Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M509307200 on November 8, 2005

J. Biol. Chem., Vol. 281, Issue 2, 1008-1015, January 13, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/2/1008    most recent
M509307200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sekine, M.
Right arrow Articles by Yonekawa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sekine, M.
Right arrow Articles by Yonekawa, H.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The cis-Regulatory Element Gsl5 Is Indispensable for Proximal Straight Tubule Cell-specific Transcription of Core 2 beta-1,6-N-Acetylglucosaminyltransferase in the Mouse Kidney*

Michiko Sekine{ddagger}, Chouji Taya{ddagger}, Hiroshi Shitara{ddagger}, Yoshiaki Kikkawa{ddagger}, Noriko Akamatsu{ddagger}, Masaharu Kotani§, Masao Miyazaki¶, Akemi Suzuki¶1, and Hiromichi Yonekawa{ddagger}

From the {ddagger}Department of Laboratory Animal Science and the §Department of Clinical Genetics, Tokyo Metropolitan Institute of Medical Science, Tokyo, 113-8613 Japan, and Sphingolipid Expression Laboratory, RIKEN Frontier Research System, Wako, 351-0198 Japan

Received for publication, August 23, 2005 , and in revised form, October 27, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Gsl5 regulates the expression of a glycolipid and glycoproteins that contain the LeX epitope in the mouse kidney through tissue-specific transcriptional regulation of the core 2 beta-1,6-N-acetylglucosaminyltransferase (core 2 GnT) gene. The core 2 GnT gene has six exons and produces three alternatively spliced transcripts. Gsl5 regulates only the expression of the kidney-type mRNA, which is transcribed from the most 5'-upstream exon. By introducing a 159-kb bacterial artificial chromosome (BAC) clone that carries the mouse core 2 GnT gene and its 5'-upstream region into DBA/2 mice that carry a defective Gsl5 allele, we were able to rescue the deficient phenotype. The BAC clone was subsequently engineered to replace the core 2 GnT gene with the sequence of enhanced green fluorescent protein (EGFP) as a reporter by an inducible homologous recombination system in Escherichia coli. The transgenic mice derived from the modified BAC clone expressed EGFP in the kidney, which suggests that the candidate Gsl5 is in the 5'-upstream region of the core 2 GnT gene. Sequence analysis of the 5'-upstream regions of the BAC clone and DBA/2 genomic DNA revealed a candidate sequence for Gsl5 at about 5.5 kb upstream of exon 1. This sequence consisted of eight repeats of two GT-rich units in the wild-type mice, whereas it consisted of only one pair of GT-rich units with a minor modification in the DBA/2 mice. Transgenic mice produced with the EGFP reporter gene construct that included this candidate sequence expressed EGFP exclusively in the proximal straight tubular cells of the kidney. These results indicated that this unique repeat is indeed the Gsl5, and it is a cis-regulatory element responsible for proximal straight tubule cell-specific transcriptional regulation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Glycoconjugates are constituents of the plasma membrane and play important roles in cell-cell and cell-matrix interactions (1, 2). The glycan structures of these complex glycoconjugates change during the processes of embryogenesis, differentiation, and malignant transformation (3). The synthesis of glycan structures begins in the endoplasmic reticulum and is completed in the Golgi apparatus, where most of the structural variations are produced. The biosynthetic pathways that produce this level of diversity are considered to be strictly regulated in tissue- and stage-specific procedures as the result of the ordered expression of glycosyltransferase activities within the Golgi apparatus. However, the molecular mechanisms remain to be revealed and constitute an important issue in glycobiology research.

We focused on the polymorphic expression of kidney glycolipids among inbred strains of mice, and we found a single autosomal gene that controls the expression of a glycolipid (Galbeta1-4(Fuc{alpha}1-3)GlcNAcbeta1-6(Galbeta1-3)GalNAcbeta1-3Gal{alpha}1-4Galbeta1-4Glcbeta1-ceramide (GL-Y)2) through the regulation of beta-1,6-N-acetylglucosaminyltransferase (beta6GlcNAc-T) activity (4). We named this gene Gsl5 and mapped the Gsl5 locus to chromosome 19 (5). DBA/2 and other several strains of mice carry a recessive allele for Gsl5, which originated from Mus musculus, Asian subspecies (6). We have made the following observations regarding Gsl5. 1) The amino acid sequence deduced from the cDNA sequence of Gsl5-controlled beta6GlcNAc-T is identical to that of the mouse core 2 beta6GlcNAc-T (core 2 GnT). 2) The mouse core 2 GnT gene produces three alternatively spliced transcripts, and Gsl5 controls only one of these, transcribed from exon 1, which is located closest to the 5' end. 3) Gsl5 controls the activity of beta6GlcNAc-T, whose substrates are the glycolipid Galbeta1-3GalNAcbeta1-3Gal{alpha}1-4Galbeta1-4Glcbeta1-ceramide (GL-X) and the oligosaccharide Galbeta1-3GalNAc{alpha}- and beta-p-nitrophenyl derivatives. 4) In addition to the glycolipid, glycoproteins that bear the core 2-LeX epitope (Galbeta1-4(Fuc{alpha}1-3)GlcNAcbeta1-6(Galbeta1-3)GalNAc-) are regulated by Gsl5. 5) Gsl5 controls the level of mRNA that encodes beta6GlcNAc-T in a kidney proximal tubule cell-specific manner (7-9).

We postulated that Gsl5 might be a kidney-specific element in transcriptional regulation. It appeared to be an excellent candidate for the analysis of tissue-specific regulation mechanisms. However, the molecular basis of Gsl5 could not be addressed easily, as cultured cells that maintain the expression of Gsl5-regulated core 2 GnT are not available at present. In addition, in our preliminary experiments, even primary cultures of mouse proximal tubule cells lost the expression of kidney-specific core 2 GnT mRNA within 48 h. These results compelled us to use an in vivo genetic approach. We introduced a clone of a bacterial artificial chromosome (BAC) containing the entire core 2 GnT gene derived from a dominant mouse strain into Gsl5-deficient DBA/2 mice, and we tested whether the wild-type BAC clone was able to rescue the defective phenotype of the DBA/2 mice. One clone rescued the defective phenotype and produced GL-Y glycolipid and glycoproteins with the core 2-LeX epitope in the kidneys of transgenic mice. In addition, we were able to modify the BAC clone by homologous recombination and to define the region of the candidate sequence.

Here we present for the first time evidence that Gsl5 is a unique cis-regulatory element that controls kidney proximal tubular cell-specific transcription.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
BAC Rescue Experiments—A mouse CITB BAC library (Research Genetics/Invitrogen) was screened by PCR, and one BAC clone carrying the core 2 GnT gene was isolated.

The closed circular form of BAC DNA was purified using an alkaline lysis and cesium chloride gradient ultracentrifugation protocol (10). After overnight dialysis, the DNA was diluted to a concentration of 3 ng/µl in TE buffer (10 mM Tris-HCl (pH 7.5), 0.1 mM EDTA) and microinjected into pronucleus stage oocytes isolated from DBA/2 mice. The microinjected oocytes were transplanted into pseudo-pregnant ICR mice. The resulting mice were screened by PCR analysis with PCR primers, BAC-1 and BAC-2, for the BAC vector using genomic DNA purified from tail biopsies. The primer sequences are shown in Table 1. One transgenic line was established by mating the founder mouse and DBA/2 mice.


View this table:
[in this window]
[in a new window]
  		TABLE 1
Primers used for PCR and GET recombination

 
To examine the expression of mRNA for core 2 GnT, total RNA samples from the kidneys or other tissues of the transgenic mice were subjected to RT-PCR. OmniscriptTM reverse transcriptase (Qiagen) was used, and the PCR was performed with the following primers: GNT-28, for the kidney-type cDNA; GNT-29, for the ubiquitous-type cDNA; and GNT-38, the common antisense primer.

Kidney neutral glycolipids were isolated and identified as described previously (6). Briefly, total glycolipids were extracted from kidneys in a chloroform/methanol mixture. The neutral glycolipid fraction was eluted from a DEAE-Sephadex A-25 column and subjected to mild alkaline treatment. After neutralization, the neutral glycolipid fractions were desalted on a Sephadex LH-20 column and analyzed by TLC. Glycolipids were visualized by spraying the TLC plates with an orcinolsulfuric acid reagent and heating at 110 °C.

Microsomal fractions of mouse kidneys were prepared as described previously (9). Protein content was determined using the BCA reagent (Pierce). The protein samples (20 µg) were applied to an SDS-polyacrylamide 3-15% gradient gel, electrophoresed, and blotted to an Immobilon-P membrane (Millipore Corp.). The IgM monoclonal antibody SA024, which recognizes the carbohydrate epitope Galbeta1-4(Fuc{alpha}1-3)GlcNAcbeta1-6(Galbeta1-3)GalNAc, and horseradish peroxidase-conjugated anti-mouse IgM antibody were used. Peroxidase activity was detected with the ECL kit (Amersham Biosciences).

Modification of the BAC Clone by Homologous Recombination in Escherichia coli—The BAC clone that contained Gsl5 was modified to replace the core 2 GnT gene with the EGFP reporter gene using an inducible homologous recombination system, GET recombination, in E. coli (11).

The 6578-bp pGETrec plasmid, which contains the E. coli recE and recT genes and the bacteriophage {lambda} gam gene in a polycistronic operon (donated by Dr. P. A. Ioannou, The Royal Children's Hospital, Melbourne, Australia), was electroporated into E. coli DH10B that carried the BAC clone. The DH10B cells that carried both the BAC clone and pGETrec were prepared for recombination. The expression levels of the recE, recT, and gam genes were induced by the addition of L-arabinose to a final concentration of 0.2% (w/v) for an additional 40-min incubation. The cells were harvested and made electrocompetent (10).

The PCR product that contained the EGFP/kanr cassette was amplified using the GNT-egfp and GNT-kana primers (Table 1). In Table 1, the capital letters (50 nt) correspond to the homology-targeting arms of the genomic sequences, and the lowercase letters refer to those used for primer amplification of the EGFP/kanr cassette. The pEGFP-N3 vector (Clontech) was used as the template. The purified PCR product (300-500 ng) was then electroporated into the DH10B cells that carried both the BAC clone and pGETrec (12). PCR screening was performed to identify recombinant clones using the combination of primer sets designed for the sequences of the BAC clone and the inserted PCR product.

We obtained one recombinant clone in which the EGFP/kanr cassette replaced the core 2 GnT gene. The modified BAC DNA was digested with SacII or SalI and analyzed by pulse field gel electrophoresis (PFGE) (10). The closed circular form of the recombinant BAC DNA was purified and microinjected into pronucleus stage oocytes obtained from C57BL/6 mice, as described above for the original BAC clone.

To identify transgenic mice, PCR analysis was performed with the GNT-22 and EGFP-R primers. The 707-bp fragment of the EGFP gene was amplified by PCR using the EGFP-1 and EGFP-6 primers with kidney total RNA as the template. To ensure that the PCR products were not derived from some contamination of the genomic DNA, a negative control reaction without reverse transcriptase was performed.

Three transgenic mouse lines were established by mating each founder animal with C57BL/6 mice. An MZ FLIII fluorescence stereomicroscope (Leica) with a filter for green fluorescent protein was used for the histological observations.

Sequencing of the BAC Clone and the Corresponding DBA/2 Genomic DNA—The BAC clone was digested with BssHII and SalI. A 40-kb fragment from the 5' end of the clone, which included exon 1 and intron 1 of the core 2 GnT gene, was subcloned and sequenced using the BigDye Terminator cycle sequencing kit (Applied Biosystems) and the ABI PRISM 377 sequencer (Applied Biosystems). PCR products that corresponded to those of the BAC clone were obtained from the DBA/2 genomic DNA and were analyzed.

Gsl5-EGFP Transgenesis—Using the BAC clone that included the core 2 GnT gene as the template, a PCR product was amplified with the GNT-103 and GNT-170Xho primers and was digested with XhoI. Another PCR product, which contained exon 1 of the core 2 GnT gene and its immediate 5'-flanking region, was amplified with the GNT-22Xho and GNT-23Hd primers and was digested with XhoI and HindIII. These fragments were purified using the QIAquick gel extraction kit (Qiagen). The pEGFP-N3 plasmid was digested with HindIII and DraIII. The fragment that included the EGFP gene was ligated with the two PCR fragments described above. The Gsl5-EGFP construct was then amplified by PCR using the GNT-103 and EGFP-3 primers with the ligated DNA as template, purified using the QIAquick gel extraction kit, and microinjected at a concentration of 3 ng/µl in TE buffer into pronucleus stage oocytes from C57BL/6 mice. A Gsl5-EGFP transgenic mouse was identified and established by mating the founder animal with C57BL/6 mice.

Cryostat sections (10 µm thick) from unfixed frozen kidney samples of the transgenic mouse were placed on poly-L-lysine-coated slides, dried for 5 min at room temperature, and then exposed for 16 h at -20 °C to the vapor of formaldehyde produced from a filter paper soaked in 37% formaldehyde solution in a tightly closed plastic box (13). After fixation, the sections were washed with TBS-Ca buffer (50 mM Tris-HCl (pH 7.6), 150 mM NaCl, 1 mM CaCl2). An MZ FLIII fluorescence stereomicroscope (Leica) with a filter for green fluorescent protein was used. Then the sections were incubated, after preincubation in TBS-Ca buffer containing 10% goat serum, with rabbit polyclonal antibody against keyhole limpet hemocyanin-conjugated C-terminal peptide, (C)TATEDTFKDTANLVKEDSDV, of mouse megalin which is a member of low density lipoprotein receptor and is localized at the proximal tubule cells (14), and stained with goat anti-rabbit IgG conjugated with Alexa Fluor 543 (Molecular Probes). The stained sections were observed under an LSM510 laser scanning confocal microscope (Carl Zeiss).

For Western blotting of the EGFP protein, kidney homogenates were subjected to SDS-PAGE (10% polyacrylamide gel). The affinity-purified anti-EGFP monoclonal antibody JL-8 was purchased from Clontech. The secondary antibody was peroxidase-conjugated anti-mouse IgG (Santa Cruz Biotechnology), and the ECL Advance system (Amersham Biosciences) was used for visualization.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
BAC Rescue Experiments—The transgenesis of DBA/2 mice with a 159-kb BAC clone (BAC367O1) that contains the core 2 GnT gene rescued the defective kidney-specific transcription of the enzyme (Fig. 1A). The core 2 GnT gene consists of at least six exons spanning about 45 kb and produces three alternatively spliced transcripts (8). The kidney-type transcript is composed of exons 1-3; the ubiquitous-type contains exons 1', 2, and 3, as well as an additional transcript, which was cloned from MDAY-Dw33 cells established from a DBA/2 mouse and encompasses exons 1''-1, 1''-2, 2, and 3.3 Exons 2 and 3 are common to these three transcripts. The coding region is included only in exon 3, which indicates that the same protein is produced from the three different transcripts. BAC367O1 has 24 kb of the 5'-flanking region of exon 1, 45 kb of exons 1-3, and 90 kb of the 3'-flanking region of exon 3, giving a total size of 159 kb.


Figure 1
View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 1.
Transgenesis of DBA/2 mice with the BAC clone. A, the BAC clone BAC367O1 used for the transgenesis includes the core 2 GnT gene, which consists of six exons. E1-E3, exons 1-3 of core 2 GnT; arrows indicate the primers used for the PCR analysis. B, PCR analysis with the BAC vector-specific primers BAC-1 and -2 and with genomic DNA or BAC DNA as the template. C, RT-PCR analysis of kidney-type mRNA (kid) with the GNT-28 and -38 primers, and of the ubiquitous-type mRNA (ubiq) with the GNT-29 and -38 primers. Kidney total RNA was used as the template. D, the kidney neutral glycolipids of transgenic mice visualized with orcinol reagent. E, Western blot of the kidney microsomal fractions of transgenic mice reacted with antibody against the anti-core 2 LeX epitope. Lanes 1-6, six F1s of the transgenic mouse; D, DBA/2 mouse; B, BALB/c mouse; G, glycolipid extract of bovine brain as the standard; BAC, BAC367O1; GalCer, Galbeta1-ceramide; GM1, Galbeta1-3GalNAcbeta1-4(NeuAc{alpha}2-3)Galbeta1-4Glcbeta1-ceramide; GD1a, NeuAc{alpha}2-3Galbeta1-3GalNAcbeta1-4(NeuAc{alpha}2-3)Galbeta1-4Glcbeta1-ceramide; GD1b, Galbeta1-3GalNAcbeta1-4(NeuAc{alpha}2-8NeuAc{alpha}2-3)Galbeta1-4Glcbeta1-ceramide; GT1b, NeuAc{alpha}2-3Galbeta1-3GalNAcbeta1-4(NeuAc{alpha}2-8NeuAc{alpha}2-3)Galbeta1-4Glcbeta1-ceramide. The results indicate that 1-4 F1 mice are transgenic.

 
The transgenic mice that carried the BAC vector sequence in their genomic DNA expressed the kidney-type transcript of core 2 GnT as well as the ubiquitous-type transcript in their kidneys (Fig. 1, B and C). Four of six transgenic F1 offspring were transgenic. These mice expressed the GL-Y glycolipid and glycoproteins that incorporated the core 2-LeX, which are expressed in dominant-type mice but not in DBA/2 mice (Fig. 1, D and E). The two nontransgenic F1 mice expressed neither GL-Y nor the glycoproteins.


Figure 2
View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 2.
Modification of the BAC 367O1 clone by the homologous recombination system. A, strategy for targeted BAC modification. E1-E3, exons 1-3 of the core 2 GnT gene in BAC 367O1; Sal, SalI site; Sac, SacII site; Bss, BssHII site. The arrows indicate the primers for PCR analysis. Light gray boxes a and b correspond to the homology-targeting arms of core 2 GnT. a, 5'-GTGGAGGGAAAGAACCTGGAACCCAATGAAACCTTGATTTTAATGGGTTT-3', which is the 5'-terminal sequence of exon 1; b, 5'-CTGATTAGTTCTCGAGGCTGACATTTTTCACTGGCCTCTTTCCCAATCAC-3', which is the 3'-noncoding region of exon 3. The checkered box indicates the EGFP/kanr cassette. The EGFP/kanr cassette replaces the core 2 GnT gene in the modified BAC clone, rBACegfp. B, PCR analysis of the BAC367O1 and rBACegfp clones. The primer sets are shown on top. C, PFGE analysis of the BAC367O1 and rBACegfp clones, which were digested with SacII or SalI and subjected to PFGE. The SacII 53- and 29-kb fragments and the SalI 9- and 72-kb fragments in the original BAC disappeared, and the new SacII 40-kb and SalI 35-kb fragments were detected. Std-1, 100-bp DNA ladder; Std-2, 8-48-kb DNA size standard; Std-3, {lambda} EcoT14I digest.

 


Figure 3
View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 3.
Transgenic rBACegfp mice. A, PCR analysis of genomic DNA with the primer set GNT-22 and EGFP-R. Three lines of transgenic mice, 9, 14, and 27, were established. WT indicates the nontransgenic wild type. B, RT-PCR analysis of the transgenic mouse kidney. EGFP mRNA was reverse-transcribed and detected in a subsequent PCR with the primer set EGFP-1 and EGFP-6, and core 2 GnT mRNA was detected using GNT-26 and GNT-38. RT+ and RT- indicate with and without reverse transcriptase. C, fluorescence stereoscopy of the kidney of a transgenic mouse. Strong fluorescence is localized in the cortex adjacent to the medulla.

 
Modification of the BAC Clone by Homologous Recombination—We modified the BAC clone using the homologous recombination system in its host E. coli strain DH10B. The targeting arm of the GNT-egfp primer was designed for exon 1 of the core 2 GnT gene and that of GNT-kana was designed for the 3'-noncoding region of the core 2 GnT gene, so that the core 2 GnT gene (45 kb) was replaced with the EGFP/kanr cassette (2857 bp) (Fig. 2A). Electroporation of the EGFP/kanr cassette followed by selection with chloramphenicol and kanamycin resulted in the isolation of a number of clones that were resistant to both antibiotics. However, we obtained only one clone (rBACegfp) that showed PCR products that spanned the recombination junctions, which were amplified with the primer sets GNT-22/EGFP-R and kana-s/GNT-3' (Fig. 2B). The recombinant also contained the EGFP gene (EGFP-1/EGFP-6 primer set) but not the core 2 GnT gene (GNT-26/GNT-38). PFGE analysis demonstrated that the SacII 53- and 29-kb fragments and the SalI 9- and 72-kb fragments in the original BAC disappeared, and the new SacII 40-kb and SalI 35-kb fragments were detected, indicating that the SacII and SalI restriction sites in exon 3 of the core 2 GnT gene were deleted (Fig. 2C).

The rBACegfp construct was introduced into mice, generating three transgenic lines (Fig. 3A). RT-PCR analysis showed that each rBACegfp transgenic line expressed EGFP mRNA (Fig. 3B) in the kidneys. Fluorescence stereomicroscopy detected EGFP fluorescence in the corticomedullary region of the kidney (Fig. 3C). EGFP was not detected in the kidney medulla.

Sequencing of the BAC Clone and the Corresponding DBA/2 Genomic DNA—The alignment of the 24-kb sequence, which includes the region 5'-upstream of the core 2 GnT gene in BAC367O1, and the DBA/2 genome revealed five deletions and four insertions of >20 nt as well as a number of single nucleotide polymorphisms in the DBA/2 genome (data not shown). Two exons of the riboflavin kinase (Rfk) gene were detected at the 5' end of the BAC clone in the reverse direction, which represents the border of the core 2 GnT gene.

There was no significant difference in the sequences of exon 1 and its immediate flanking region extending up to -400 bp of the core 2 GnT gene between BAC367O1 and the DBA/2 genome (AB219562 [GenBank] and AB219563 [GenBank] ). The TATA box was detected in both sequences at about 30 bp upstream of exon 1, where the kidney-type mRNA is transcribed as reported in previous paper (8). We found that DBA/2 contained an ~350-bp deletion at 5.5 kb upstream of exon 1 (AB219561 [GenBank] ). The corresponding region of BAC367O1 included a unique tandem repeat (AB219560 [GenBank] ) (Fig. 4A), which consisted of a GT-rich, 16-nt unit (A,TGTGTGTGTGTATGTA) plus a GT-rich, 36-nt unit (B, TGGGTTTGTGTGTATGTGTT-TGTGTGGTTATATGTA). BAC367O1 contained these units repeated eight times: A-B-A'-B-A-B-B-A-B'-A-B'-A-B-A-B-A', where A' (TGTGTGTGTATGTA) is 2 nt shorter than A, and B' has a C substitution for the T of TGGGTTT...in B. In contrast, DBA/2 had only one A''-B'', in which A'' (TGTGTGTGTTAGTGTATGTA) is 4 nt longer than the wild-type A, and B'' has an A substitution for the G of TGGGTTTGTGTGTATG... in B. We performed PCR analysis to determine the correlation between this tandem repeat and the expression of GL-Y in the inbred strains of mice that lacked GL-Y in their kidneys, i.e. MSM, JF1, BLG2, KJR, CHD, and SWN. All six strains had the same deletion. Mus spretus, which is the closest species to M. musculus, which does not express GL-Y, also had this deletion. On the other hand, A/Wy, BALB/c, C57BL/6, and PGN/2 mice that expressed GL-Y in their kidneys had PCR products of the same length as that of BAC367O1 (Fig. 4B). These correlations support the notion that this deletion is a candidate for the recessive Gsl5.


Figure 4
View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 4.
DBA/2 mice have a deletion located about 5. 5 kb upstream of the core2 GnT exon 1. A, scheme demonstrates the tandem repeat of the wild-type mice and the deletion of DBA/2 mice. Each oval represents a repeated unit: A, A', B, B', A'', and B''. Several binding sites for known trans-acting proteins are indicated. B, PCR products obtained with the GNT-103 and GNT-94 primers, which were designed to include the deletion in the DBA/2 genome. Inbred strains of mice without GL-Y expression in their kidneys show the same genomic deletion as that observed in the DBA/2 genome. Those mice that express GL-Y show the same banding pattern as BAC367O1.

 
Gsl5-EGFP Transgenesis—The Gsl5-EGFP construct shown in Fig. 5, A and B (AB234879 [GenBank] ), was introduced into C57BL/6 oocytes, and one transgenic line was established. RT-PCR analysis showed that the expression of EGFP was restricted to the kidney (Fig. 5C). Although the submaxillary gland showed slight contamination of the genomic DNA, we could not find EGFP mRNA in the liver, spleen, submaxillary gland, heart, or lung tissues of the transgenic mouse.

EGFP fluorescence was detected in the proximal tubule cells in the corticomedullary region of the kidney (Fig. 6A). EGFP was not detected in either the medulla or outer cortex regions. Confocal microscopy at a higher magnification demonstrated that EGFP was localized at the proximal straight tubule cells, and megalin distribution at the luminal side of proximal tubule cells supported the EGFP localization (Fig. 6B). Western blotting with the anti-EGFP antibody confirmed that EGFP protein was expressed in the kidneys of transgenic mice (Fig. 6C). Thus, we were able to establish a transgenic mouse line that expresses EGFP in the kidneys.

Taken together, these results demonstrate that the Gsl5-EGFP construct contains a kidney-specific cis-element and that A-B-A''-B-A-B-B-A-B'-A-B'-A-B-A-B-A' is absolutely required for the transcription of the core 2 GnT gene in a proximal straight tubule cell-specific manner.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
We cloned the mouse core 2 GnT cDNA, showed that this gene is transcribed in a kidney-specific manner (8), and investigated the elements involved in the regulation process defined by Gsl5. During a search for the core 2 GnT gene, we obtained a clone containing the 5' end of the kidney-type cDNA from a {lambda} library of the mouse genome. This clone included about 4.5 kb of the 5'-upstream region of the transcriptional start site of kidney-type cDNA and had a TATA box-like sequence at about -30 nt. However, in our preliminary promoter assays using primary cultures of mouse kidney proximal tubule cells and luciferase as the reporter, we did not find any promoter activity in the 5'-upstream region of exon 1 of the core 2 GnT gene, even up to about -4500 nt (data not shown). As the primary culture rapidly lost the expression of kidney-type mRNA, promoter activity was assayed although mRNA expression was still maintained. The 5'-upstream region of the 4.5-kb fragment seemed to be insufficient. To investigate further the longer 5'- and 3'-flanking regions of the core 2 GnT gene, we used BAC-mediated transgenesis. BAC clones can stably maintain DNA fragments of up to 300 kb (16) and are known to be useful in identifying cis-regulatory elements that lie far from the coding region (17, 18).

The BAC clone BAC367O1, which contains the core 2 GnT gene, was able to rescue the defective phenotype of DBA/2 in terms of the kidney-specific transcription of the gene, which suggests that the Gsl5 locus that plays a key role in the transcriptional regulation of core 2 GnT is contained within this clone. Exon 1, which is transcribed in a kidney-specific manner, is located the farthest 5'-upstream, and the Gsl5-deficient DBA/2 mice retain the ubiquitous-type mRNA, which is transcribed from exon 1', located 17 kb downstream of exon 1. Gsl5 should lie either 5'-upstream of exon 1 on BAC367O1 or in intron 1 between exons 1 and 1'. BAC engineering using the GET recombination system excluded the possibility that Gsl5 is in intron 1. The engineered BAC clone, rBACegfp, has the EGFP gene inserted between exon 1 and the 3' end of the core 2 GnT gene, and it expresses EGFP in a kidney-specific manner, despite lacking the region between intron 1 and exon 3 of the core 2 GnT gene. Therefore, Gsl5 is located 5'-upstream of the 24-kb fragment. As a reporter, EGFP has the advantage of being directly visualized in vivo with high sensitivity and without any further treatments (19).

We analyzed the 24-kb upstream region of exon 1 and the corresponding genomic DNA sequence of DBA/2 mice. A candidate for Gsl5 was located about 5.5 kb upstream of exon 1, where the unique sequence was tandemly repeated eight times in BAC367O1. However, a similar sequence was repeated only once in the DBA/2 genome. We found binding sites for several known trans-acting factors, such as CCAAT/enhancer binding protein (C/EBP), human runt-factor AML-1 (AML-1), mouse HFH-8 (HNF-3/Fkh homolog-8), sex-determining region Y gene product (SRY), yeast RAP1 (repressor/activator protein 1), and Drosophila CF2-II (chorion transcription factor), in the repeated sequence by means of a computer search of GenomeNet using the MOTIF program. Only five repeats are described in the mouse genome sequences in the EMBL/GenBank/DDBJ databases, and the comment of "unresolved tandem repeat" is annotated for that region (AC147369 [GenBank] ). Nevertheless, the present study of PCR product length (Fig. 4B) and our sequencing data confirm that there are eight repeats in the BAC clone and in the genomes of several different strains of mice.


Figure 5
View larger version (57K):
[in this window]
[in a new window]
  		FIGURE 5.
The Gsl5-EGFP construct. A, scheme represents the Gsl5-EGFP construct. The left box is the Gsl5 candidate region, and the inner shaded box represents the deletion detected in the DBA/2 genome. The striped box is the 5'-flanking region of core 2 GnT gene. The EGFP box represents the EGFP structure gene. Arrows indicate the primers for PCR. B, the sequence of the Gsl5-EGFP construct. Arrows indicate the primers, GNT-103, GNT-170Xho, GNT-22Xho, and GNT-23Hd, from top to bottom. The deletions in DBA/2 mouse genome are shaded. The repetitive sequence shown in Fig. 4 is located between the asterisks. Exon 1 of core 2 GnT is boxed, and TATA box is underlined. The 5'-terminal sequence of EGFP gene is indicated in boldface and includes start codon (ATG). Lowercase letters ctcgag indicate the junction between the PCR fragments obtained with GNT-103/GNT-170Xho and GNT-22Xho/GNT-23Hd, and lowercase letters aagctt represent the junction between the GNT-22Xho/GNT-23Hd fragment and EGFP gene. The complete sequence of the construct is registered in the GenBankTM/DDBJ with the accession number AB234879 [GenBank] . C, RT-PCR analysis of various tissues from a Gsl5-EGFP transgenic mouse and the kidney from a wild-type mouse. The following primers were used: EGFP-1 and EGFP-R for EGFP mRNA; GNT-28 and GNT-38 for core 2 GnT (kidney-type mRNA); and GNT-26 and GNT-38 for core 2 GnT (all three transcripts). Tg, transgenic mouse; kid, kidney; WT, wild-type mouse (nontransgenic).

 
The mRNAs for mouse 25-hydroxyvitamin D-1 {alpha}-hydroxylase (20) and {gamma}-glutamyl transpeptidase type II (21) are mainly expressed in kidney proximal tubules, and their cis-acting elements have been reported as TCF-1 (ternary complex factor-1) and AP2 (glucocorticoid-response element) in the 5'-flanking region close to the transcription start site. The glucose transporter Sglt2 promoter, consisting of the first exon, the first intron, and a part of the second exon, was successfully used for establishing a transgenic mouse carrying the Sglt2 promoter-Cre recombinase and was applied to make transgenic mice with the proximal tubule cell-specific expression of beta-galactosidase (22). However, there has been no report on the unique GT-rich repeat that includes cis-elements for several binding proteins in an overlapping arrangement. We have named this the Gsl5 regulatory element. The repeated binding sites for the trans-acting factors may be critical for highly enhanced transcription, like that of the kidney-type core 2 GnT. This type of tandem repeat in transcriptional enhancers has been reported in fungi, in which it mediates fungicide resistance (23). The tandem repeat in combination with the TATA box-like sequence in the immediate 5'-flanking region of exon 1 may also be critical and may represent a useful tool for the expression of genes of interest in mouse kidney proximal tubules. In our preliminary gel-shift assay, both the wild-type and deficient DBA/2 mice had a binding protein with specificity for this repeat in their kidneys (data not shown). Further analysis is required to determine which trans-acting factors are involved in mouse kidney proximal straight tubule cell-specific regulation.


Figure 6
View larger version (47K):
[in this window]
[in a new window]
  		FIGURE 6.
Detection of EGFP in the Gsl5-EGFP transgenic mouse kidney. A, fluorescence stereomicroscopy of a kidney section from the transgenic mouse. EGFP fluorescence is detected in the cortex adjacent to the medulla, where proximal straight tubule cells are distributed. B, confocal microscopy of a section of the same kidney. a, EGFP is detected in the proximal straight tubule cells; b, megalin stained with polyclonal antimegalin antibody is detected at the luminal side of the proximal tubule cells; c, merged image confirms that EGFP is localized at proximal straight tubule cells. C, Western blot with the anti-EGFP antibody. Ten and 20 µg of the kidney homogenates from the transgenic (Tg) and wild-type (WT) mice were applied.

 
We evaluated whether the candidate region had kidney-specific promoter activity, using the DNA construct that contained the candidate sequence, the 5'-flanking region of the exon 1, and the EGFP gene as a reporter. With the PCR-based construct, we generated transgenic mice that expressed EGFP in their kidneys. EGFP was restricted to the proximal tubule cells and was not detected in either the glomeruli in the cortex or the collecting duct cells in the medulla. At high magnification under confocal microscopy, EGFP was localized to the proximal straight tubular cells. In our previous study, the kidney-type mRNA of the core 2 GnT gene was expressed mainly in the part of the cortex adjacent to the medulla, as assessed by in situ hybridization, and the signal pattern was identical to that of the proximal tubule cells (9). Therefore, we conclude that the identified region contains an indispensable element for kidney proximal straight tubule cell-specific transcription.

Reports on in vivo tissue-specific transcriptional regulation related to glycobiology are very limited, and successful demonstration has been reported for the mouse beta-1,4-galactosyltransferase I gene (24-26). This gene produces one housekeeping and two tissue-specific transcripts. One of the two is a mammary gland-specific transcript, which is regulated by a target region for multiple factors including AP2, a mammary gland-specific form of CTF/NF, SP1, and a negative regulatory factor (24). The other is related to a male germ cell-specific regulation, which includes two putative CRE-like motifs (25). Then a unique 14-bp regulatory element located 16 bp upstream of the transcriptional start site was determined to be essential for the regulation of late pachytene spermatocyte-specific transcript and was named TASS-1 (transcriptional activator in late pachytene spermatocytes and round spermatids 1) (26). TASS-1 has been suggested to be a novel member of the Ets family of transcription factors. Although the tissue-specific glycan structures of glycolipids and glycoproteins have been analyzed extensively, most of the molecular mechanisms responsible for these structures remain to be uncovered. Our present study reveals a molecular mechanism that is specific to mouse proximal straight tubules. The transgenic experiments used in this study are evidently essential methods in elucidating these molecular mechanisms.

Core 2 GnT catalyzes the transfer of the beta-GlcNAc residue to Galbeta1-3GalNAc- and plays a key role in creating the branching core 2 structure, GlcNAcbeta1-6(Galbeta1-3)GalNAc-. In addition, the formation of the core 2 structure is essential for further elongation of the carbohydrate chains. Three different core 2 beta-1,6-GlcNAc transferases, termed core 2 GnT-I, -II, and -III, have been reported in humans (27-29). The mouse core 2 GnT is a homolog of human core 2 GnT-I. We have described two alternatively spliced transcripts in the mouse (8), whereas the human core 2 GnT-I gene has five mRNAs that are different in their 5'-untranslated regions (30). Their 5'-terminal exons are expressed in a tissue-specific manner, although none of the transcripts are restricted to the kidney. Therefore, the regulation of core 2 GnT-I by Gsl5 is mouse-specific, because it does not seem to be conserved among other mammals.

Transgenic mice that express the core 2 GnT-I gene under the control of the T cell-specific promoter lck exhibit a reduced immune response in delayed type hypersensitivity (31), and core 2 GnT-I-targeted mice exhibit a restricted phenotype with neutrophilia and partial deficiency of selectin ligands (32). The expression of sialyl-LeX, which is one of the physiologically relevant selectin ligands, is controlled by fucosyltransferase FucT-VII during lymphocyte differentiation or activation (33), and core 2 GnT-I, but not GnT-II or GnT-III, is also required to express sialyl-LeX on glycoproteins in human precursor B cells (15). These reports suggest physiological functions for core 2 GnT-I in the immune system. However, the functions of proximal straight tubule cell-specific and mouse-specific regulation of core 2 GnT-I gene are not clear.

DBA/2 mice that lack the kidney-type mRNA of core 2 GnT-I, the GL-Y glycolipid, and glycoproteins that bear the core2-LeX carbohydrate structure do not exhibit any kidney dysfunction under normal conditions. It is possible that the functional significance of the proximal straight tubule cell-specific enhancement of core 2 GnT mRNA could be revealed under certain stress conditions.

In conclusion, we have used the combination of BAC engineering, in vivo promoter assays, and transgenesis to characterize Gsl5, which is composed of a unique tandem repeat, as a cis-regulatory element that is essential for kidney proximal straight tubule cell-specific transcription of the mouse core 2 GnT gene.


   FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the DDBJ/GenBankTM/EBI Data Bank with accession number(s) AB219560 [GenBank] to AB219563 [GenBank] and AB234879 [GenBank] .

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: RIKEN Frontier Research System, 2-1 Hirosawa, Wako-shi, Saitama, 351-0198, Japan. Tel.: 81-48-467-9615; Fax: 81-48-462-4692; E-mail: aksuzuki{at}riken.jp.

2 The abbreviations used are: GL-Y, Galbeta1-4(Fuc{alpha}1-3)GlcNAcbeta1-6(Galbeta1-3)GalNAcbeta1-3Gal{alpha}1-4Galbeta1-4Glcbeta1-ceramide; core 2 GnT, core 2 beta-1,6-N-acetylglucosaminyltransferase; BAC, bacterial artificial chromosome; EGFP, enhanced green fluorescent protein; PFGE, pulse field gel electrophoresis; RT, reverse transcription; GL-X, Galbeta1-3GalNAcbeta1-3Gal{alpha}1-4Galbeta1-4Glcbeta1-ceramide; LeX, Lewis X antigen; nt, nucleotide. Back

3 C. E. Warren, GenBankTM accession number MMU19265. Back


   ACKNOWLEDGMENTS
 
We thank Dr. P. A. Ioannou, The Royal Children's Hospital, Melbourne, Australia, for the kind donation of the pGETrec vector, Dr. R. Kannagi, Aichi Cancer Center, for sending us the monoclonal antibody SA024, and Dr. D. M. Marcus, Baylor College of Medicine, for assistance with the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lowe, J., and Marth, J. (2003) Annu. Rev. Biochem. 72, 643-691[CrossRef][Medline] [Order article via Infotrieve]
  2. Haltiwanger, R., and Lowe, J. (2004) Annu. Rev. Biochem. 73, 491-537[CrossRef][Medline] [Order article via Infotrieve]
  3. Varki, A. (1993) Glycobiology 3, 97-130[Abstract/Free Full Text]
  4. Sekine, M., Hashimoto, Y., Inagaki, F., Yamakawa, T., and Suzuki, A. (1990) J. Biochem. (Tokyo) 108, 103-108[Abstract/Free Full Text]
  5. Sekine, M., Sakaizumi, M., Moriwaki, K., Yamakawa, T., and Suzuki, A. (1989) J. Biochem. (Tokyo) 105, 680-683[Abstract/Free Full Text]
  6. Sekine, M., Kikkawa, Y., Takahama, S., Tsuda, K., Yonekawa, H., and Suzuki, A. (2002) J. Biochem. (Tokyo) 132, 387-393[Abstract/Free Full Text]
  7. Sekine, M., Hashimoto, Y., Suzuki, M., Inagaki, F., Takio, K., and Suzuki, A. (1994) J. Biol. Chem. 269, 31143-31148[Abstract/Free Full Text]
  8. Sekine, M., Nara, K., and Suzuki, A. (1997) J. Biol. Chem. 272, 27246-27252[Abstract/Free Full Text]
  9. Sekine, M., Taya, C., Kikkawa, Y., Yonekawa, H., Takenaka, M., Matsuoka, Y., Imai, E., Izawa, M., Kannagi, R., and Suzuki, A. (2001) Eur. J. Biochem. 268, 1129-1135[Medline] [Order article via Infotrieve]
  10. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., pp. 1.119-1.122, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  11. Narayanan, K., Williamson, R., Zhang, Y., Stewart, A. F., and Ioannou, P. A. (1999) Gene Ther. 6, 442-447[CrossRef][Medline] [Order article via Infotrieve]
  12. Orford, M., Nefedov, M., Vadolas, J., Zaibak, F., Williamson, R., and Ioannou, P.A. (2000) Nucleic Acids Res. 28, 84
  13. Jockusch, H., Voigt, S., and Eberhard, D. (2003) J. Histochem. Cytochem. 51, 401-404[Abstract/Free Full Text]
  14. Zou, Z., Chung, B., Nguyen, T., Mentone, S., Thomson, B., and Biemesderfer, D. (2004) J. Biol. Chem. 279, 34302-34310[Abstract/Free Full Text]
  15. Kikuchi, J., Shinohara, H., Nonomura, C., Ando, H., Takaku, S., Nojiri, H., and Nakamura, M. (2005) Glycobiology 15, 271-280[Abstract/Free Full Text]
  16. Shizuya, H., Birren, B., Kim, U. J., Mancino, V., Slepak, T., Tachiiri, Y., and Simon, M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 8794-8797[Abstract/Free Full Text]
  17. Nielsen, L. B., McCormick, S. P., Pierotti, V., Tam, C., Gunn, M. D., Shizuya, H., and Young, S. G. (1997) J. Biol. Chem. 272, 29752-29758[Abstract/Free Full Text]
  18. Antoch, M. P., Song, E. J., Chang, A. M., Vitaterna, M. H., Zhao, Y., Wilsbacher, L. D., Sangoram, A. M., King, D. P. Pinto, L. H., and Takahashi, J. S. (1997) Cell 89, 655-667[CrossRef][Medline] [Order article via Infotrieve]
  19. Yu, Y. A., Szalay, A. A., Wang, G., and Oberg, K. (2003) Luminescence 18, 1-18[CrossRef][Medline] [Order article via Infotrieve]
  20. Yoshida, T., Yoshino, J., Hayashi, M., and Saruta, T. (2002) J. Am. Soc. Nephrol. 13, 1455-1463[Abstract/Free Full Text]
  21. Sepulveda, A. R., Huang, S. L., Lebovitz, R. M., and Lieberman, M. W. (1997) J. Biol. Chem. 272, 11959-11967[Abstract/Free Full Text]
  22. Rubera, I., Poujeol. C., Bertin, G., Hasseine, L., Counillon, L., Poujeol, P., and Tauc, M. (2004) J. Am. Soc. Nephrol. 15, 2050-2056[Abstract/Free Full Text]
  23. Hamamoto, H., Hasegawa, K., Nakaune, R., Lee, Y. J., Makizumi, Y., Akutsu, K., and Hibi, T. (2000) Appl. Environ. Microbiol. 66, 3421-3426[Abstract/Free Full Text]
  24. Shaper, N. L., Harduin-Lepers, A., and Shaper, J. H. (1994) J. Biol. Chem. 269, 25165-25171[Abstract/Free Full Text]
  25. Rajput, B., Shaper, N. L., and Shaper, J. H. (1996) J. Biol. Chem. 271, 5131-5142[Abstract/Free Full Text]
  26. Charron, M., Shaper, N. L., Rajput, B., and Shaper, J. H. (1999) Mol. Cell. Biol. 19, 5823-5832[Abstract/Free Full Text]
  27. Bierhuizen, M. F., and Fukuda, M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9326-9330[Abstract/Free Full Text]
  28. Yeh, J. C., Ong, E., and Fukuda, M. (1999) J. Biol. Chem. 24, 3215-3221
  29. Schwientek, T., Yeh, J. C., Levery, S. B., Keck, B., Merkx, G., van Kessel, A. G., Fukuda, M., and Clausen, H. (2000) J. Biol. Chem. 275, 11106-11113[Abstract/Free Full Text]
  30. Falkenberg, V. R., Alvarez, K., Roman, C., and Fregien, N. (2003) Glycobiology 13, 411-418[Abstract/Free Full Text]
  31. Tsuboi, S., and Fukuda, M. (1997) EMBO J. 16, 6364-6373[CrossRef][Medline] [Order article via Infotrieve]
  32. Ellies, L. G., Tsuboi, S., Petryniak, B., Lowe, J. B., Fukuda, M., and Marth, J. D. (1998) Immunity 9, 881-890[CrossRef][Medline] [Order article via Infotrieve]
  33. Macher, B. A., Holmes, E. H., Swiedler, S. J., Stults, C. L., and Srnka, C. A. (1991) Glycobiology 1, 577-584[Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Am. J. Respir. Cell Mol. Bio.Home page
S. Tan and P.-W. Cheng
Mucin Biosynthesis: Identification of the cis-Regulatory Elements of Human C2GnT-M Gene
Am. J. Respir. Cell Mol. Biol., June 1, 2007; 36(6): 737 - 745.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/2/1008    most recent
M509307200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sekine, M.
Right arrow Articles by Yonekawa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sekine, M.
Right arrow Articles by Yonekawa, H.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement