min at 98 °C. 10% of the resulting cDNA was amplified using the SYBR Green quantitative PCR kit. Primers used for real time PCR were synthesized by MWG-Biotech (Milton Keynes, UK). The 5' to 3' sequences used were as follows: GCATCTTCTTTTGCGTCGCC (GAPDH-1 forward), GTCATTGATGGCAACAATATCC (GAPDH-1 reverse), GCCCAGCACTTCACGCATCAG (COX-2 forward), and AGACCAGGCACCAGACCAAAGACC (COX-2 reverse). The PCR was performed (Opticon II) using the following parameters: 95 °C for 2 min, 30 cycles of 93 °C for 1 min, and 60 °C for 1 min and a final extension step at 60 °C for 7 min. Each analysis contained a range of standards (known concentrations of the same target sequence). Data were analyzed using the Opticon II monitor 2 analysis software, and a standard curve was plotted that correlated cycle number with the amount of product formed after each cycle. COX-2 mRNA levels were normalized to GAPDH for each sample.

Analysis of NF-{kappa}B Activation Using Luciferase Adenovirus Infection All viruses were E1/E3 (early transcribed regions)-deficient and belonged to the Adv5 serotype. Viruses were propagated in 293 human embryonic kidney cells (American Type Culture Collection, Manassas, VA) and purified by cesium chloride ultracentrifugation. Titers of viral stocks were determined by plaque assay on 293 cells. Replication-deficient control adenoviral vector without insert (Ad0) was provided by Drs A. Byrnes and M. Wood (Oxford University). Adenovirus encoding porcine I{kappa}B{alpha} with a cytomegalovirus promoter and a nuclear localization sequence (AdI{kappa}B{alpha}) was provided by Dr. R. de Martin (University of Vienna). The adenovirus expressing mutated human I{kappa}B{alpha} (tyrosine 42 to phenylalanine; AdI{kappa}B{alpha} Y42F) was from Prof. J. F. Engelhardt (University of Iowa). Efficient infection of cells (>95%) was confirmed using virus encoding bacterial beta-galactosidase at a multiplicity of infection (MOI) of 100:1 followed by the addition of the fluorimetric substrate, fluorescein-di-beta-galactopyranoside (Sigma) (data not shown). Measurement of NF-{kappa}B transactivation is based on the use of an adenovirus reporter vector, which contains a luciferase gene under the control of NF-{kappa}B (AdNF-{kappa}B-Luc). This adenovirus reporter was provided by Dr. P. B. McCray, Jr. (University of Iowa) and is a modification of the pNF-{kappa}B-Luc reporter vector (BD Biosciences/Clontech). pNF-{kappa}B-Luc contains the firefly luciferase gene from Photinus pyralis and four tandem copies of the NF-{kappa}B consensus sequence fused to a TATA-like promoter from the herpes simplex virus thymidine kinase promoter. The vector backbone also contains an f1 origin for single-stranded DNA production, a pUC origin of replication, and an ampicillin resistance gene for propagation and selection in Escherichia coli. Therefore, NF-{kappa}B-directed promoter activity is estimated as being proportional to the firefly luciferase activity.

For adenoviral infection, HUVEC were seeded at 80% confluence (9,600 cells) in 30-mm2 wells and infected in serum-free medium (RPMI 1640) with Ad0 or AdNF-{kappa}B-Luc (MOI of 100:1) with or without coinfection with AdI{kappa}B{alpha} or AdI{kappa}B{alpha} Y42F (MOI 100:1). After 1 h of infection, medium containing free adenoviruses was replaced with complete culture medium for 24-36 h to allow expression of the gene(s) of interest. Cells were then stimulated for the time periods detailed in the legend to Fig. 8, subsequently washed with sterile phosphate-buffered saline (PBS), and lysed in 100 µl of lysis buffer (0.65% Nonidet P-40, 10 mM Tris (pH 8.0), 1 mM EDTA, 150 mM NaCl) on ice for 5 min. 50 µl of lysate were added to the wells of a luminometer cuvette strip containing 120 µl of luciferase assay buffer (25 mM Tris-phosphate (pH 7.8), 8 mM MgCl2, 1 mM EDTA, 1% (v/v) Triton X-100, 1% (v/v) glycerol, 1 mM dithiothreitol, 0.5 mM ATP). Luciferase activity was measured using a LabSystems luminometer by dispensing 30 µl of luciferin (BrightGloTM luciferase assay system; Promega)/assay point. Luciferase activity was normalized in each experiment to the amount of protein.

Immunofluorescence—HUVEC were plated on 13-mm glass coverslips in 4-well plates (Nunc-Nalgene) and grown for 24-48 h until 80% confluent. Following the required treatments, cells were fixed in 4% paraformaldehyde, washed with 0.5% BSA-PBS containing 0.5% BSA (PBS-BSA), and permeabilized in PBS-BSA supplemented with 0.1% Triton. Coverslips were then incubated for 1 h with anti-p65NF-{kappa}B antibodies (10 µg/ml) in PBS-BSA at room temperature. After incubation, coverslips were washed twice in PBS-BSA and incubated with fluorescein isothiocyanate-conjugated secondary goat anti-rabbit antibodies (1:100) for 45 min. Cells were then washed (twice), and slides were mounted with either Fluorsave (Dako, Cambridgeshire, UK) or with propidium iodide-containing mounting medium (Vectashield, Burlingame, CA). Immunofluorescence was monitored by confocal microscopy using a Zeiss LSM 510 inverted microscope.

Measurement of PGI2 Release—Confluent cultures of HUVEC in 24-well tissue culture trays were treated as described in the legends. Supernatants were assayed for 6-keto-PGF1{alpha} (the stable hydrolysis product of PGI2) by radioimmunoassay as previously described (12).

Statistical Analysis—Student's t test or ANOVA, as appropriate, were used to compare means of groups of data. p < 0.05 was considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
PAR Agonists Differentially Induce COX-2 Expression and PGI2 Synthesis in HUVEC—Peptide agonists for PARs have been extensively characterized for PAR selectivity (e.g. see Ref. 32) and are currently in wide use to interrogate the functional significance of PARs in a number of systems. We have recently shown that thrombin enhances expression of COX-2 protein and mRNA in HUVEC and that this is accompanied by prolonged PGI2 synthesis (12). We also provided evidence that the human PAR-2-selective agonist peptide SLIGKV increased COX-2 protein in HUVEC and enhanced COX-2 mRNA and PGI2 release after 2 and 6 h, respectively (12). To gain further insight into the regulation of COX-2 expression and PGI2 synthesis in response to activation of PARs, we initially extended these findings by comparing, within the same HUVEC cultures, the time courses of expression of COX-2 (mRNA and protein) as well as examining the detailed time courses of PGI2 synthesis for all three stimulants in comparison with IL-1{alpha}. Both thrombin and SLIGKV enhanced COX-2 expression in HUVEC in a concentration- and time-dependent manner (Fig. 1). Thrombin (1 units/ml) induced a significant increase in COX-2 protein expression after 2 h, and this was maintained and further increased after 4- and 8-h exposure. Similar induction kinetics were evident in cells challenged with the PAR-1-selective peptide TFFLRN (data not shown). In contrast, SLIGKV (100 µM) (Fig. 1A) or the metabolically stable PAR-2 peptide 2F-LIGRLO (10 µM) (data not shown) maximally induced COX-2 expression after 2 h, and this was sustained but not further enhanced with prolonged exposure to peptide. In keeping with our previous findings (12), the expression of COX-1 was not significantly modified by either thrombin or SLIGKV (Fig. 1, A and B). We next examined whether PAR-stimulated COX-2 protein expression is accompanied by changes in COX-2 mRNA expression using real time reverse transcription-PCR analysis. Both thrombin and SLIGKV caused a 3-4-fold increase in COX-2 mRNA expression after 1-2 h (Fig. 2). However, in SLIGKV-stimulated HUVEC, mRNA levels declined rapidly after 1 h, whereas expression peaked at 2 h after thrombin exposure and was still evident after 4 h. Together, these results show that activation of either PAR-1 or PAR-2 in HUVEC promotes increased COX-2 expression but that the time courses of induction differ between agonists.


Figure 1
View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 1.
Thrombin and the PAR-2-selective peptide SLIGKV induce COX-2 protein expression in HUVEC. Confluent, quiescent HUVEC were exposed to vehicle alone (C) or thrombin (T; 1 unit/ml) for the indicated time periods (A) or to SLIGKV (SL; 50-200 µM) for 2 h (B). Whole cell lysates were prepared and analyzed by SDS-PAGE and immunoblotting with COX-1 and COX-2 antibodies. Immunoblots are each representative of five separate experiments performed on cells isolated from five umbilical cords. Data from densitometric analyses are presented as mean ± S.D. (n = 5 individual experiments). *, p < 0.05 versus unstimulated control cells.

 


Figure 2
View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 2.
Effects of thrombin and SLIGKV on COX-2 mRNA expression in HUVEC. Confluent, quiescent HUVEC were challenged with vehicle alone (Cont; control), thrombin (1 unit/ml), SLIGKV (100 µM), or IL-1{alpha} (100 units/ml) for 1, 2, or 4 h. Total RNA was extracted, and COX-2 and GAPDH mRNAs were quantified by real-time PCR as described under "Experimental Procedures." Results, normalized to GAPDH expression, are given as mean ± S.D. (n = 3 individual experiments). *, p < 0.01; #, p < 0.001 versus unstimulated control cells (ANOVA).

 
We have previously shown that exposure of HUVEC to thrombin triggers a biphasic PGI2 synthesis characterized by an initial rapid release occurring within 30 min of exposure followed by a sustained and prolonged synthesis lasting for several hours (12). Here, we have confirmed this effect and characterized the PGI2 response to PAR-2 stimulation. As depicted in Fig. 3, a 30-min exposure to thrombin (1 unit/ml) markedly enhanced (up to 18-fold) formation of the stable PGI2 hydrolysis product, 6-keto-PGF1{alpha}, whereas little effect of either SLIGKV or IL-1{alpha} was evident at this time point. Increasing the exposure time to thrombin further increased release, which reached a sustained peak between 4 and 8 h. Similar results were obtained with the PAR-1 peptide TFFLRN (data not shown). In contrast, no significant 6-keto-PGF1{alpha} generation was evident in SLIGKV-stimulated cells until 2-4 h after exposure. Thus, the time of onset of PGI2 synthesis as well as the magnitude of the response differs between PAR agonists. To confirm the involvement of COX-2 activity in these responses, we used the COX-2-selective inhibitor NS398. As shown in Fig. 3 (inset), 6-keto-PGF1{alpha} formation in unstimulated HUVEC and in cells subject to prolonged exposure to thrombin was inhibited by ~80% following pretreatment with NS398 (1 µM), but virtually abolished by exposure to the COX-1/2 inhibitor indomethacin. These results confirm the importance of COX-2 activity in prolonged PGI2 release in response to thrombin and suggest that a component of thrombin-induced synthesis depends upon COX-1 activity (12, 24, 52).

Involvement of MAPK Signaling Cascades in PAR-induced COX-2 Expression and PGI2 Synthesis—We and others have shown that MAPK signaling pathways are important regulators of acute prostanoid synthesis by endothelium (24). However, the molecular mechanisms involved in regulating prolonged endothelial prostanoid release, particularly in response to PAR activation, remain to be determined. To define the importance of ERK1/2 and p38MAPK as regulators of PAR-induced COX-2 expression and prostanoid release, we initially examined the effects of PAR agonists on the phosphorylation status of ERK1/2 and p38MAPK. Thrombin (Fig. 4A) and the PAR-1-selective peptide TFLLRN (not shown) caused a rapid and robust activation of ERK1/2 that was still evident after 2 h but was significantly reduced (p < 0.05) compared with that evident after 10 min. In contrast, stimulation with the PAR-2 peptide produced a rapid increase in ERK1/2 activation that did not significantly decline even after 4 h of exposure. SLIGKV also activated p38MAPK with similar levels of activation evident at both early and late time points (Fig. 4B). The PAR-4-selective peptide AYPGKF promoted activation of ERK1/2 and p38MAPK in HUVEC that was evident after 10 min of stimulation (Fig. 4C), which contrasts with our previous demonstration that ERK1/2 activation by thrombin or PAR-1 peptide occurs more rapidly (1-5 min of exposure) (33). However, in contrast to PAR-1 or PAR-2 stimulation, MAPK activation in PAR-4 peptide-stimulated cells was not associated with enhanced COX-2 expression (Fig. 4C) or 6-keto PGF1{alpha} formation (not shown). To explore the role of ERK1/2 and p38MAPK activation in PAR-induced COX-2 expression, we next determined the effects of pharmacological blockade of MEK1/2 or p38MAPK on COX-2 protein and mRNA levels in HUVEC challenged with thrombin and PAR-1- and PAR-2-selective peptides. We have shown previously that these pharmacological inhibitors block agonist-induced MAPK activation in HUVEC in a concentration-dependent manner (24). As shown in Fig. 5, the MEK inhibitors PD98059 (1-10 µM) and U0126 (0.3-3 µM) and the p38MAPK inhibitor SB203580 (1-10 µM) dose-dependently reduced thrombin-induced, TFLLRN-induced (not shown), and SLIGKV-induced COX-2 protein expression. A combination of PD98059 and SB203580 caused a greater reduction in expression than either inhibitor alone (Fig. 5A). U0126 and SB203580 at maximally effective concentrations also reduced basal COX-2 mRNA and abolished COX-2 mRNA induction in both thrombin- and SLIGKV-stimulated endothelial cells (Fig. 5C). Blocking COX-2 activity with NS398, however, did not affect COX-2 protein expression in thrombin-, TFFLRN-, or SLIGKV-stimulated HUVEC (Fig. 7A). These data show that, in contrast to COX-2 induction by IL-1{alpha}, which is minimally affected by blockade of the MEK-ERK pathway,3 COX-2 expression in HUVEC challenged with PAR agonists is strongly dependent upon both ERK1/2 and p38MAPK activation. They also show that COX-2 induction by these stimuli is independent of COX-2 activity. To define the MAPK dependence of COX-2-derived PGI2 synthesis, we examined the effects of U0126 and SB202190 on thrombin-, SLIGKV-, and 2F-LIGRLO (not shown)-induced 6-keto-PGF1{alpha} formation (Fig. 5D). Preexposure to either inhibitor or to the NF-{kappa}B inhibitor PG490 markedly inhibited 6-keto-PGF1{alpha} generation in response to thrombin or the PAR-2-activating peptides.


Figure 3
View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 3.
Delayed 6-keto-PGF1{alpha} formation in PAR-2 agonist peptide-stimulated HUVEC. Confluent HUVEC monolayers in 24-well tissue culture trays were exposed to thrombin (1 unit/ml), SLIGKV (100 µM), or vehicle control for times ranging between 30 min and 8 h. Supernatants were collected and assayed for 6-keto-PGF1{alpha}, the stable hydrolysis product of PGI2, using radioimmunoassay. The protein contents of whole cell lysates were quantified, and 6-keto PGF1{alpha} formation is expressed as pg/µg protein. Data are presented as mean ± S.D. (n = 3 separate experiments each with triplicate observations per treatment). **, p < 0.001 versus unstimulated control cells (ANOVA). The inset shows the effects of a 30-min pretreatment with either indomethacin (In; 1 µM) or NS-398 (NS; 1 µM) on 6-keto-PGF1{alpha} formation basally and after 4 h of stimulation with thrombin (T; 1 unit/ml) in the continued presence of inhibitor (mean ± S.E.; n = 3).

 


Figure 4
View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 4.
Thrombin and SLIGKV promote activation of ERK1/2 and p38MAPK. Quiescent HUVEC monolayers were incubated with thrombin (1 unit/ml) or SLIGKV (100 µM) for the times indicated. Whole cell lysates were analyzed by SDS-PAGE and immunoblotting with phosphospecific ERK1/2 (p-ERK1/2) (A) and p38MAPK (p-p38) (B) antibodies. Equal protein loading was confirmed by reprobing stripped blots with antibodies against total (Tot) ERK1/2 and p38MAPK. Densitometric analyses of p-ERK1/2 and p-p38MAPK immunoblots from three separate experiments are given as mean ± S.D. *, p < 0.05 versus unstimulated control cells. C, HUVEC were exposed to the PAR-4-selective peptide AYPGKF (50 µM) for the times indicated, and the resulting blots were probed for phosphorylated p38MAPK, phosphorylated ERK1/2, or COX-2. Data are from a single experiment representative of two with similar results.

 
Role of NF-{kappa}B in PAR-mediated Signaling—COX-2 expression in endothelial cells exposed to a number of proinflammatory or mitogenic stimuli is known to depend in part upon the activation of NF-{kappa}B (34-36). To begin to define the involvement of NF-{kappa}B-dependent signaling events in regulating prostanoid production in response to PAR activation, we initially assessed nuclear translocation of p65-NF-{kappa}B by confocal microscopy. As shown in Fig. 6, a 2-h exposure to either thrombin or IL-1{alpha}, but not the PAR-4 peptide (data not shown), caused a marked translocation of the p65 subunit of NF-{kappa}B from the cytoplasm to the nucleus. Notably, the PAR-2 peptide 2F-LIGRLO at 10 µM also strongly induced the nuclear translocation of p65-NF-{kappa}B. We next examined the consequences of suppression of NF-{kappa}B activity on PAR-induced COX-2 expression. Pretreatment with the NF-{kappa}B inhibitor PG490 (25 ng/ml) abrogated thrombin-stimulated, TFFLRN-stimulated (not shown), and SLIGKV-stimulated COX-2 protein expression by 70-80% (Fig. 7B) without modifying basal COX-2 protein or basal COX-2 mRNA levels (Fig. 5C). PG490 treatment also reduced PAR-stimulated COX-2 mRNA expression by between 50 and 80% (Fig. 5C) without affecting expression of the COX-1 isoenzyme (not shown). The proteasome inhibitor MG-132 also partially inhibited PAR-2-selective peptide-induced as well as thrombin-induced COX-2 expression (Fig. 7C). In these experiments, 6-keto-PGF1{alpha} generation was also partly reduced by MG-132 treatment (28 ± 5 and 32 ± 6% inhibition of thrombin- and SLIGKV-induced release, respectively; mean ± S.E., n = 2-4 experiments). Further parallel studies showed that sustained 6-keto-PGF1{alpha} formation in response to thrombin, SLIGKV, or 2F-LIGRLO (not shown) was also inhibited by blockade of NF-{kappa}B with PG490 (Fig. 5D). Together, these results suggest that NF-{kappa}B-dependent signaling events are important for regulating COX-2 expression and PGI2 synthesis mediated by PAR-1 and PAR-2 activation.


Figure 5
View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 5.
MAPK inhibitors attenuate thrombin- and SLIGKV-induced COX-2 expression and PGI2 synthesis. A and B, quiescent HUVEC in 60-mm2 dishes were preexposed (30 min) to the indicated concentrations of either PD98059 (PD), SB203580 (SB), U0126 (U0), or a combination of PD98059 and SB203580 and then exposed to thrombin (1 unit/ml) or SLIGKV (100 µM) for 6 or 4 h, respectively. Proteins in whole cell lysates were separated by SDS-PAGE and analyzed by immunoblotting with COX-2 antibody. Blots are each representative of results from three similar independent experiments. C and D, cells were pretreated (30 min) with SB202190 (10 µM), U0126 (1 µM), or PG490 (PG; 25 ng/ml) and subsequently exposed to vehicle alone (C), thrombin (T; 1 unit/ml), SLIGKV (100 µM), or IL-1{alpha} (100 unit/ml) in the continued absence or presence of inhibitor. COX-2 mRNA expression was quantified by real time PCR as described under "Experimental Procedures," and 6-keto-PGF1{alpha} formation was quantified by radioimmunoassay. Data are expressed as mean ± S.D.(n = 3 separate experiments).C,*,p<0.01;#,p<0.0001 versus unstimulated control cells; **, p < 0.0001 versus agonist-stimulated cells. D, *, p < 0.01 versus agonist-stimulated cells; #, p < 0.0001 versus unstimulated control cells; **, p < 0.0001 versus agonist-stimulated or control cells.

 
To further investigate the functional significance of NF-{kappa}B activation in response to PAR stimulation, we examined the effect of thrombin and PAR-selective peptides on the transcriptional activation of NF-{kappa}B in HUVEC infected with an adenoviral reporter containing four NF-{kappa}B consensus sequences upstream of luciferase (37). As shown in Fig. 8A, NF-{kappa}B-directed promoter activity was increased by exposure to thrombin (1 unit/ml) in a biphasic manner with significant activation observed at both early (30 min) and late (4-6 h) exposure times. In cells infected with a control adenovirus, no luciferase activity was observed (data not shown). Thrombin therefore induces a biphasic activation of NF-{kappa}B in HUVEC. Thrombin-induced NF-{kappa}B activation was also concentration-dependent (Fig. 8B), with activation detected at 0.01 units/ml and maximum at 1 unit/ml. We have previously shown that thrombin-driven COX-2 expression and PGI2 synthesis show similar concentration dependences in thrombin-stimulated HUVEC (12). We next examined the effects of PAR-1-, PAR-2-, and PAR-4-selective peptides on luciferase activity in infected endothelial cells (Fig. 8C). The PAR-1 peptide TFLLRN strongly increased luciferase activity, with a peak evident at 6 h after exposure. SLIGKV, the PAR-2 peptide, also enhanced NF-{kappa}B activity, which was smaller in magnitude than that evoked by thrombin but was sustained over a longer time period (Fig. 8C). Consistent with its lack of effect on COX-2 expression and PGI2 formation (Fig. 4C), the PAR-4 peptide did not modify luciferase activity (Fig. 8C). To define the potential involvement of I{kappa}B{alpha} in mediating PAR-induced NF-{kappa}B activation, luciferase activity induced by thrombin was further analyzed following co-infection with either a native I{kappa}B{alpha}-expressing adenovirus (AdI{kappa}B{alpha}) or with an adenovirus overexpressing I{kappa}B{alpha} in which tyrosine residue 42 was mutated to phenylalanine (AdI{kappa}B{alpha} Y42F). As depicted in Fig. 8A, biphasic NF-{kappa}B activation by thrombin was inhibited by coexpression of native I{kappa}B{alpha}, as was the late phase of activation at 6 h (Fig. 8D). Overexpression of the mutated I{kappa}B{alpha} also resulted in inhibition of thrombin-induced NF-{kappa}B activation (Fig. 8D). In keeping with the latter finding, and with the partial inhibition of SLIGKV- and thrombin-induced COX-2 expression by MG-132 (Fig. 7C), we found that expression of I{kappa}B{alpha} protein was only marginally reduced in HUVEC exposed to either thrombin or the PAR-2 peptide SLIGKV (Fig. 9C). Co-infection of HUVEC with AdNF-{kappa}B-Luc and with either of the I{kappa}B{alpha} viruses significantly inhibited 6-keto-PGF1{alpha} generation (Fig. 8D). Collectively, these results suggest that PAR-1- and PAR-2-stimulated NF-{kappa}B activation occurs in an I{kappa}B{alpha}-dependent manner and that such pathways are required for PAR-induced COX-2-derived PGI2 synthesis.


Figure 6
View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 6.
Nuclear translocation of NF-{kappa}B in HUVEC following stimulation with thrombin, PAR-2-selective peptides, and IL-1{alpha}. HUVEC were treated with vehicle (Control), thrombin, the PAR-2-selective peptide 2F-LIGRLO, or IL-1{alpha} at the indicated concentrations for 2 h. Cells were then fixed, permeabilized, and stained with anti-p65NF-{kappa}B antibody followed by incubation with fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit secondary antibody. Nuclei were counterstained with propidium iodide (PI), and immunofluorescence was monitored by confocal microscopy (see "Experimental Procedures"). Results in each panel are representative of four separate experiments.

 


Figure 7
View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 7.
PAR-induced COX-2 expression is inhibited by pharmacological blockade of NF-{kappa}B. A, quiescent HUVEC were preexposed for 30 min to either the NF-{kappa}B inhibitor PG490 (25 ng/ml) or the COX-2-selective inhibitor NS398 (1 µM) for 30 min. Cells were then challenged with vehicle alone (C), thrombin (T; 1 unit/ml), the PAR-1-selective peptide TFLLRN (TF; 100 µM), SLIGKV (SL; 100 µM), or IL-1{alpha} (100 units/ml) in the continued absence or presence of inhibitor for 4 h. Whole cell lysates were prepared, and COX-1/2 protein levels were determined by immunoblotting. The immunoblots shown are representative of five separate experiments. B, densitometric analysis of immunoblotting data from five individual experiments. Results are presented as mean ± S.D. (n = 5). C, HUVEC were incubated for 30 min with vehicle or the proteosome inhibitor MG-132 (1 µM) and then stimulated with either thrombin (1 unit/ml) or SLIGKV (100 µM) for 4 h. Data are from a representative experiment with four experiments showing similar results. *, p < 0.05 versus expression in unstimulated control cells. #, p < 0.05 versus agonist-stimulated expression.

 
Growing evidence suggests that posttranslational modification of p65-NF-{kappa}B is also required for efficient transactivation of NF-{kappa}B-dependent genes (29, 38, 39). We next examined whether phosphorylation of p65-NF-{kappa}B on serine 536 is triggered by activation of PARs on endothelial cells. Incubation with thrombin or the PAR-2 peptide SLIGKV caused a rapid and sustained increase in p65 phosphorylation without modifying total p65-NF-{kappa}B expression (Fig. 9A). To determine the relationship between PAR-induced ERK/p38MAPK activation and p65 phosphorylation, HUVEC were preexposed to the NF-{kappa}B inhibitor PG490, and the phosphorylation state of ERK1/2, p38MAPK, and p65-NF-{kappa}B was assessed using phosphospecific antibodies. As shown in Fig. 9D, blockade of NF-{kappa}B activity did not affect thrombin- or SLIGKV-induced activation of either ERK1/2 or p38MAPK. Similarly, inhibition of MEK with U0126 or of p38MAPK with SB202190 did not modify PAR-2-induced phosphorylation of NF-{kappa}B on serine 536 but partially reduced thrombin-stimulated p65-NF-{kappa}B phosphorylation (Fig. 9E). These results suggest that phosphorylation of p65-NF-{kappa}B on serine 536 in HUVEC exposed to PAR-2 activators, but not thrombin, occurs independently of MEK-ERK- or p38MAPK-mediated signaling.


Figure 8
View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 8.
Thrombin and SLIGKV stimulate transcriptional activity of NF-{kappa}B. A, HUVEC were infected with an NF-{kappa}B luciferase adenovirus and co-infected with adenovirus overexpressing native I{kappa}B{alpha} (AdI{kappa}B{alpha}) or with empty adenovirus (Ad0) both at MOI 100:1. Cells were subsequently treated with thrombin (1 unit/ml) for the times indicated, and luciferase activity was quantified as described under "Experimental Procedures." Data are mean ± S.D. (n = 4) from a single experiment representative of three with similar results. B, HUVEC infected with NF-{kappa}B luciferase adenovirus were exposed to thrombin for 4 h at the indicated concentrations. Results are given as mean ± S.E. (n = 3 experiments). C, HUVEC infected with NF-{kappa}B luciferase adenovirus (MOI 100:1) were stimulated with PAR-agonist peptides (100 µM; PAR-1, TFLLRN; PAR-2, SLIGKV; PAR-4, AYPGKF) for the indicated time periods. Data are mean ± S.E. from four individual experiments. Data in D are from thrombin-stimulated HUVEC co-infected with the NF-{kappa}B luciferase adenovirus and either the adenovirus overexpressing I{kappa}B{alpha} (AdI{kappa}B{alpha}) or a virus encoding a mutated I{kappa}B{alpha} (AdI{kappa}B{alpha}Y42F). Data shown in open columns (left y axis) are expressed as percentage of luciferase activity observed in thrombin-stimulated, Ad0-infected cells and 6-keto-PGF1{alpha} formation (closed symbols; right y axis) was quantified in parallel by radioimmunoassay. Results are means ± S.E. from seven individual experiments. *, p < 0.05; ***, p < 0.001 versus unstimulated control cells by one-way ANOVA. #, p < 0.05; ###, p < 0.001 versus Ad0-infected cells by one-way ANOVA.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In the present study, we have demonstrated that in human endothelial cells, thrombin- and PAR-2 agonist peptide-driven COX-2 expression and sustained PGI2 synthesis require the activation of ERK1/2 and p38MAPK signaling pathways as well as NF-{kappa}B activity. We further show that PAR-mediated NF-{kappa}B activation is accompanied by p65 phosphorylation and is dependent upon I{kappa}B{alpha}. This is the first report to demonstrate a functional link between PARs and COX-2-derived endothelial PGI2 production involving MAPKs and NF-{kappa}B pathways.

Thrombin is known to exert its cellular effects through activation of PAR-1. However, there is some evidence of transactivation of PAR-2 through cleaved PAR-1 (40). In the present study, we observed that thrombin and PAR-2-selective peptides induced COX-2 expression. Although it is possible that the up-regulatory effects of thrombin on COX-2 and on MAPK activation may be partially mediated through PAR-2 transactivation, the PAR-2-selective peptides employed in the present study do not activate PAR-1, thus indicating that PAR-2-peptide-induced effects occur predominantly through PAR-2 activation. In addition, COX-2 up-regulation, as well as MAPK activation and PGI2 synthesis, was marked by differences in kinetics and magnitude in HUVEC exposed to thrombin versus PAR-2-selective peptides. Whereas these differences may well be explained by a difference in potency of PAR-1 versus PAR-2 agonists at their receptors, the possibility that these differences could have functional significance is suggested by the fact that the PAR-2-selective peptide, unlike thrombin or the PAR-1-selective peptide, does not promote acute prostanoid synthesis. This may reflect an inability of PAR-2 agonists to activate acute calcium-dependent pathways in HUVEC that are required for rapid prostanoid production (24). Although the ability of thrombin to promote prostanoid release in several tissues is well documented, the potential roles of proteases and their receptors in regulating sustained endothelial cell PGI2 synthesis have received little attention, and few reports document the ability of thrombin to promote prolonged prostanoid production via COX-2 induction in these cells (12, 39). However, our results are consistent with those of a recent study showing that activated protein C, as well as thrombin, can induce COX-2 expression in HUVEC through activation of PAR-1-mediated signaling (42).


Figure 9
View larger version (57K):
[in this window]
[in a new window]
 
FIGURE 9.
Thrombin and SLIGKV promote early phosphorylation of p65-NF-{kappa}B in HUVEC. Cells were stimulated with vehicle alone (C), thrombin (T; 1 unit/ml), SLIGKV (SL; 100 µM), or IL-1{alpha} (100 units/ml) for the times indicated. Proteins in cell lysates were then separated by SDS-PAGE and analyzed by immunoblotting with phosphospecific p65-NF-{kappa}B or total p65-NF-{kappa}B antibodies (A, B (left), C, and E) or with an antibody raised against total I{kappa}B{alpha} (C, right). D, HUVEC were preexposed to PG490 (25 ng/ml) and then challenged with vehicle alone (C), thrombin (T; 1 units/ml), or SLIGKV (100 µM) for 10 or 30 min in the presence or absence of PG490. The phosphorylation status of p65-NF-{kappa}B, ERK1/2, and p38MAPK were each assessed by immunoblotting with phosphospecific antibodies. E, cells were preincubated with vehicle alone (C), SB202190 (SB; 1 µM), or U0126 (U0;1 µM) and then exposed to SLIGKV (100 µM)or thrombin (1 unit/ml) in the continued absence or presence of inhibitor for the times shown. The resulting blots were probed with an anti-phospho-p65-NF-{kappa}B antibody. Immunoblots in each panel are representative of two or three individual experiments.

 
Endothelial PGI2 production in response to thrombin or PAR-2 peptides occurred with different time courses and to different extents. As previously reported (12) PGI2 release in thrombin-stimulated cells was characterized by an initial rapid increase (principally COX-1-derived) and a later prolonged and sustained phase lasting several hours. The extent of inhibition of thrombin-driven PGI2 release by COX-2 blockade with NS-398 versus that with indomethacin (COX-1/2 inhibitor) confirms the COX-2 dependence of chronic PAR-induced prostanoid synthesis as well as the contribution from COX-1 to overall synthesis. In marked contrast, our present studies with the PAR-2-selective peptide have shown that SLIGKV does not trigger an acute release of PGI2 synthesis but that release was only detectable 2-4 h after peptide exposure and was sustained thereafter. These differential effects of PAR-1 versus PAR-2 activation were concomitant with increased COX-2 protein levels at the same time points and were not accompanied by changes in COX-1 expression.

Our present data report an up-regulation of COX-2 and COX-2-derived PGI2 synthesis in HUVEC in response to PAR-1 and PAR-2 activation. The observation that PARs are capable of stimulating COX-2-driven PGI2 release emphasizes the pathophysiological significance of PAR-1 and PAR-2 activation by circulating proteases and suggests that they contribute to the early inflammatory response by transiently increasing COX-2 expression and PGI2 synthesis. Although the endogenous ligand(s) responsible for driving COX-2 induction in HUVEC through PAR-2 activation remain to be defined, our preliminary data indicate that ligands previously identified as PAR-2-selective (e.g. tryptase; trypsin) are capable of enhancing COX-2 expression in HUVEC.

COX-2 induction in the inflammatory setting has largely been considered deleterious, but relatively less is known about its role under normal physiological conditions. Our current data, along with our previous studies (12, 24), have shown that PGI2 synthesis occurs in resting unperturbed endothelial cells. Our data also indicate that, under our experimental culture conditions, unstimulated HUVEC cultures exhibit variable COX-2 expression. Whereas this could be due at least in part to serum-stimulated induction, inhibition of basal PGI2 synthesis by the COX-2-selective inhibitor NS-398 would support the suggestion that a component of basal release is COX-2-derived under the conditions of our experiments. Although there is evidence that human and mouse arteries express COX-2 ex vivo (43), further studies are required to unequivocally demonstrate that COX-2 is present in normal endothelium. PAR-2 expression in endothelium and other cells is known to be strongly induced by proinflammatory stimuli (17), and PAR-2-mediated events can then exacerbate inflammation-based disease (44). Importantly, our results clearly show that prostanoid production in response to PAR-2 activation occurs without the requirement for pretreatment with a proinflammatory stimulus, suggesting that PAR-2 activation and its associated signaling events are physiologically relevant components of transient (and hence resolved) inflammation. The significance of these findings and the potential protective role of the PAR-COX-2-PGI2 axis in the vasculature are highlighted by the observations that production of circulating PGI2 is COX-2-dependent (45) and that COX-2-derived PGI2 reduces the detrimental vascular remodeling associated with hemodynamic stress (46). Protective roles for COX-2-derived mediators have also been reported in lung (47) and during ischemic preconditioning, where COX-2-derived PGI2 synthesis is up-regulated and exerts cardioprotective effects (48).

Ligand binding to G-protein-coupled receptors leads to the activation of MAPK signaling cascades, and PAR-mediated signaling in a number of cell types is known to involve activation of one or more MAPK cascades (1, 49). In endothelial cells, we and others have shown that activation of ERK1/2 and p38MAPK is triggered by a number of cytokines including tumor necrosis factor-{alpha} and IL-1{alpha} (50, 51) as well as growth factors such as vascular endothelial growth factor (52). However, there are few reports of MAPK signaling in response to PAR activation in human endothelial cells. In the present work, we investigated the potential role of MAPKs in PAR-induced COX-2 expression. We demonstrate that both ERK1/2 and p38MAPK pathways are required for the induction of COX-2 in response to thrombin and PAR-2 activation. Pharmacological inhibition of either ERK1/2 or p38MAPK abrogated PAR-induced COX-2 protein and mRNA expression as well as PGI2 synthesis. However, PD98059 and SB203580 are known to block COX-1 and COX-2 activities in a nonspecific manner (24, 53); hence, we do not rule out the possibility that the substantial decreases in PGI2 levels observed in the presence of these inhibitors could partly result from inhibition of COX enzyme activities. We have shown, however, that U0126 has no significant effect on COX activity (24). In addition, thrombin-induced COX-2 expression was not modified by preexposure to either indomethacin (COX-1/-2 inhibitor) or the COX-2-selective inhibitor NS-398, suggesting that inhibition of COX-2 expression by PD98059 and SB202190 results from kinase blockade. These results indicate that the ERK1/2 and p38MAPK families are activated by stimulation of endothelial PAR-1 and PAR-2 receptors and that these pathways are critical regulators of PAR-induced COX-2 expression and PGI2 synthesis. Whereas it is clear that PAR-1- and PAR-2-induced MAPK activation is functionally linked to prostanoid generation, the PAR-4-selective peptide failed to promote either COX-2 expression or PGI2 release, despite its ability to induce both ERK1/2 and p38MAPK phosphorylation. It is possible that PAR-4 contributes to COX-2 induction at higher thrombin concentrations (49) and/or that this receptor does not normally participate in regulating endothelial prostanoid production (4).

NF-{kappa}B is known to be involved in the transcriptional regulation of several immune and inflammatory markers, including the COX-2 gene (35). In the current work, we investigated the involvement of this transcription factor in PAR-induced COX-2 up-regulation. Thrombin, the PAR-1-selective peptide, and the PAR-2-selective peptide all stimulated the transcriptional activity of NF-{kappa}B. Our data showing a failure of the PAR-4 peptide to promote NF-{kappa}B activation in AdNF-{kappa}B-Luc-infected HUVEC corroborate the lack of effect of PAR-4 activation on COX-2 expression. NF-{kappa}B activation by PARs was associated with translocation of p65-NF-{kappa}B to the nucleus and coincided temporally with PAR-induced COX-2 expression and sustained PGI2 formation. The NF-{kappa}B inhibitor PG490 also attenuated PAR-induced COX-2 expression as well as PGI2 synthesis, providing further support for the hypothesis that signaling to NF-{kappa}B plays a critical role in COX-2 induction and endothelial prostacyclin release.

NF-{kappa}B activation in response to proinflammatory stimuli as well as growth factors involves phosphorylation of the I{kappa}B{alpha} protein. Recruitment and activation of the classical I{kappa}B-kinase (IKK) complex (including IKK{alpha} and IKKbeta) leads to serine phosphorylation of I{kappa}B and subsequent degradation via the proteasome pathway. An alternative mechanism for NF-{kappa}B activation involves tyrosine (Tyr42) phosphorylation of I{kappa}B{alpha}, and this pathway does not require I{kappa}B{alpha} degradation (reviewed in Refs. 29 and 38). We used recombinant adenoviruses encoding wild-type I{kappa}B{alpha} and mutated I{kappa}B{alpha} (Y42F) to begin to probe the potential involvement of I{kappa}B{alpha}-dependent pathways in PAR-induced NF-{kappa}B activation and hence in COX-2 expression and PGI2 synthesis. We found that NF-{kappa}B activation was inhibited by co-infection with either AdI{kappa}B{alpha} or AdI{kappa}B{alpha}Y42F, suggesting that I{kappa}B{alpha}-dependent activation of NF-{kappa}B occurs in endothelial cells exposed to PAR agonists. Moreover, PAR-driven PGI2 formation was also significantly abrogated in cells overexpressing either I{kappa}B{alpha} or I{kappa}B{alpha}Y42F, providing evidence for a role for I{kappa}B{alpha} in regulating PGI2 synthesis in response to PARs activation. The inhibition of NF-{kappa}B activation by infection with AdI{kappa}B{alpha}Y42F raises the possibility that tyrosine phosphorylation of I{kappa}B{alpha} participates in regulating PAR-mediated responses in HUVEC. Indeed, recent studies using AdI{kappa}B{alpha}Y42F have indicated that tyrosine phosphorylation of I{kappa}B{alpha} contributes to regulation of vascular endothelial growth factor-induced NF-{kappa}B activation in HUVEC,4 a growth factor that we have previously shown induces COX-2 expression and PGI2 synthesis in human endothelial cells (12). The kinase(s) responsible for triggering tyrosine phosphorylation of I{kappa}B{alpha} in various cell types are not defined, but recent evidence suggests that c-Src is a possible candidate mediator of this event in macrophages (54). In this respect, we have previously shown that c-Src activity is required for PAR-stimulated ERK1/2 activation in HUVEC, suggesting that activation of c-Src is a component of PAR signaling (55). Our observations that marginal I{kappa}B{alpha} degradation occurs following PAR-1 or PAR-2 activation and that the proteosome inhibitor MG-132 only partially reduces PAR-induced COX-2 expression and PGI2 formation lend support to the possibility that PAR-mediated NF-{kappa}B activation and its downstream events in HUVEC are regulated principally through degradation-independent pathways.

Increasing evidence suggests that post-translational modifications of NF-{kappa}B proteins are required for efficient gene transcription. In particular, phosphorylation of p65-NF-{kappa}BonSer536 regulates its transactivating ability following binding to its consensus sequence (10, 56). We determined whether PAR agonists modify phosphorylation of p65-NF-{kappa}B on Ser536. We found that thrombin and SLIGKV, as well as IL-1{alpha}, stimulated a rapid and sustained increase in the phosphorylation state of p65-NF-{kappa}B. Since the time course of NF-{kappa}B phosphorylation in response to either thrombin or PAR-2 peptide coincided with the kinetics of ERK1/2 and p38MAPK phosphorylation, we examined the potential for interaction between these pathways to regulate PAR-induced p65 phosphorylation. Blockade of NF-{kappa}B activity did not affect PAR-induced ERK1/2 or p38MAPK activation, confirming that MAPK activation does not require NF-{kappa}B activity. However, inhibition of either MEK or p38MAPK partially inhibited thrombin-induced p65 phosphorylation without modifying the response to PAR-2 activation. The identity of the kinase(s) that phosphorylates p65-NF-{kappa}B in response to PAR-1 and PAR-2 activation is unknown, but our data suggest that p65 phosphorylation on Ser536 in thrombin-stimulated but not PAR-2 peptide-stimulated endothelial cells is at least partially dependent upon ERK1/2 and p38MAPK activities. This would be consistent with a role for p65 phosphorylation in regulating thrombin-induced COX-2 expression and PGI2 release. Our findings do not rule out the possibility that PAR activation may be accompanied by changes in the phosphorylation state of p65 on sites other than Ser536 or that PAR-stimulated kinases other than the MAPKs are involved in regulating Ser536 phosphorylation. The mechanisms mediating the early phosphorylation of p65-NF-{kappa}B and its significance for PAR-mediated COX-2 induction remain to be elucidated. Potential candidates involved in this regulation, including IKK{alpha}/beta and the Akt pathway, are currently under examination in our laboratory.

In conclusion, this study has demonstrated that ERK1/2 and p38MAPK as well as the NF-{kappa}B pathway participate in the PAR-mediated regulation of COX-2 expression and hence regulate sustained PGI2 synthesis by human endothelial cells exposed to PAR activators. These findings provide new insights into the molecular mechanisms used by proteases and PARs to regulate generation of the cytoprotective molecule PGI2 through changes in endothelial COX-2 expression.


    FOOTNOTES
 
* This work was supported by the British Heart Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Dept. of Veterinary Basic Sciences, Royal Veterinary College, Royal College St., London NW1 0TU, UK. Tel.: 44-0207-468-5237; Fax: 44-0207-468-5204; E-mail: cwheeler{at}rvc.ac.uk.

2 The abbreviations used are: PAR, protease-activated receptor; HUVEC, human umbilical vein endothelial cell(s); COX-1/-2, cyclooxygenase-1/-2; I{kappa}B{alpha}, inhibitory protein {kappa}B{alpha}; IKK, I{kappa}B-kinase; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; ERK, extracellular signal-regulated kinase; MAPK, mitogen-activated protein kinase; IL-1{alpha}, interleukin-1{alpha}; 6-keto-PGF1{alpha}, 6-keto-prostaglandin F1{alpha}; PGI2, prostacyclin (prostaglandin I2); Ad, adenovirus; BSA, bovine serum albumin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PBS, phosphate-buffered saline; ANOVA, analysis of variance. Back

3 R. A. Houliston and C. P. D. Wheeler-Jones, manuscript in preparation. Back

4 J. Grosjean, S. Kiriakidis, K. Reilly, M. Feldmann, and E. Paleolog, submitted for publication. Back


    ACKNOWLEDGMENTS
 
We thank the midwives and staff of the London Hospital and the Portland Hospital for Women and Children for help in providing umbilical cords. We are grateful to Drs. A. Byrnes and M. Wood (Oxford University), Dr. R. de Martin (University of Vienna), and Dr. P. McCray Jr. and Prof. J. Engelhardt (University of Iowa) for provision of adenoviruses. We also thank Elaine Shervill and Helen Smith for expert technical assistance.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Macfarlane, S. R., Seatter, M. J., Kanke, T., Hunter, G. D., and Plevin, R. (2001) Pharmacol. Rev. 53, 245-282[Abstract/Free Full Text]
  2. Hollenberg, M. D. (2005) J. Pharmacol. Sci. 97, 8-13[CrossRef][Medline] [Order article via Infotrieve]
  3. Mason, J. C., Lidington, E. A., Yarwood, H., Lubin, D. M., and Haskard, D. O. (2001) Arthritis Rheum. 44, 138-150[CrossRef][Medline] [Order article via Infotrieve]
  4. Kataoka, H., Hamilton, J. R., McKemy, D. D., Camerer, E., Zheng, Y. W., Cheng, A., Griffin, C., and Coughlin, S. R. (2003) Blood 102, 3224-3231[Abstract/Free Full Text]
  5. Takeuchi, T., Harris, J. L., Huang, W., Yan, K. W., Coughlin, S. R., and Craik, C. S. (2000) J. Biol. Chem. 275, 26333-26342[Abstract/Free Full Text]
  6. Wheeler-Jones, C. P., May, M. J., Houliston, R. A., and Pearson, J. D. (1996) FEBS Lett. 388, 180-184[CrossRef][Medline] [Order article via Infotrieve]
  7. Ludeman, M. J., Kataoka, H., Srinivasan, Y., Esmon, N. L., Esmon, C. T., and Coughlin, S. R. (2005) J. Biol. Chem. 280, 13122-13128[Abstract/Free Full Text]
  8. Minami, T., Sugiyama, A., Wu, S. Q., Abid, R., Kodama, T., and Aird, W. C. (2004) Arterioscler. Thromb. Vasc. Biol. 24, 41-53[Abstract/Free Full Text]
  9. Tang, H., Low, B., Rutherford, S. A., and Hao, Q. (2005) Blood 105, 1977-1985[Abstract/Free Full Text]
  10. Mattioli, I., Sebald, A., Bucher, C., Charles, R.-P., Nakano, H., Doi, T., Kracht, M., and Schmitz, M. L. (2004) J. Immunol. 172, 6336-6344[Abstract/Free Full Text]
  11. Chung, A., Wildhirt, S. M., Wang, S., Koshal, A., and Radomski, M. W. (2005) J. Thorac. Cardiovasc. Surg. 129, 782-790[Abstract/Free Full Text]
  12. Houliston, R. A., Keogh, R. J., Sugden, D., Dudhia, J., Carter, T. D., and Wheeler-Jones, C. P. D. (2002) Thromb. Haemost. 88, 321-328[Medline] [Order article via Infotrieve]
  13. Shirotani, M., Yui, Y., Hattori, R., and Kawai, C. (1991) Prostaglandins 41, 97-110[CrossRef][Medline] [Order article via Infotrieve]
  14. Stratton, R., Rajkumar, V., Ponticos, M., Nichols, B., Shiwen, X., Black, C. M., Abraham, D. J., and Leask, A. (2002) FASEB J. 14, 1949-19451
  15. Fiorucci, S., Mencarelli, A., Palazzetti, B., Distrutti, E., Vergnolle, N., Hollenberg, M. D., Wallace, J. L., Morelli, A., and Cirino, G. (2001) Proc. Natl. Acad. Sci. 98, 13936-13941[Abstract/Free Full Text]
  16. Ferrell, W. R., Lockhart, J. C., Kelso, E. B., Dunning, L., Plevin, R., Meek, S. E., Smith, A. J., Hunter, G. D., McLean, J. S., McGarry, F., Ramage, R., Jiang, L., Kanke, T., and Kawagoe, J. (2003) J. Clin. Invest. 111, 35-41[CrossRef][Medline] [Order article via Infotrieve]
  17. Nystedt, S., Ramakrishnan, V., and Sundelin, J. (1996) J. Biol. Chem. 271, 14910-14915[Abstract/Free Full Text]
  18. Fitzpatrick, F. A. (2004) Curr. Pharm. Des. 10, 577-588[CrossRef][Medline] [Order article via Infotrieve]
  19. Pruzanski, W., Stefanski, E., Vadas, P., Kennedy, B. P., and van den Bosch, H. (1998) Biochim. Biophys. Acta 27, 47-56
  20. Minghetti, L. (2004) J. Neuropathol. Exp. Neurol. 63, 90-110
  21. Dean, J. L., Sarsfield, S. J., Tsounakou, E., and Saklatvala, J. (2003) J. Biol. Chem. 278, 39470-39476[Abstract/Free Full Text]
  22. LaPointe, M. C., and Isenovic, E. (1999) Hypertension 33, 276-282[Abstract/Free Full Text]
  23. Lin, C. C., Sun, C. C., Luo, S. F., Tsai, A. C., Chien, C. S., Hsiao, L. D., Lee, C. W., Hsieh, J. T., and Yang, C. M. (2004) J. Biomed. Sci. 11, 377-390[Medline] [Order article via Infotrieve]
  24. Houliston, R. A., Pearson, J. D., and Wheeler-Jones, C. P. D. (2001) Am. J. Physiol. 281, C1266-C1276
  25. Chen, J., Zhao, M., Rao, R., Inoue, H., and Hao, C. M. (2005) J. Biol. Chem. 280, 16354-16359[Abstract/Free Full Text]
  26. Caramori, G., Adcock, I. M., and Ito, K. (2004) Curr. Opin. Investig. Drugs. 11, 1141-1147
  27. Brown, M., McGuinness, M., Wright, T., Ren, X., Wang, Y., Boivin, G. P., Hahn, H., Feldman, A. M., and Jones, W. K. (2005) Am. J. Physiol. 289, H466-H476
  28. Misra, A., Haudek, S. B., Knuefermann, P., Vallejo, J. G., Chen, Z. J., Michael, L. H., Sivasubramanian, N., Olson, E. N., Entman, M. L., and Mann, D. L. (2003) Circulation 108, 3075-3078[Abstract/Free Full Text]
  29. Schmitz, M. L., Mattioli, I., Buss, H., and Kracht, M. (2004) Chembiochem 5, 1348-1358[CrossRef][Medline] [Order article via Infotrieve]
  30. Bretschneider, E., Wittpoth, M., Weber, A. A., Glusa, E., and Schror, K. (1997) Biochem. Biophys. Res. Commun. 235, 365-368[CrossRef][Medline] [Order article via Infotrieve]
  31. Bretschneider, E., Kaufmann, R., Braun, M., Wittpoth, M., Glusa, E., Nowak, G., and Schror, K. (1999) Br. J. Pharmacol. 126, 1735-1740[CrossRef][Medline] [Order article via Infotrieve]
  32. Kawabata, A., Kanke, T., Yonezawa, D., Ishiki, T., Saka, M., Kabeya, M., Sekiguchi, F., Kubo, S., Kuroda, R., Iwaki, M., Katsura, K., and Plevin, R. (2004) J. Pharmacol. Exp. Ther. 309, 1098-1107[Abstract/Free Full Text]
  33. Keogh, R. J., Houliston, R. A., and Wheeler-Jones, C. P. (2002) Biochem. Biophys. Res. Commun. 290, 1470-1477[CrossRef][Medline] [Order article via Infotrieve]
  34. Monaco, C., and Paleolog, E. (2004) Cardiovasc. Res. 61, 671-682[Abstract/Free Full Text]
  35. Tsai, S. H., Liang, Y. C., Chen, L., Ho, F. M., Hsieh, M. S., and Lin, J. K. (2002) J. Cell. Biochem. 84, 750-758[CrossRef][Medline] [Order article via Infotrieve]
  36. Nadjar, A., Tridon, V., May, M. J., Ghosh, S., Dantzer, R., Amedee, T., and Parnet, P. (2005) J. Cereb. Blood Flow Metab. 25, 1047-1059[CrossRef][Medline] [Order article via Infotrieve]
  37. Sanlioglu, S., Williams, C. M., Samavati, L., Butler, N. S., Wang, G., McCray, P. B., Jr., Ritchie, T. C., Hunninghake, G. W., Zandi, E., and Engelhardt, J. F. (2001) J. Biol. Chem. 276, 30188-30198[Abstract/Free Full Text]
  38. Viatour, P., Merville, M. P., Bours, V., and Chariot, A. (2005) Trends Biochem. Sci. 30, 43-52[CrossRef][Medline] [Order article via Infotrieve]
  39. Doyle, S. L., Jefferies, C. A., and O'Neill, L. A. (2005) J. Biol. Chem. 280, 23496-23501[Abstract/Free Full Text]
  40. O'Brien, P. J., Prevost, N., Molino, M., Hollinger, M. K., Woolkalis, M. J., Woulfe, D. S., and Brass, L. F. (2000) J. Biol. Chem. 275, 13502-13509[Abstract/Free Full Text]
  41. Sato, T., Sawada, S., Tsuda, Y., Komatsu, S., Akamatsu, N., Kono, Y., Higaki, T., Imamura, H., Tada, Y., Yamasaki, S., Tamagaki, T., Nakagawa, K., Tsuji, H., and Nakagawa, M. (1999) J. Pharmacol. Toxicol. Methods 41, 173-182[CrossRef][Medline] [Order article via Infotrieve]
  42. Brueckmann, M., Horn, S., Lang, S., Fukudome, K., Schulze Nahrup, A., Hoffmann, U., Kaden, J. J., Borggrefe, M., Haase, K. K., and Huhle, G. (2005) Thromb. Haemostasis 93, 743-750[Medline] [Order article via Infotrieve]
  43. Grosser, T., Fries, S., and FitzGerald, G. A. (2006) J. Clin. Invest. 116, 4-15[CrossRef][Medline] [Order article via Infotrieve]
  44. Holzhausen, M., Spolidorio, L. C., and Vergnolle, N. (2005) J. Dent. Res. 84, 154-159[Abstract/Free Full Text]
  45. McAdam, B. F., Catella-Lawson, F., Mardini, I. A., Kapoor, S., Lawson, J. A., and FitzGerald, G. A. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 272-277[Abstract/Free Full Text]
  46. Rudic, R. D., Brinster, D., Cheng, Y., Fries, S., Song, W. L., Austin, S., Coffman, T. M., and FitzGerald, G. A. (2005) Circ. Res. 96, 1240-1247[Abstract/Free Full Text]
  47. Fukunaga, K., Kohli, P., Bonnans, C., Fredenburgh, L. E., and Levy, B. D. (2005) J. Immunol. 174, 5033-5039[Abstract/Free Full Text]
  48. Wang, Y., Kodani, E., Wang, J., Zhang, S. X., Takano, H., Tang, X. L., and Bolli, R. (2004) Circ. Res. 95, 84-91[Abstract/Free Full Text]
  49. Sabri, A., Guo, J., Elouardighi, H., Darrow, A. L., Andrade-Gordon, P., and Steinberg, S. F. (2003) J. Biol. Chem. 278, 11714-11720[Abstract/Free Full Text]
  50. May, M. J., Wheeler-Jones, C. P. D., Houliston, R. A., and Pearson, J. D. (1998) Am. J. Physiol. 274, C789-C798[Medline] [Order article via Infotrieve]
  51. Pru, J. K., Lynch, M. P., Davis, J. S., and Rueda, B. R. (2003) Reprod. Biol. Endocrinol. 1, 17[CrossRef][Medline] [Order article via Infotrieve]
  52. Gliki, G., Abu-Ghazaleh, R., Jezequel, S., Wheeler-Jones, C., and Zachary, I. (2001) Biochem. J. 353, 503-512[CrossRef][Medline] [Order article via Infotrieve]
  53. Borsch-Haubold, A. G., Pasquet, S., and Watson, S. P. (1998) J. Biol. Chem. 273, 28766-28772[Abstract/Free Full Text]
  54. Abu-Amer, Y., Ross, F. P., McHugh, K. P., Livolsi, A., Peyron, J. F., and Teitelbaum, S. L. (1998) J. Biol. Chem. 273, 29417-29423[Abstract/Free Full Text]
  55. Keogh, R. J., Houliston, R. A., and Wheeler-Jones, C. P. (2002) Biochem. Biophys. Res. Commun. 294, 1001-1008[CrossRef][Medline] [Order article via Infotrieve]
  56. Jiang, X., Takahashi, N., Ando, K., Otsuka, T., Tetsuka, T., and Okamoto, T. (2003) Biochem. Biophys. Res. Commun. 301, 583-590[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Ann. Thorac. Surg.Home page
R. M. Osipov, C. Bianchi, R. T. Clements, J. Feng, Y. Liu, S.-H. Xu, M. P. Robich, J. Wagstaff, and F. W. Sellke
Thrombin Fragment (TP508) Decreases Myocardial Infarction and Apoptosis After Ischemia Reperfusion Injury.
Ann. Thorac. Surg., March 1, 2009; 87(3): 786 - 793.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Nacci, M. Tarquinio, L. De Benedictis, A. Mauro, A. Zigrino, M. R. Carratu, M. J. Quon, and M. Montagnani
Endothelial Dysfunction in Mice with Streptozotocin-induced Type 1 Diabetes Is Opposed by Compensatory Overexpression of Cyclooxygenase-2 in the Vasculature
Endocrinology, February 1, 2009; 150(2): 849 - 861.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Yamawaki, K. Saito, M. Okada, and Y. Hara
Methylglyoxal mediates vascular inflammation via JNK and p38 in human endothelial cells
Am J Physiol Cell Physiol, December 1, 2008; 295(6): C1510 - C1517.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
F. Syeda, E. Tullis, A. S. Slutsky, and H. Zhang
Human neutrophil peptides upregulate expression of COX-2 and endothelin-1 by inducing oxidative stress
Am J Physiol Heart Circ Physiol, June 1, 2008; 294(6): H2769 - H2774.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. Q. van der Merwe, M. D. Hollenberg, and W. K. MacNaughton
EGF receptor transactivation and MAP kinase mediate proteinase-activated receptor-2-induced chloride secretion in intestinal epithelial cells
Am J Physiol Gastrointest Liver Physiol, February 1, 2008; 294(2): G441 - G451.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Brownbill, G. C. McKeeman, J. C. Brockelsby, I. P. Crocker, and C. P. Sibley
Vasoactive and Permeability Effects of Vascular Endothelial Growth Factor-165 in the Term in Vitro Dually Perfused Human Placental Lobule
Endocrinology, October 1, 2007; 148(10): 4734 - 4744.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Sadagopan, N. Sharma-Walia, M. V. Veettil, H. Raghu, R. Sivakumar, V. Bottero, and B. Chandran
Kaposi's Sarcoma-Associated Herpesvirus Induces Sustained NF-{kappa}B Activation during De Novo Infection of Primary Human Dermal Microvascular Endothelial Cells That Is Essential for Viral Gene Expression
J. Virol., April 15, 2007; 81(8): 3949 - 3968.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/17/11792    most recent
M509292200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Syeda, F.
Right arrow Articles by Wheeler-Jones, C. P. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Syeda, F.
Right arrow Articles by Wheeler-Jones, C. P. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement