JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M601264200 on March 16, 2006

J. Biol. Chem., Vol. 281, Issue 20, 14340-14349, May 19, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/20/14340    most recent
M601264200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by de Saro, F. J. L.
Right arrow Articles by O'Donnell, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by de Saro, F. J. L.
Right arrow Articles by O'Donnell, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The beta Sliding Clamp Binds to Multiple Sites within MutL and MutS*

Francisco J. López de Saro{ddagger}1, Martin G. Marinus§, Paul Modrich, and Mike O'Donnell{ddagger}||

From the {ddagger}The Rockefeller University and ||Howard Hughes Medical Institute, New York, New York 10021, the §Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School, Worcester, Massachusetts 01605, and the Department of Biochemistry, Howard Hughes Medical Institute, Duke University Medical Center, Durham, North Carolina 27710

Received for publication, February 9, 2006 , and in revised form, March 16, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The MutL and MutS proteins are the central components of the DNA repair machinery that corrects mismatches generated by DNA polymerases during synthesis. We find that MutL interacts directly with the beta sliding clamp, a ring-shaped dimeric protein that confers processivity to DNA polymerases by tethering them to their substrates. Interestingly, the interaction of MutL with beta only occurs in the presence of single-stranded DNA. We find that the interaction occurs via a loop in MutL near the ATP-binding site. The binding site of MutL on beta locates to the hydrophobic pocket between domains two and three of the clamp. Site-specific replacement of two residues in MutL diminished interaction with beta without disrupting MutL function with helicase II. In vivo studies reveal that this mutant MutL is no longer functional in mismatch repair. In addition, the human MLH1 has a close match to the proliferating cell nuclear antigen clamp binding motif in the region that corresponds to the beta interaction site in Escherichia coli MutL, and a peptide corresponding to this site binds proliferating cell nuclear antigen. The current report also examines in detail the interaction of beta with MutS. We find that two distinct regions of MutS interact with beta. One is located near the C terminus and the other is close to the N terminus, within the mismatch binding domain. Complementation studies using genes encoding different MutS mutants reveal that the N-terminal beta interaction motif on MutS is essential for activity in vivo, but the C-terminal interaction site for beta is not. In light of these results, we propose roles for the beta clamp in orchestrating the sequence of events that lead to mismatch repair in the cell.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The process of chromosomal replication can generate small deletions, insertions, or mismatches in newly synthesized DNA. If left unrepaired, post-replicative DNA damage can lead to genomic instability and increased rates of mutation (1, 2). These types of replicative errors are corrected by a set of enzymes that are specialized in performing DNA mismatch repair (MMR)2 and are conserved across all domains of life. In Escherichia coli it is estimated that the fidelity of replication is increased >100-fold by the action of MMR (3). In humans a deficiency in MMR has been linked to increased susceptibility to certain sporadic cancers (4-6).

The E. coli MutS protein is an essential component of MMR and it directly binds to abnormal DNA structures to initiate the cascade of events that lead to repair. These events include the removal of a segment of the newly synthesized DNA strand by the combined action of a helicase and one or more nucleases, and the re-synthesis of the resulting gap by a DNA polymerase (1). A second essential component of MMR in E. coli is MutL, which is thought to link the action of MutS with nucleases and a helicase (1, 7). However, although the individual components of MMR in prokaryotes and eukaryotes are mostly well described, many of the details of the repair mechanism are still poorly defined.

In eukaryotic organisms, MutS homologues MSH3 and MSH6 bind to the processivity factor PCNA (proliferating cell nuclear antigen) (8-12), a homotrimeric protein clamp essential in DNA replication, which therefore provides a link between the MMR and replication machineries. Fluorescence microscopy has revealed that MMR enzymes colocalize with active replication centers in the cell (13, 14). In addition, numerous genetic studies in yeast by Kolodner and collaborators show that a distinctive set of mutations in PCNA can result in MMR deficiency (15, 16). Conversely, mutation of the PCNA-binding motif in either MSH3 or MSH6 abolishes the interaction with the clamp and results in yeast strains with elevated mutation rates (11, 12). In bacteria, MutS has been shown to interact with the beta clamp, the processivity factor of DNA polymerase III (17).

PCNA and beta are ring-shaped proteins that bind to DNA by encircling it, and are generally referred to as "sliding clamps." Loading of PCNA and beta onto DNA requires the action of "clamp loaders" ({gamma}-complex in prokaryotes, replication factor C in eukaryotes), which are multisubunit ATPase machines that open the ring and place it around primed sites on DNA (18). The beta clamp tethers the replicase to DNA by binding it directly and sliding with it along DNA during chain elongation, converting it into a highly processive enzyme (19). In recent years it has become evident that sliding clamps interact with many other proteins involved in all aspects of DNA metabolism. Despite the diversity of the proteins that bind to PCNA or beta, the interaction often has a common structure: proteins typically bind to the clamp via N- or C-terminal flexible extensions containing a short motif (20, 21), and the interaction takes place at a hydrophobic pocket near the C terminus of the clamp. Detailed studies of the contact between clamps and their partners show that these interactions are often complex, with involvement of more than one binding surface, and in the case of PCNA even with mechanisms that regulate the interaction by post-translational modifications (22-25). In addition, because PCNA is trimeric and beta dimeric, it has been speculated that the ring could accommodate more than one ligand at the same time and therefore serve as a mobile platform that coordinates multiple enzymes performing sequential actions on DNA (22, 26).

What is the precise role of processivity clamps in mismatch repair? Because clamps are typically associated with DNA polymerases, and clamp loaders are integral components of the replication fork, clamps could be used for targeting the MMR machinery to "replication factories" that could therefore contain synthetic errors. A second possibility is that they participate directly in the mechanism of action of mismatch repair. For example, MSH2-MSH6 binds to PCNA in the absence of a mismatch but not in its presence, suggesting that PCNA could help the MSH complex locate the mismatch on DNA (12, 27). In addition, because clamps used by DNA polymerase have a distinct orientation on DNA, they could provide the MMR machinery with the means to discriminate between the parental DNA and the newly synthesized strands (2, 4).

In an effort to gain a deeper understanding of the interplay between MMR and replication, we investigated in greater detail the physical interactions between E. coli MutL and MutS and the beta clamp of DNA polymerase. We find that beta binds directly to MutL. Interestingly, MutL only interacts with beta in the presence of single-stranded (ss) DNA. Studies herein demonstrate that the site of contact with beta is located on a loop in the N-terminal ATP-binding domain of MutL. Mutation of two residues within this loop reduces interaction with beta, but does not influence MutL ATPase and function with helicase II. Mutation of these two residues abolish mismatch repair in vivo. In addition we have identified two points of contact on MutS that bind to beta, one at the N terminus and another at the C terminus. The C-terminal site has a strong affinity for beta, whereas the interaction with the N-terminal site is weak. Interestingly, only the N-terminal site is essential for mismatch repair in vivo. This work provides new insights into the role of beta in mismatch repair in the cell, and suggests that the clamp is an essential player. We propose that beta helps to order the sequence of events in this multistep repair pathway.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—High pressure liquid chromatography purified N-terminal biotinylated peptides were purchased from Bio-synthesis Inc. All other peptides were purchased from Chiron Mimotopes, which utilizes a synthetic method that leaves a diketopiperidine linker at the C terminus of the peptide. Streptavidin was purchased from Sigma. Labeled nucleotides were from PerkinElmer Life Sciences. Unlabeled nucleotides and AMPPNP were from Amersham Biosciences. Proteins were purified as follows: beta as described (28); beta containing a C-terminal 6-residue kinase recognition sequence and human PCNA with a 6-residue N-terminal tag were purified and labeled using [{gamma}-32P]ATP as described (29); pol III core was reconstituted from isolated subunits and purified from unbound proteins as described (30).

MutS and MutL Overexpression and Purification—The MutS gene was cloned into pET11c (Novagen) to yield pET-mutSwt. MutS mutants, MutSN (pET-mutSN) and MutSC (pET-mutSC), were generated using site-directed mutagenesis by the QuikChange method (Stratagene, La Jolla, CA). Constructs were sequenced before use. Purification of MutS and MutS derivatives was based on the procedure described earlier (31). For MutS and its derivatives, plasmids were transformed in E. coli BL21(DE3) and 12L of cells grown at 37 °C in LB media supplemented with 0.2% glucose and 50 µg/ml ampicillin. When the cell culture reached an A600 = 0.6, 1 mM isopropyl 1-thio-beta-D-galactopyranoside was added and after a further 2-h incubation the cells were harvested by centrifugation. Cells were resuspended in 50 ml of lysis buffer (20 mM KPO4, pH 7.5, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 10 mM dithiothreitol, 100 mM NaCl) and lysed using a French press at 4 °C. The lysate was clarified by centrifugation and the extract was mixed with a solution of 25% streptomycin sulfate (0.4 ml/1 ml of extract). After stirring, the precipitate was pelleted by centrifugation and the supernatant was treated with solid ammonium sulfate (0.180 g/ml) at 4 °C. After centrifugation, the precipitate was resuspended in buffer A (20 mM KPO4, pH 7.5, 1 mM EDTA, 10 mM dithiothreitol, 25 mM NaCl, 5% glycerol) and dialyzed in the same buffer. This dialysate was applied to a heparin-Sepharose chromatography column (150-ml bed volume) and eluted with a 500-ml linear gradient of NaCl (25-500 mM). Fractions were analyzed on a SDS-polyacrylamide gel and those containing MutS were pooled, dialyzed against Buffer A, and then applied to a 200-ml column of fast-flow S-Sepharose (Amersham Biosciences) equilibrated in Buffer A. The S-Sepharose column was eluted with a 600-ml NaCl gradient (25-500 mM) in buffer A. MutS-containing fractions were pooled, precipitated with ammonium sulfate, dialyzed against buffer A, and then stored at -80 °C.

The MutL gene was cloned in pET11c to yield pET-mutL. MutLLF in which residues Leu-150 and Phe-151 were replaced by alanine was constructed by site-directed mutagenesis (QuikChange) to yield pET-mutLLF. E. coli BL21(DE3) was transformed with pET-mutL or pET-mutLLF and grown, induced, and harvested as described above for MutS. MutL and MutLLF were purified as described (32) except that a fast-flow Q (Amersham Biosciences) column replaced the hydroxylapatite column.

Protein Gel Mobility Shift Assays—Native polyacrylamide gel electrophoresis assays using [32P]beta (150 dpm/fmol) were performed as described by López de Saro and O'Donnell (17). Reactions (15 µl) contained 20 mM Tris-Cl (pH 7.5), 0.1 mM EDTA, 4% glycerol, 50 µg/ml bovine serum albumin, 100 mM NaCl, 5 mM DTT, and 50 nM [32P]beta. Reactions also included peptide, streptavidin, MutS, DNA, MutL, or AMPPNP as indicated in the figure legends. Duplex DNA was a 300-mer duplex generated by PCR and gel purified, and ssDNA was a 90-mer synthetic oligonucleotide (5'-CCCCCTTATTAGCGTTTGCCATCTTTTCATAATCAAAATCACCGGAACCAGAGCCACCACCGGAACCGCCTCCCTCAGAGCCGCCACCCT-3'). After incubation at 37 °C for 5 min, 5 µl of the reaction was applied to a 4% native polyacrylamide gel (4% acrylamide-bisacrylamide 29:1, 1x TBE buffer, 5% glycerol). Electrophoresis was performed in 1x TBE buffer (89 mM Tris borate, 89 mM boric acid, 2 mM EDTA) at 19 mA for 90 min (4 °C). Gels were dried and detection of [32P]beta was performed using a PhosphorImager. Free and bound forms of [32P]beta were quantitated using ImageQuant software (Amersham Biosciences) and the percentage of bound [32P]beta obtained using the formula [32P]betabound = [32P]betabound x 100/[32P]betatotal. Concentrations of the addition of [32P]beta ligands are indicated in each figure.

Superdex 200 Chromatography—A 25-ml FPLC Superdex 200 column (Amersham Biosciences, separation range 10,000-600,000 Da) was used to analyze MutS and its derivatives. The column buffer contained 50 mM HEPES (pH 7.4), 1 mM EDTA, 100 mM NaCl, and 2 mM DTT. Wild-type MutS, MutS800, and MutSC were each loaded at a concentration of 25 µM in a volume of 200 µl. Fractions (420 µl) were collected and protein content measured by the Bradford assay (Bio-Rad), using bovine serum albumin as a standard.

Determination of Mutant Frequency—The wild-type strain used for the mutagenesis assay was AB1157 (F-thr-1 araC14 leuB6 {Delta}(gpt-proA)62 lacY1 tsx-33 supE44 galK2 hisG4 rfbD1 mgl-51 rpoS396 rpsL31 kdgK51 xylA5 mtl-1 argE3 thi-1) obtained from E. A. Adelberg (Yale University). Strains KM52 and KM75 (from K. C. Murphy, University of Massachusetts Medical School) were derived from AB1157 by replacement of the mutL and mutS coding regions by genes encoding chloramphenicol and tetracycline resistance, respectively (33). Strains were grown at 37 °C to saturation from single colonies in Brain Heart Broth (20 g/liter) supplemented with ampicillin (100 µg/ml) when required. To determine the frequency of rifampicin resistance, aliquots were spread on L plates with or without ampicillin (100 µg/ml) and onto L plates containing rifampicin (100 µg/ml) with or without ampicillin (100 µg/ml). The plates were incubated at 37 °C overnight before scoring. To determine Gal+papilation, 10-µl aliquots of the overnight cultures were spotted on MacConkey agar plates containing 0.2% galactose as the sole carbon source. The plates were scored after incubation for 3 days at 37 °C.

Construction of the mutSC Chromosomal Mutant—Strain GM8607, containing the mutSc chromosomal deletion was constructed as described by Calmann et al. (34) except that the strain used for Redmediated recombination was GM8496, which contains the cat gene inserted between codons 820 and 821 of the mutS gene (mutS820:cat). AmpR-CamS and AmpR CamR recombinants were recovered after electroporation, which contained the mutSc chromosomal deletion or mutS820::cat, respectively, as determined by DNA sequencing. P1vir transduction was used to move the mutSC mutation into AB1157 using AmpR as the selective marker and the resultant strain was designated GM8607.

ATPase Assays—Wild-type MutL or MutLLF (5 µM, as dimer) where incubated with or without a synthetic gel-purified 100-mer ssDNA oligonucleotide (6.6 µM) in buffer containing 20 mM Tris (pH 7.5), 4% glycerin, 40 µg/ml bovine serum albumin, 5 mM MgCl2,and 5 mM DTT. Reactions (15 µl) were supplemented with 3 mM ATP and 2.5 µCi of [{alpha}-32P]ATP, and incubated at 37 °C for 15 min. Reactions were stopped by addition of 25 mM EDTA, and 0.4 µl were spotted on PEI thin-layer chromatography (TLC) plates to separate ATP from ADP. TLC plates were developed with 0.6 M potassium phosphate (pH 3.4). TLC plates were dried and radioactivity was visualized and quantified using a PhosphorImager (Amersham Biosciences).

DNA Gel Mobility Shift Assay—DNA containing a mismatch (heteroduplex DNA) was generated by annealing of two complementary 68-mer synthetic oligonucleotides (A: 5'-GGTCGACTCTAGAGGATCCCCGGGTACCGAGCTTGAATTCGTAATCATGGTCATAGCTGTTTCCTGTG-3' and B: 5'-CACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGACTCGACC-3'), which generates a G·T mismatch at position 34. Homoduplex DNA was generated using an oligonucleotide that was fully complimentary to oligonucleotide B. Reactions (15 µl) contained 20 mM Tris-Cl (pH 7.5), 120 mM NaCl, 2 mM DTT, 40 µg/ml bovine serum albumin, 3 mM MgCl2, 0.6 nM 32P-labeled heteroduplex DNA, and 6 nM unlabeled homoduplex DNA and the amounts of MutS and MutSN described in the legend to Fig. 4. Reactions were incubated for 5 min at 25 °C before loading (4 µl) in a native 4% polyacrylamide gel. After electrophoresis in TBE buffer, gels were dried and analyzed using a PhosphorImager (Amersham Biosciences).

Helicase Assay—The DNA substrate for helicase assays was a 90-mer DNA oligonucleotide labeled at the 5' terminus with [32P] using [{gamma}-32P]ATP and T4 polynucleotide kinase, followed by hybridization to M13mp18 ssDNA at a ratio of 1:5 (oligo:M13). The sequence of the oligonucleotide is as follows: 5'-CCCCCTTATTAGCGTTTGCCATCTTTTCATAATCAAAATCACCGGAACCAGAGCCACCACC GGAACCGCCTCCCTCAGAGCCGCCACCCT-3'. The labeled DNA substrate was present at a concentration of 1 nM in a mixture containing 20 mM Tris-Cl (pH 7.5), 50 mM NaCl, 2 mM DTT, 40µg/ml bovine serum albumin, 3 mM MgCl2,and 3 mM ATP. The amounts of UvrD and MutL added to the reactions are indicated in the legend to Fig. 2. Reactions (15 µl) were initiated upon addition of UvrD and incubated for 15 min at 37 °C. Reactions were quenched upon addition of 5 µl of 50 mM Tris-Cl, 50% glycerol, and 10% SDS. Then 5 µl of each quenched reaction was loaded onto a 4% native polyacrylamide gel in TBE buffer. After electrophoresis, the gel was dried, exposed to a PhosphorImager screen, and radioactive bands were quantitated with ImageQuant software (Amersham Biosciences).

Microtiter Plate Assays—N-terminal biotinylated peptides (100 pmol) were added to streptavidin-coated 96-well plates in 30 µl of PBST buffer (0.01 M phosphate-buffered saline, pH 7.2, supplemented with 0.1 (v/v) Tween 20) and incubated 1 h at 23°C. Wells were then washed three times by addition and removal of 100 µl of PBST buffer. [32P]beta or human [32P]PCNA were added (90 nM) directly to wells in a volume of 30 µl and incubated for 1 h, after which each well was washed three times with 50 µl of PBST buffer. Plates were analyzed using a PhosphorImager (Amersham Biosciences).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
MutL Interacts with the beta Clamp Only in the Presence of ssDNA— MutL protein is thought to act as a bridge between the site of DNA damage, recognized by MutS, and enzymes that subsequently process the DNA, like MutH endonuclease, helicases, and exonucleases (1, 7). Structural analysis of MutL indicate that it is a highly flexible molecule with two distinct regions connected by a proline-rich, 100-residue long disordered linker (7, 35). Because the C-terminal domain contains a strong dimerization surface and the N-terminal domains dimerize upon ATP binding, the MutL dimer contains a very large cavity (~100 %Aring;) that is sufficiently large to possibly accommodate 2-4 DNA helices at the same time (7). The N-terminal domain contains the ATP-binding site, and MutL is a weak ATPase that is stimulated by ssDNA; a putative ssDNA-binding site is located at the interface of two N-terminal domains as suggested by structural studies and mutational analysis (36). Upon binding to ATP, several disordered loops (L1, L2, L3, L45, and the ATP-binding region) become ordered within the N-terminal region of MutL. These loops have been suggested to be critical for the dynamic interactions that take place between the two N-terminal domains during each cycle of ATP binding, hydrolysis, and ADP release (36).

We have reported previously that MutL in solution does not show an interaction with the beta clamp (17). Here we used an assay similar to that used initially to demonstrate the MutS-beta interaction, in which beta complexed with either MutS or DNA polymerase III migrates slower than free beta in native polyacrylamide gel electrophoresis (17). In these assays the position of beta on the gel is visualized using beta labeled with a C-terminal tag that is specifically phosphorylated by a protein kinase (29). Using this method, an interaction between MutL and beta is readily apparent in the presence of a single-stranded DNA oligonucleotide (Fig. 1A). A titration of MutL·ssDNA into a reaction containing [32P]beta indicates that they interact with a Kd value of ~250 nM (each as dimer) (Fig. 1B). These results suggest that the interaction of MutL with beta may require a conformational change in MutL brought about by ssDNA binding.

Next we tested the effect of the non-hydrolyzable nucleotide analog, AMPPNP, on the binding of MutL to beta in the presence of ssDNA (Fig. 1B). Although ATP has no apparent effect on ssDNA binding, ssDNA increases the ATPase rate of MutL, possibly by inducing dimerization of the N-terminal domains of MutL, a pre-requisite for ATP hydrolysis (36). The results show that AMPPNP decreases the affinity of MutL for beta in the presence of ssDNA by ~3-fold (Fig. 1B). AMPPNP binding to MutL causes folding of various disordered loops at the N-terminal domains of the MutL dimer (36), and therefore this result suggests that the interaction of MutL with beta may be partially regulated by conformational changes in the N-terminal domains of MutL.

To determine whether MutL binds to the same C-terminal face of beta as MutS and other proteins, we examined the interaction by the kinase protection assay (Fig. 1C) (17, 37). The rate of phosphorylation of the 6-residue kinase tag attached to the C terminus of beta was followed in the presence or absence of MutL and the ssDNA oligonucleotide. As a control, PCNA containing a kinase tag was included in the reaction. Protein kinase A phosphorylated beta and PCNA equally in the absence of additional proteins (lanes 1-3), but addition of the MutL·ssDNA complex inhibited phosphorylation of beta (lanes 4-6). This result suggests that MutL·ssDNA binds to beta on the same side as MutS, {gamma} complex, and the pol III {alpha} subunit.


Figure 1
View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 1.
MutL interacts with beta in the presence of ssDNA. A, native PAGE was used to analyze the interaction of [32P]beta (50 nM) with MutL (2 µM) in the presence or absence of dsDNA (10 µM as 300-mer), ssDNA (10 µM as 100-mer), and AMPPNP (1 mM). MutS was included in lanes 8 and 9 to demonstrate that AMPPNP does not affect the ability of MutS to bind beta under these conditions. B, a titration of MutL and MutLLF (0.150-5 µM) into reactions containing 50 nM [32P]beta was performed to estimate the affinity of the complexes in the presence of ssDNA and AMPPNP. Complexes were separated by native PAGE and bound and free [32P]beta was quantified for each reaction using a PhosphorImager. C, kinase protection assay. Protein kinase labels the C-terminal kinase tags of beta that protrude from the face to which DNA polymerase binds these (see diagram). In the absence of additional factors, both clamps are phosphorylated equally (lanes 1-3). Addition of MutL·ssDNA prevents labeling of beta but not of the PCNA control (lanes 4-6). D, a peptide derived from the C terminus of the {alpha} subunit of DNA polymerase III that binds to the hydrophobic pocket in beta displaces the core·beta (lanes 2 and 6), MutS·beta (lanes 3 and 7), or MutL·ssDNA·beta (lanes 4 and 8) complexes, demonstrating that all three proteins interact in a similar fashion with the hydrophobic pocket on beta.

 
In the experiment of Fig. 1D, we used a 20-mer peptide derived from the C terminus (residues 1141-1160) of the {alpha} subunit (polymerase) of pol III to challenge the MutL·ssDNA·beta complex (Fig. 1D). This peptide binds to the hydrophobic pocket in beta that is targeted by the {delta} subunit of the {gamma}-complex as well as all five DNA polymerases of E. coli (38). The result demonstrates that the 20-mer peptide readily dissociates complexes of pol III core·beta, MutS·beta, and MutL·ssDNA·beta, indicating that MutL likely binds the same hydrophobic site on the beta ring that these other proteins bind.


Figure 2
View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 2.
Analysis of the MutL beta-binding site and influence on ATPase and helicase stimulation. A, alignment of the loop 2 region of MutL in E. coli, with the sequence from Saccharomyces cerevisiae and human MutL homologues (MLH1). Structural elements of the E. coli MutL structure (36) are shown above the sequence. The conserved LF residues that were mutated to alanine in the peptide experiments shown in panel B are boxed. The sequence used to design peptides for experiments described in panel B is underlined. B, biotinylated peptides were attached to an enzyme-linked immunosorbent assay plate coated with streptavidin, and tested for retention of [32P]beta (left) or [32P]PCNA (right) as described (38). In the left plate the peptide used was a 20-mer derived from the E. coli sequence in panel A. In the right panel the peptide used was a 20-mer derived from the human MLH1 sequence in panel A. In both mutant peptides the LF sequence (boxed in panel A) was mutated to alanines. C, ATPase assays of MutL and MutLLF indicate that the mutant retains wild-type activity, and that both are stimulated to a similar extent by ssDNA. D, UvrD helicase is stimulated similarly by MutL (black squares) and MutLLF (open squares). In lane2 the helicase substrate (see "Experimental Procedures") was heated to 100 °C for 4 min prior to loading the gel. UvrD was 0.5 nM and MutL (or MutLLF) was 0.6 nM (lanes 4 and 9), 1.8 nM (lanes 5 and 10), 5.4 nM (lanes 6 and 11), 17 nM (lanes 7 and 12), and 50 nM (lanes 8 and 13).

 
Conserved Loop L2 of the N-terminal Domain of MutL Is Involved in beta Binding—Inspection of an alignment of diverse bacterial MutL proteins for candidate beta-interaction sequences did not reveal an obvious 4- or 5-residue consensus beta-binding motif. However, loop 2 in the N-terminal ATP-binding domain of MutL contains a highly conserved LF motif reminiscent of the one present in the {delta} subunit of the {gamma}-complex that, despite its deviation from the consensus, binds the hydrophobic pocket in beta. We tested beta binding to a series of peptides derived from sequences comprising loops L1 and L3 of MutL, with negative results (data not shown), but a 20-mer peptide corresponding to loop 2 (L2) (Fig. 2A) in the N-terminal domain tested positive for binding to beta (Fig. 2B, left panel). To examine the peptide for interaction with beta, an N-terminal biotinylated 20-mer peptide corresponding to loop 2 of MutL was attached to wells of a microtiter plate coated with streptavidin, and the wells were probed with [32P]beta (Fig. 2B). The presence of the peptide resulted in retaining [32P]beta in the well. A double mutation to alanine of residues Leu-150 and Phe-151 within the peptide (residue number corresponding to full-length MutL) abolished the interaction. Interestingly, the homologous region in human MLH1 contains a sequence (QXXVXXLF) that may be predicted to bind PCNA (Fig. 2A). A peptide derived from the human MLH1 protein was capable of forming complexes with human [32P]PCNA (Fig. 2B, right panel). Mutation of residues Leu-155 and Phe-156 to alanine in the peptide derived from human MLH1 also abolished the interaction.

These results indicate that loop L2 in MutL is a candidate site for interaction with beta and that the homologous residues in human MLH1 could bind PCNA. Mutation of the two residues to alanine renders the MutL mutant inactive in complementing a strain of E. coli in which the normal mutL gene is inactivated by replacement of the coding sequence with the chloramphenicol acetyltransferase (cat) gene (Table 1). The mutant protein was purified (referred to herein as MutLLF) and tested for binding to beta (Fig. 1B). MutLLF-ssDNA shows decreased binding to beta with respect to wild-type MutL-ssDNA. This effect may be due to residual binding at the mutated site on MutLLF, or may be explained by the presence of a second site of interaction elsewhere in MutL. Interestingly, the affinity of MutLLF-ssDNA for beta does not decrease in the presence of AMPPNP and is similar to that of wild-type MutL in the presence of AMPPNP. To examine whether the double mutation causes a defect in the ATPase rate of MutL, we performed ATPase assays in the presence and absence of ssDNA. The results in Fig. 2C show that the ATPase activity of MutLLF is indistinguishable from that of wild-type MutL. Stimulation of helicase activity by UvrD is also unaffected by the double mutation in MutLLF, which shows a similar activity in this assay as wild-type MutL (Fig. 2D). This study suggests that MutL binds beta only in the presence of ssDNA, and that a site of contact between MutL and beta is located in the conserved loop L2 on the N-terminal domain of the protein.


View this table:
[in this window]
[in a new window]
  		TABLE 1
Mutant frequency of MutL and MutS mutants Aliquots from five saturated cultures of each strain were plated on media to select for rifampicin-resistant mutants and total cell number. The plates were scored after overnight incubation. Mutant frequencies were rounded to the nearest whole integer.

 


Figure 3
View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 3.
Peptides derived from the MutS N and C terminus domains interact with beta. A, the mobility of [32P]beta (50 nM, lane 1) on native polyacrylamide gel electrophoresis changes when bound to streptavidin (SA)-peptide complexes (lanes 5 and 6). 21-mer peptides (1µM) were biotinylated at their N terminus and streptavidin concentration was 1 µM. B, peptides disrupt preformed MutS·[32P]beta or pol III core·[32P]beta complexes. Complexes of [32P]beta (50 nM) with MutS or pol III core (2 µM) were preincubated for 5 min at 37 °C before adding peptides (100 µM), followed by an additional incubation for 5 min at 37 °C.

 
Peptides Derived from N- and C-terminal Sequences of MutS Interact with beta—We have shown previously that E. coli MutS interacts with beta in solution (17). Many of the proteins that bind to beta do so via extreme N- or C-terminal residues (21, 23, 38). To investigate whether MutS utilizes N- or C-terminal residues to bind to beta, we synthesized biotinylated 21-mer peptides containing MutS sequences corresponding to the N- and C-terminal residues and probed them for interaction with beta. The assay utilizes [32P]beta and streptavidin. If the biotinylated peptide binds to beta, the streptavidin, which couples to the biotinylated peptide, shifts the position of beta in the native polyacrylamide gel. The gel shift requires streptavidin as the peptide alone is not large enough to result in a detectable gel shift of [32P]beta (compare Fig. 3 lanes 3 and 4 with 5 and 6). Peptides derived from internal sequences, as well as the peptide derived from the extreme C terminus of MutS (MutS823-853) did not interact with beta (data not shown). However, as shown in Fig. 3A, peptides derived from both the N terminus (MutS1-21) and a region very near the C terminus (MutS802-820) bind to beta in the native gel assay (Fig. 3A, lanes 5 and 6).


Figure 4
View larger version (62K):
[in this window]
[in a new window]
  		FIGURE 4.
Analysis of the N-terminal beta binding sequence of MutS. A, scheme of peptides spanning the N-terminal sequences of MutS used in this study. B, displacement assay of MutS·beta complexes (50 nM [32P]beta, 2 µM MutS) by peptides (50 µM) illustrated in panel A. C, alanine scanning of the region between Pro-12 and Leu-20 of MutS. Peptides contained single mutations to alanine at the indicated positions. D, a mobility shift assay of DNA by wild-type MutS and MutSN shows that both proteins bind to a 32P-labeled (68-mer) mismatch-containing duplex DNA with similar affinity. Concentrations of MutS proteins (as dimer) were 0.42 nM (lanes 2 and 9), 12.6 nM (lanes 3 and 10), 37 nM (lanes 4 and 11), 113 nM (lanes 5 and 12), 0.3 µM (lanes 6 and 13), 1 µM (lanes 7 and 14), and 3 µM (lanes 8 and 15). Results are quantitated to the right for MutS (black squares) and MutSN (open squares).

 
Next, we investigated the effect of the MutS beta-binding peptides on the mobility of preformed MutS·beta complexes. Interestingly, the results, in Fig. 3B, demonstrate that both the N- and C-terminal MutS peptides disrupt the MutS·beta complex (Fig. 3B, lanes 1-4), suggesting that both bind to beta at the same location. We then tested the effect of the two MutS peptides on preformed DNA polymerase III (core)·beta complexes (Fig. 3B, lanes 5-7). The result shows that the two peptides are both capable of disrupting the pol III core·beta complex, implying that, despite their lack of sequence similarity, they both bind to the same sites on beta that are contacted by pol III core.

Studies of the interaction between pol III core and beta indicate the presence of at least two contact points on beta, possibly the two identical hydrophobic pockets in the two protomers of the beta dimer (21, 38, 39). Taken together, these results suggest that MutS binds to beta in a manner similar to that of the pol III core and is consistent with our previous result that MutS binds beta on the same face of the ring as the {alpha} subunit of DNA polymerase III and the {delta} subunit of the {gamma}-complex (17).

The N-terminal beta-Binding Site in MutS Is Essential in Vivo—The studies herein using peptides derived from the MutS sequence suggest that one putative beta-binding site is located in the N terminus, which is a part of the mismatch DNA-binding domain of MutS (Domain 1). To obtain a more detailed view of this interaction, nested peptides were synthesized spanning the first 21 amino acids of MutS (Fig. 4A). As shown in Fig. 4B, peptides corresponding to N-terminal sequences of MutS can efficiently compete the MutS-beta interaction by binding to beta, except peptide MutS1-11. This result defines a particular region of interaction spanning residues Pro-12 to Lys-21. To identify the particular residues in the MutS peptide that are essential for the interaction with beta, residues were mutated one at a time. The results (Fig. 4C) show that certain residues between Met-13 and Arg-19 are important to preserve the interaction with beta. Amino acid replacements Q15A, L18A, and R19A show a greatly reduced binding to beta, whereas M13A, M14A, and Q16A have an intermediate effect. In contrast, peptides with replacements Y17A or L20A bind to beta similar to wild-type peptide.

Next, we constructed MutS mutants by site-directed mutagenesis of the mutS gene and tested the mutant proteins for binding to beta in vitro. A double mutant, Q15A/L18A, or a quadruple mutant Q15A/Q16A/L18A/R19A (referred to below as MutSN) did not show a significant decrease in binding to beta, suggesting that the interaction at the N terminus is not necessary for MutS to bind beta in solution (data not shown). In solution the MutS-beta interaction may be dominated by the C-terminal region of MutS, which is a strong interaction (see below). It also remains possible that the N-terminal residues identified here could become important for the interaction when MutS and beta are both bound to DNA. MutSN binds to heteroduplex DNA containing a G·T mismatch with an affinity similar to wild-type MutS (Fig. 4D), and its ATPase activity is also indistinguishable from wild-type MutS (data not shown).

To determine whether the MutS mutants were functional in vivo, the mutant genes were tested for their ability to complement E. coli KM75, a mismatch repair-deficient strain in which a tetracycline-resistance cassette replaces the chromosomal mutS gene. Plasmids that contain a copy of wild-type MutS restore mismatch repair (Table 1). Consistent with the in vitro studies above, the plasmid containing the quadruple mutant MutSN gene is unable to complement the repair pathway, suggesting that beta interaction at the N-terminal site on MutS is important to function (Table 1).

The C-terminal Domain of MutS Contains a Strong beta-Binding Site— Alignment of bacterial MutS sequences from different bacteria allowed Dalrymple and co-workers (21, 40) to identify a putative beta-binding motif about 30 residues from the C terminus of E. coli MutS, and they showed that a peptide derived from this region could bind to beta. This peptide contains a short sequence, QMSLL, that is related to the beta-binding motifs of other E. coli proteins. In light of the experiments described above with peptide MutS802-820 (Fig. 3), we tested binding of beta to two mutant forms of the MutS protein defective in this region near the C terminus. One form of MutS, MutS{Delta}C800 (or MutS800), contains a 53-amino acid C-terminal truncation and has been described and characterized previously (41, 42). The other contains a 5-residue deletion in the putative beta-binding motif (QMSLL) within the C terminus (MutS{Delta}812-816), which will be referred to here as MutSC. As shown in Fig. 5A, neither MutS800 nor MutSC interact with beta under the conditions of the native polyacrylamide gel-shift assay, suggesting that the motif located at the C terminus is an important site for binding to beta in solution.

MutS binds to beta2 with a Kd value of ~250 nM (as dimer) (Fig. 5B), as determined by the native gel electrophoresis assay, and the presence of homo- or heteroduplex DNA, or ATP, did not alter this equilibrium (data not shown). For comparison, a similar experiment was performed using pol III core, which is known to bind beta with a Kd of ~250 nM using other methods (43). In solution MutS is a tetramer, but MutS800 is dimeric, indicating that the missing 53 residues of MutS800 not only contain a beta-binding site, but are also required for tetramerization. We tested the oligomeric state of MutSC by gel filtration chromatography (Fig. 5C) but find that MutSC co-migrates with wild-type MutS and that therefore MutSC appears to be a tetramer. We conclude that the deleted beta-binding motif is not a determinant of the oligomeric status of MutS.

Although previous reports have shown that MutS800 is functional in vivo and can complement a null MutS mutant when expressed from plasmids (41, 44), more recent work has shown that the C-terminal domain of MutS is critical for mismatch repair in vivo when the protein is expressed from a single copy gene in the chromosome (34). However, strain GM8607, containing a deletion of five residues within the C-terminal domain of MutS (MutSC), can indeed complement the MutS-null strain when in a plasmid or in single-copy in the chromosome (Table 1). We conclude that, whereas the N-terminal motif seems to be essential for mismatch repair in vivo, the C-terminal one is not.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
To understand the role of processivity clamps in MMR, we have analyzed the E. coli beta clamp for interaction and function with the MutL and MutS proteins. We observe an interaction between MutL and beta that is only apparent in the presence of ssDNA. Furthermore, binding of ATP modulates the mutL-beta interaction. These results indicate that beta binds to MutL while MutL is engaged in the process of mismatch repair. The beta interaction site in MutL appears similar to that in the {delta} subunit of the clamp loader, and replacement of 2 amino acids in MutL (MutLLF) diminishes binding to beta, similar to analogous mutations in the {delta} subunit. The MutL mutant retains ATPase activity and ability to stimulate helicase II. Expression of the MutLLF mutant fails to complement a MutL defective strain of E. coli, indicating that the interaction of MutL with beta is essential to function.

Study of MutS identifies two distinct sites of interaction with beta. Analysis of MutS deletion mutants indicate that MutS binds to beta most strongly via residues in the C-terminal region of MutS. However, as revealed by peptide analysis, an additional contact site with beta is located at the extreme N terminus of MutS. In vivo functional studies reveal that MutS, which is mutated in amino acids required for beta binding at the N-terminal site, is no longer capable of complementing a MutS-deficient strain of E. coli, indicating that this site is important to mismatch repair in the cell. Overall, the results of the current report highlight the use of processivity clamps in mismatch repair and indicate that they act at more than one step, and possibly coordinating MutS and MutL activities with replication.


Figure 5
View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 5.
Analysis of the C-terminal beta-binding site in MutS. A, mutants of MutS deleted in the C-terminal beta-binding site lose interaction with the clamp. MutS800 is deleted for the C-terminal 53 amino acids, and MutSC is deleted for residues 812-816. Reactions were as described under "Experimental Procedures." B, MutSwt (squares) and MutSC (circles) were titrated into reactions containing [32P]beta (50 nM) and the complexes were separated by native gel electrophoresis as in A. For each reaction the free and bound [32P]beta were quantitated by PhosphorImager analysis and the percent bound was plotted versus MutS concentration (as monomer), upper panel. For comparative purposes, DNA polymerase III core ({alpha}{epsilon}{theta}) was titrated into similar reactions (lower panel). C, gel filtration analysis using Sephacryl S-200 chromatography shows that wild-type (wt) MutS (MutSwt) migrates at a higher molecular weight than MutS800 (upper panel). MutSC, containing a deletion of the beta-binding motif at the C-terminal domain (residues 812-816), behaves as MutSwt (lower panel).

 


Figure 6
View larger version (42K):
[in this window]
[in a new window]
  		FIGURE 6.
Model of MutS function with the beta clamp. A, structure of E. coli MutS bound to a fragment of DNA with a mismatch (1E3M) (left) (41), and of beta (2POL) (right) (28). In the case of MutS, the protein used for crystallization lacked the C-terminal 53 amino acids (MutS800). The position of the C terminus in this truncated version of MutS is indicated. Residues Met-13 to Leu-20 from the N-terminal domain of MutS are colored red in the protomer; they do not interact directly with the mismatch, and are labeled N-terminal binding site. In the case of beta dimer, residues in the hydrophobic pocket of each protomer are labeled red (Leu-155, Thr-172, Arg-176, Leu-177, and Pro-242). B, a model for the use ofbeta by MutS during the early stages of mismatch repair. beta is loaded onto DNA by the DNA replication machinery and used by the pol III replicase processivity (a). The replicase periodically leaves clamps on DNA that are therefore available for use by MutS to check the newly synthesized DNA for errors (b). Mismatch recognition by MutS results in a conformational change in MutS. This may transfer DNA from the inner channel to the outer channel of MutS, kinking DNA at the damaged site and releasing the clamp (c). C, alignment of the beta-binding motifs of E. coli proteins: pol III core ({alpha} subunit) internal site (a); pol III core ({alpha} subunit) extreme C-terminal motif (b); MutS N-terminal motif (a); MutS C-terminal motif (b); DNA polymerase II C-terminal motif, and DNA polymerase IV C-terminal motif.

 
Recent evidence has accrued for at least two points of contact between pol IV and the clamp and between pol III and the clamp (23, 39, 45, 46). One may speculate that one contact is strong and allows a partner to bind to the DNA-bound clamp from solution, and that an additional binding site is apparent when the protein is actively engaged in performing its enzymatic activity on DNA. In this regard, the location of clamp interactive residues in the extreme N or C terminus of a protein could make these regions articulated and hinge-like, allowing them to bind the clamp and yet permit rapid association and dissociation from DNA. Surprisingly, to date the interactions of proteins with beta and PCNA have only been ascribed to the highly conserved hydrophobic pocket on the C-terminal face of the clamp, and adjacent areas, but not to the opposite face of the clamp. In addition, due to the homo-oligomeric structure of beta and PCNA, more than one protein can potentially bind to a clamp at the same time. Taken together, these features of clamp binding reveal a role for clamps in the coordination of multistep reactions of enzymes on DNA. Thus, processivity clamps regulate the exchange of replicative and repair DNA polymerases during DNA replication to overcome damaged DNA (22-24), or the action of specialized nucleases and DNA ligase during the maturation of Okazaki fragments (46-48). Sequential orchestration of different enzymatic activities is consistent with the present study of MutS and MutL interactions with the clamp.

MutS·beta: Two Coupled Rings to Scan the Chromosome—The finding that the C-terminal region of MutS can bind beta may seem puzzling, as this domain (53 residues) of MutS, missing in the crystal structure, would appear to be located far from the bound DNA duplex as illustrated in Fig. 6A (41, 44). Thus, it would seem improbable that a clamp encircling DNA could interact with the C terminus of MutS when MutS is bound to a mismatch. However, the Thermus aquaticus crystal structure of free MutS (without DNA) has shown that the N-terminal domains are highly mobile (44) and suggest that the MutS dimer could possibly form a ring for DNA interaction. This hypothesis is consistent with the behavior that MutS exhibits in a number of studies (49, 50). It has been proposed that the MutS ring may be semi-closed and therefore less stable on DNA compared with beta and PCNA (51), but may allow for one-dimensional diffusion on DNA before encountering the mismatch.

A clue to how MutS may slide on DNA is provided by a second channel (inner channel) apparent in the crystal structure (Fig. 6A). This channel is distinct from the one in which mismatched DNA is bound and its size and surface electrostatic potential is compatible with DNA contact (51). The paradox of a C-terminal interaction of MutS with beta can readily be solved if MutS interacts with beta when DNA is threaded through the inner channel. An alignment of the channels in both molecules positions the C-terminal and the N-terminal binding sites of MutS at approximately the same distance as exists between the two hydrophobic binding sites of beta, ~60 Å apart (Fig. 6A).

Structural studies of MutS with homoduplex DNA, or of the missing C-terminal extension that interacts with beta, will be needed to further evaluate this model. An interesting implication, however, is that upon binding to damaged DNA, the binding surface of MutS to beta may disconnect upon the relocation of the DNA duplex to the lower channel (Fig. 6A, left panel). beta release from the N-terminal site would be predicted to occur upon binding of the MutS to damaged DNA because the residues implicated in beta binding form an {alpha}-helix when MutS binds mismatched DNA (41). In addition, when MutS binds the mismatch beta it would be expected to detach from the C-terminal site as well, because the new distance would now be too great for the C terminus of MutS to interact with beta.

The model in Fig. 6B implicates beta in the earliest stages of mismatch repair in which beta targets MutS to sites of DNA replication and helps MutS in one-dimensional scanning along DNA for lesions (Fig. 6B, diagrams a and b). In this hypothesis, we propose that DNA threads through the upper chamber in MutS, allowing both MutS sites to bind the beta clamp (as described above). MutS binding to the mismatch would reposition the DNA and break both sites of contact with beta, ejecting the clamp from the MutS·DNA complex. Previous studies also suggest that there is a close relationship between mismatch recognition and processivity clamp binding and release (12, 27). The affinity of beta for MutS (Fig. 5B) is similar to that of pol III core in solution (~250 nM (43), Fig. 5B). Targeting of MutS to beta could possibly explain the observed reduced mutagenesis rates in the lagging strand versus the leading strand (52, 53), because the mechanism of DNA replication results in the accumulation of processivity clamps on the lagging strand (37). Also, because all processivity clamps loaded at the replication fork have the same orientation with respect to the double helix, beta could direct repair to the newly synthesized strands. We show here that the C-terminal site in MutS accounts for the strength of interaction with beta in solution. Hence, MutS may first bind to beta via the C-terminal motif and then, as MutS encircles DNA, also via the N-terminal motif. Is there any similarity between the beta motifs in MutS and pol III? An alignment of the two binding motifs in E. coli pol III {alpha} subunit and the two binding motifs in MutS (Fig. 6C) show similarity at positions one and four (Q1XXL4), whereas a hydrophobic residue, either Leu or Phe, has been shown to be accommodated at positions 5 or 6 in some beta binding motifs (21). This minimal consensus sequence in different ligands of a common binding site reflects the ability of the hydrophobic pocket on the surface of beta to interact dynamically with several different partners in the cell (38).


Figure 7
View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 7.
Model of MutL function with the beta clamp. A, structures of the N-terminal domain of MutL either without nucleotide (1BKN, left) or with nucleotide (1B63, right). Left panel, the position of loop 2 (not visible in the crystal) is labeled in red. Right panel, MutL bound to AMPPNP in which the residues needed for beta binding (Leu-150 and Phe-151) are colored in red. B, possible interactions of MutL with the beta clamp during repair. DNA polymerase that has generated a mismatch (a) could be arrested by MutL looping of intervening DNA and direct displacement of the polymerase upon MutL binding to ssDNA and beta (b). A possible outcome could be the activation of the proofreading exonuclease in the polymerase, which would degrade DNA up to the mismatch. MutL could also recruit UvrD helicase and an exonuclease to degrade the newly synthesized DNA (c).

 
The MutL-beta Interaction Requires ssDNA—The determination of MutL structures by Yang and collaborators (7, 35, 36, 54) has led to exciting new insights into their role in mismatch repair. However, major questions remain regarding the mechanism by which MutL coordinates mismatch repair. For example, the amino acids in MutL that interact with MutS, MutH, and UvrD have not yet been determined, and there is uncertainty as to the mode in which MutL binds to various DNA species. The study presented here adds yet another protein partner to MutL, the beta clamp processivity factor. Studies of eukaryotic MLH1 also indicate that it binds the PCNA clamp (8, 55-57). Our results show that MutL binding to beta requires ssDNA. Presumably MutL binding to ssDNA induces a conformational change in the N-terminal domains of the MutL dimer that allow for interaction with beta. It is interesting to note the atomic position of MutL residues Leu-150 and Phe-151 implicated in this study in binding to beta. The structures of MutL with and without nucleotide are shown in Fig. 7A. The beta interactive residues are exposed in the absence of nucleotide, but are sequestered in its presence. It seems likely that this nucleotide-induced change underlies the observation herein that nucleotide diminishes the ability of MutL to bind beta. We also demonstrate that human PCNA binds to a peptide derived from the corresponding region in human MLH1.

The finding that ssDNA is required for beta binding by MutL, combined with the fact that beta slides only on double-stranded DNA, suggests that the interaction between MutL and beta occurs at a junction between ss- and dsDNA. A ss/dsDNA junction is the natural substrate of DNA polymerases (Fig. 7B), and this structure is also present during the excision step in mismatch repair that involves the combined actions of a helicase and exonuclease to degrade the newly replicated DNA strand (Fig. 7C). We demonstrate here that MutL competes with the pol III core for beta, and thus one may speculate that MutL may displace pol III core from a primed site by direct competition for the processivity clamp. Alternatively, MutL may bind to one beta protomer, whereas pol III binds the other, as demonstrated recently for pol III and pol IV binding to one beta dimer simultaneously (22). This may even induce the polymerase to back-track to the point of the mismatch by stimulating the proofreading activity present in all replicative DNA polymerase complexes (i.e. the {epsilon} subunit of E. coli DNA polymerase III). For example, in eukaryotic organisms, genetic evidence has implicated the intrinsic 3' exonucleases of pol {delta} and pol {epsilon} in mismatch repair (58). On the other hand, independent exonucleases may be recruited to the clamp, as has been demonstrated recently for human EXOI and PCNA (56, 59).

DNA loop structures have been implicated in mismatch repair to account for the distance between the site of DNA damage and the place where degradation of the damaged DNA strand starts, which can be on the order of kilobases (2, 7, 60). MutL would be well suited for DNA looping as a consequence of the long connector sequences between the N- and C-terminal domains, and the ability of the N-terminal domains to dimerize in a ATP-dependent manner (36).

The models of Figs. 6 and 7 involve a combination of DNA looping and movements of MutS and MutL along the DNA contour that could eventually reconcile some of the current working models of mismatch repair. Further studies will be needed to reveal the exact roles of beta, but the interactions of beta to both MutS and MutL described in this study indicate that the clamp has multiple functions in mismatch repair.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grants GM38839 (to M. O. D.), GM63790 (to M. G. M.), and GM23719 (to P. M.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Centro de Biología Molecular Severo Ochoa, Universidad Autónoma de Madrid, 28049 Madrid, Spain. Tel.: 34-914978494; E-mail: fjlopez{at}cbm.uam.es.

2 The abbreviations used are: MMR, mismatch repair; PCNA, proliferating cell nuclear antigen; ssDNA, single-stranded DNA; dsDNA, double-stranded DNA; pol, polymerase; DTT, dithiothreitol; AMPPNP, 5'-adenylyl-beta,{gamma}-imidodiphosphate. Back


   ACKNOWLEDGMENTS
 
We thank Jeff Finkelstein for the overexpression vectors for wild-type MutS, MutL, and UvrD proteins.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Modrich, P., and Lahue, R. S. (1996) Annu. Rev. Biochem. 65, 101-133[CrossRef][Medline] [Order article via Infotrieve]
  2. Jiricny, J. (1998) EMBO J. 17, 6427-6436[CrossRef][Medline] [Order article via Infotrieve]
  3. Schaaper, R. M. (1993) J. Biol. Chem. 268, 23762-23765[Abstract/Free Full Text]
  4. Kolodner, R. D. (1996) Genes Dev. 10, 1433-1442[Free Full Text]
  5. Kunkel, T. A., and Erie, D. A. (2005) Annu. Rev. Biochem. 74, 681-710[CrossRef][Medline] [Order article via Infotrieve]
  6. Harfe, B. D., and Jinks-Robertson, S. (2000) Annu. Rev. Genet. 2000, 359-399[CrossRef]
  7. Guarné, A., Ramón-Maiques, S., Wolff, E. M., Ghirlando, R., Hu, X., Miller, J. H., and Yang, W. (2004) EMBO J. 23, 4134-4145[CrossRef][Medline] [Order article via Infotrieve]
  8. Umar, A., Buermeyer, A. B., Simon, J. A., Thomas, D. C., Clark, A. B., Liskay, R. M., and Kunkel, T. A. (1996) Cell 87, 65-73[CrossRef][Medline] [Order article via Infotrieve]
  9. Johnson, R. E., Kovvali, G. K., Guzder, S. N., Amin, N. S., Holm, C., Habraken, Y., Sung, P., Prakash, L., and Prakash, S. (1996) J. Biol. Chem. 271, 27987-27990[Abstract/Free Full Text]
  10. Gu, L., Hong, Y., McCulloch, S., Watanabe, H., and Li, G.-M. (1998) Nucleic Acids Res. 26, 1173-1178[Abstract/Free Full Text]
  11. Clark, A. B., Valle, F., Drotschmann, K., Gary, R. K., and Kunkel, T. A. (2000) J. Biol. Chem. 275, 36498-36501[Abstract/Free Full Text]
  12. Flores-Rozas, H., Clark, D., and Kolodner, R. D. (2000) Nat. Genet. 26, 375-378[CrossRef][Medline] [Order article via Infotrieve]
  13. Smith, B. T., Grossman, A. D., and Walker, G. C. (2001) Mol. Cell 8, 1197-1206[CrossRef][Medline] [Order article via Infotrieve]