Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M602373200 on April 4, 2006

J. Biol. Chem., Vol. 281, Issue 21, 14719-14728, May 26, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/21/14719    most recent
M602373200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Castellano, R.
Right arrow Articles by Collette, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Castellano, R.
Right arrow Articles by Collette, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Active Transcription of the Human FASL/CD95L/TNFSF6 Promoter Region in T Lymphocytes Involves Chromatin Remodeling

ROLE OF DNA METHYLATION AND PROTEIN ACETYLATION SUGGEST DISTINCT MECHANISMS OF TRANSCRIPTIONAL REPRESSION*

Rémy Castellano{ddagger}1, Bérengère Vire{ddagger}1, Marjorie Pion§, Vincent Quivy2, Daniel Olive{ddagger}, Ivan Hirsch§, Carine Van Lint3, and Yves Collette{ddagger}4

From the {ddagger}INSERM UMR599, Centre de Recherche en Cancérologie de Marseille, Université de la Méditerranée, 13009 Marseille, France, §INSERM U372, Unite de Pathogenie des Infections a Lentivirus, Parc Scientifique et Technologique de Luminy, 13009 Marseille, France, and Université Libre de Bruxelles, Institut de Biologie et de Médecine Moléculaires, Laboratoire de Virologie Moléculaire, 6041 Gosselies, Belgium

Received for publication, March 14, 2006


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Fas ligand (FasL/CD95L/TNFSF6), a member of the tumor necrosis factor family, initiates apoptosis in lymphoid and nonlymphoid tissues by binding to its receptor Fas (CD95/TNFRSF6). Although the transcriptional control of TNFSF6 gene expression is subjected to intense study, the role of its chromatin organization and accessibility to the transcriptional machinery is not known. Here, we determined the chromatin organization of TNFSF6 gene 5' regulatory regions. Using the indirect end-labeling technique, a unique region named HSS1 and encompassing nucleotides –189 to +185 according to the transcriptional start site, was identified throughout a 20-kilobase nucleosomal DNA domain surrounding the promoter. The HSS1 region displayed hypersensitivity to in vivo DNase I digestion in TNFSF6-expressing cells only, including upon T cell activation. Hypersensitivity to micrococcal nuclease digestion and to specific restriction enzyme digestion suggested the precise positioning of two nucleosomes across the transcription start site and minimal promoter region, likely interfering with TNFSF6 active transcription in T lymphocytes. Indeed, HSS1 hypersensitivity to nuclease digestion strictly correlated with TNFSF6 transcription, including in primary and leukemia T cells. HSS1 chromatin remodeling preceded detectable TNFSF6 mRNA accumulation and was blocked by cycloheximide that also prevented TNFSF6 transcription. However, DNA methylation levels of the TNFSF6 HSS1 region did not correlate with transcriptional activation. Induction of global protein acetylation by treatment with histone deacetylase inhibitors was not accompanied by HSS1 chromatin remodeling and/or TNFSF6 transcription. We conclude that chromatin remodeling is a primary event in the activation of TNFSF6 expression in primary and leukemia T cells and that mechanisms independent of protein deacetylation and of DNA methylation of the TNFSF6 promoter region are involved in the repression of TNFSF6 gene expression.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The TNFSF family related members are type II transmembrane proteins. Besides of their role in many important biological processes such as development, organogenesis, immunity, cell death, and survival, TNFSFs are implicated in various acquired or genetic human diseases ranging from septic shock to autoimmune disorders, allograft rejection, viral infections, and cancer (1). Hence, various therapeutic approaches aim to target these molecules, and there has been much interest toward the elucidation of the molecular mechanisms controlling their expression. TNFSF family member expression is contextually dependent on the nature, differentiation, activation, and cell cycle status of producing tissues. The regulated expression of the TNFSF genes implicates not only transcriptional but also post-transcriptional and post-translational mechanisms, together ensuring appropriate spatiotemporal expression. Escape of this tightly controlled expression has been described in various pathological conditions, including viral infections or neoplasm.

TNFSF6 (FasL/CD95L) is a key player in T lymphocyte homeostasis and cytolytic effector functions through the aggregation of its apoptosis inducing receptor, TNFRSF6 (Fas/CD95). Defective expression or function of either TNFSF6 or TNFRSF6 gene results in lymphoproliferation and autoimmunity in mice (for review, see Ref. 2) and human (35) and has been implicated in immune escape in the course of viral infection or tumor progression (610). Hence, tightly controlled expression of TNFSF6 is required for proper immune functions. Whereas TNFRSF6 is largely distributed in various tissues, initial studies described a more restricted expression of TNFSF6 confined to immune cells, with the exception of Sertoli cells and epithelial cells of the anterior chamber of the eye (1113). In resting T lymphocytes, TNFSF6 mRNA is absent or very low but is rapidly and transiently up-regulated upon T cell activation (11, 14). Subsequent studies have emphasized further the transcriptional control of TNFSF6 expression and have identified, cloned, and characterized the human and mouse TNFSF6 promoter-enhancer regions. NF-AT, but also NF-{kappa}B, Sp1, Egr-2 and -3, AP-1, Ets-1, and c-Myc transcription factors were shown to participate to TNFSF6 transcription (1528). Indeed, induced expression of TNFSF6 at the cell surface of activated T lymphocytes is inhibited by cyclosporin A, an inhibitor of the calcineurin phosphatase implicated in the regulation of NF-AT transcription factor activity and expression (29). The generation of transgenic mice in which the TNFSF6 promoter sequence controls the expression of a reporter gene evidenced a similar pattern of expression of the transgene and the endogenous gene in primary T lymphocytes, underscoring the role of these 5'-regulatory regions in TNFSF6 expression (30). Post-translational control of TNFSF6 expression has also been described. The TNFSF6 polypeptide can be sequestered as submembrane vesicles, which are rapidly released to the cell membrane by re-stimulated T lymphocytes (31, 32), and membrane-associated TNFSF6 can be processed into a soluble form by matrix metalloproteinases (33, 34). Thus, TNFSF6 surface expression is thought to be primarily controlled at the transcriptional level.

Gene transcription in eukaryotic cells is controlled by protein complexes, including general and tissue-specific transcription factors, coregulators, chromatin-remodeling complexes, and complexes responsible for signal-specific histone modifications (35). Because genomic DNA is packaged into chromatin, generally a repressive structure for transcriptional activation, transcription in the context of chromatin requires remodeling processes to reconfigure the chromatin, so that the transcription complexes have access to promoters of target genes (36). Histone acetyltransferases and histone deacetylases are chromatin-modifying enzymes that tightly cooperate with chromatin-remodeling enzymes to regulate accessibility of the template to DNA binding factors and RNA polymerase II (37). Besides histone acetylation, a variety of other histone and nonhistone protein modifications (phosphorylation, methylation, sumoylation, and ubiquitination) as well as modification of DNA itself by methylation regulates transcription initiation (3841). Orchestration of the events required for transcriptional activation is promoter-specific (4244). Chromatin remodeling plays an important role in the regulation of immune functions by controlling the expression of a growing number of key cytokine genes (45). For example, during T lymphocyte ontogeny, the differentiation of naïve T lymphocytes into Th1- or Th2-type cytokine-producing cells is accompanied by specific and organized remodeling of the IFNbeta and IL-4/IL-5/IL-13 chromatin loci, respectively, characterized by DNase I hypersensitive sites (4648). The specific and localized remodeling of nucleosomes in the vicinity of the IL-12 p40 and IFNbeta promoter regions contribute to their rapid transcription after cell stimulation (for review, see Ref. 45). Herein, we considered a possible role for chromatin structure in the regulation of TNFSF6 gene expression.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cells, Culture Conditions, and T Cell Stimulation—All cell culture experiments were performed at 37 °C in 5% CO2-humidified atmosphere. The JA16 cells (49), a clone of the Jurkat T cell line and the human NK cell lines NK92, and NKL were maintained in RPMI 1640 medium supplemented with 10% fetal calf serum. HeLa cells were maintained in Dulbecco's modified Eagle's medium (10% fetal calf serum). The IL5-2-dependent NK cell lines NK92 and NKL were provided by Prof. E. Vivier (Marseille, France) and were cultured with 100 units/ml recombinant human IL-2 and 2 mM L-glutamine. Chronic lymphocytic leukemia (CLL) peripheral blood samples were obtained after informed consent from patients at diagnosis and before any chemotherapy. Peripheral blood mononuclear cells from healthy donors and from leukemia patients were separated on Ficoll-Hypaque gradients (50). T lymphocytes were isolated by using the Pan T Cell Isolation kit, according to manufacturer's instruction (Miltenyi Biotec). T lymphocytes and the Jurkat T cell line were stimulated with 1 and 20 ng/ml PMA (Saint Louis, MO) and 1 and 2 µg/ml ionomycin (Calbiochem), respectively. Where indicated, the following drugs were used: cyclosporin A (CsA, 50 ng/ml, Calbiochem), cycloheximide (CHX, 20 µM, Sigma), GF109 (1 µM), trichostatin A (TSA, 500 nM, Sigma), valproic acid (5 mM, Sigma), nicotinamide (10 mM, Sigma), and sirtinol (25 µM, Calbiochem). The monoclonal antibody 289 (kindly provided by Alessandro Moretta) recognizes the CD3{zeta} chain of the T cell receptor complex and was immobilized on plastic culture dishes for T cell receptor stimulation. The anti-human CD28 monoclonal antibody 248 has already been described (51).

Nuclease Digestion of Purified Nuclei—Exponentially growing cells were harvested by centrifugation at 1600 rpm (Jouan CR4.11) for 10 min at 4 °C and washed twice with ice-cold phosphate-buffered saline. All subsequent operations were performed in ice with pre-cooled buffers. Cells were counted and resuspended at 25 x 106 cells/ml in buffer A (10 mM Tris, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.3 M sucrose) and incubated on ice for 10 min, an equal volume of buffer A, 0.2% Nonidet P-40 was added, and the cells were incubated for another 10 min and resuspended at 108 nuclei/ml in 1 of the 3 buffers depending on the nuclease used for digestion: buffer A for DNase I, buffer A supplemented with 10 mM CaCl2 for micrococcal nuclease, or the specific restriction enzyme buffer for each restriction enzyme. Nuclei were digested for 10 min on ice with DNase I, for 20 min at 22 °C for micrococcal nuclease, and 20 min at the temperature according the manufacturer's protocol for restriction enzymes. Digestion reactions were stopped by adding 1 volume of 2 x proteinase K buffer (100 mM Tris, pH 7.5, 200 mM NaCl, 2 mM EDTA, 1% SDS) and mixing. Samples were solubilized for 1 h at 55 °C, proteinase K was added at 400 µg/ml, and digestion was allowed to continue overnight at 55 °C. RNase A was added at a final concentration of 50 µg/ml for 1 h at 37 °C. Samples were extracted 3 times with phenol and 2 times with chloroform/isoamyl alcohol (24:1) and precipitated with ethanol. DNA was resuspended in sterile water, and its concentration was estimated by measuring the absorbance at 260 nm.

Southern Blotting—Purified DNA (30 µg for DNase I and micrococcal nuclease and 15 µg for restriction enzyme) was digested with KpnI, and the fragments generated were separated by electrophoresis in 0.8–2% agarose gels in Tris borate buffer. Each size marker was generated by digesting genomic DNA (10 µg) with two restriction enzymes, KpnI and another enzyme chosen to generate a fragment of defined size and location in the region under study. Three of these markers were mixed together and co-electrophoresed with the samples. Agarose gels were incubated 2x 30 min in denaturing solution (1.5 M NaCl, 0.5 M NaOH) and 2x 30 min in neutralizing solution (1.5 M NaCl, 1 M Tris pH 7.2) and transferred overnight by capillarity in 20x SSC (1x SSC = 0.15 M NaCl and 0.015 M sodium citrate; Invitrogen) to nylon membranes (Hybond-N+, Amersham Biosciences). DNA was cross-linked to nylon membranes by exposure to UV light (UV Stratalinker 1800, Stratagene), washed for 20 min in 2x SSPE, and prehybridized for 2 h at 68°C in hybridization buffer (6x SSC, 1% SDS, 1x Denhart's, 0.1 mg/ml sonicated salmon sperm DNA). The probe was synthesized by 25 cycles (95 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min) of polymerase chain reaction using 100 ng of Jurkat T cell genomic DNA as a template and the primers IEL3AFASL (5'-GTCTACCAGCCAGATGCACACAGC-3' and 5'-GTACCTCATGACTGCCTCTGTGGG-3'). The amplified products were separated on a 2% agarose gel and purified by using the NucleoSpin Plasmid kit procedure (Macherey-Nagel). DNA fragments were labeled by the random primer reaction (66) and purified on a G-50 Sephadex column. Denatured DNA probe was added to the hybridization buffer and allowed to hybridize for at least 16 h at 68 °C. Membranes were washed twice for 20 min (each time) in 2x SSC, 0.1% SDS, twice for 20 min (each time) in 0.2x SSC, 0.1% SDS at room temperature, and once for 30 min in 0.2x SSC, 0.1% SDS plus once for 30 min in 0.1x SSC, 0.1% SDS at 68 °C. Autoradiographic exposures with two intensifying screens were carried out for 1–10 days at –80 °C.

RT-PCR—The expression of TNFSF6 mRNA was analyzed by RT-PCR using the primer oligonucleotides 5', CAGCTCTTCCACCTACAGAAGG, and 3', CATTGATCACAAGGCCACC, as described (52).

For RT-PCR analysis of transiently transfected cells, poly(A) mRNA was purified using the MicroMax mRNA isolation kit according to the manufacturers' instructions (Miltenyi Biotec, Bergisch Gladbach, Germany), except that a DNase I treatment step of the mRNA-loaded columns was added (30 units of DNase I at room temperature for 15 min). RT-PCR analysis was performed using the following primer pairs: luciferase, 5', CTAGAGGATGGAACCGCTGGAGAGC; 3', CGCAGGCAGTTCTATGCGGAAGGG; glyceraldehyde-3-phosphate dehydrogenase, 5', GTCATCCCTGAGCTGAAC; 3', GGGTCTTACTCCTTGGAG.

Enzyme-linked Immunosorbent Assay—Soluble TNFSF6 concentrations present in culture supernatants were quantified by an enzyme-linked immunosorbent assay (ELISA) kit according to the manufacturers' instructions (Oncogene-Fas ligand ELISA catalog #QIA27).

Western Blot Analysis—Cells were harvested by centrifugation, washed, and lysed in SDS sample loading buffer followed by 12% SDS-PAGE electrophoresis. After transfer onto polyvinylidene difluoride membranes (Millipore Corp., Bedford, MA), proteins were detected with the acetylhistone H4 antibody (06–866, Upstate%20Biotechnology">Upstate Biotechnology) and enhanced chemiluminescence according to the manufacturers' instructions (Westpico, Pierce).

Bisulfite Cytosine Methylation Analysis—The samples of total genomic DNA (700 ng) isolated with the QIAamp DNA blood mini kit (Qiagen Inc.) and digested overnight with EcoRI in a volume of 20 µl were prepared for methylation analysis as described by Olek et al. (53). Briefly, the digested DNA boiled for 5 min, quickly chilled on ice, and incubated in 0.3 M NaOH at 50 °C for 15 min was mixed with 2.5 volumes of 2% LMP-agarose (SeaPlaque agarose, FMC). Ten-µl volumes of agarose/DNA mixture were pipetted into 750 µl of chilled mineral oil to form agarose beads. Aliquots of 1 ml of 2.5 M sodium metabisulfite (Sigma) and 125 mM hydroquinone (Sigma), pH 5.0, were then added to mineral oil containing up to 5 agarose beads. The reaction mixtures were kept on ice for 30 min and then incubated in the dark at 50 °C for 3.5 h. The agarose beads were equilibrated 4 times (15 min each) with 1 ml of Tris-EDTA, pH 8.0, and DNA was desulfonated in 500 µl of 0.2 M NaOH (2 x 15 min) at room temperature. Finally, the beads were washed with 1 ml of Tris-EDTA, pH 8.0 (3 x 10 min), and kept at 4 °C.

Bisulfite-treated DNA in melted agarose was amplified by PCR in a 50-µl reaction mixture containing 50 mM Tris-HCl, pH 9.2, 1.75 mM MgCl2, 350 µM of each dNTP, and 45 pmol each of FAS15+, 5'-GTAGATTTTTTAAGAGTAGGATGAAGATAAATAGGTTT-3' nucleotide (sense), and FAS18–, 5'-CTAACTAATAAAATACAACAAAAATAATAAA-3', (antisense) primers complementary to TNFSF6 5' regulatory region (Fig. 1A) with 1 unit of Taq polymerase. The amplification products were subjected to a second round of PCR with nested primers FAS16+, 5'-GGTTATTTTTTTTATTGATAATATAGATTTT-3' (sense) and FAS17–, 5'-CTAAAAAAAACAAACTTCCTAATTATA-3' (antisense). In some experiments the primer MD was replaced by the primer MF, 5'-AAATCTAAAAAATCTCTAATTACCAAAATC-3' (nt 577–606, antisense), or the primer MR, 5'-ACTCCCAAACTCAAATCTAATCTAACCAAA (nt 461–490, antisense). The sense primers contained T, and the antisense primers contained A instead of C in positions complementary to nonmethylatable C (i.e. C out of CpG dinucleotides). PCR was performed with about 50 ng of genomic DNA (out of 140 ng of DNA per 1 agarose bead) for 40 cycles at 95 °C for 45 s, 58 °C for 30 s, and 72 °C for 30 s. Amplification products were cloned in the pGEM-Easy Vector System (Promega, Madison, WI) and sequenced.

Electroporation and Luciferase Assays—107 Jurkat T cells were electroporated at 960 microfarads and 250 V using the Bio-Rad Gene Pulser with 25 µg of pGL2/basic or the various TNFSF6 promoter-driven luciferase firefly constructs together with 5 µg of thymidine kinase luciferase Renilla plasmid. The cells were incubated for 2 h, then left unstimulated or stimulated for 16 h as previously described (57). The cells were collected, washed in phosphate-buffered saline, and lysed to determine the luciferase activity by using the dual luciferase reporter assay according to the manufacturer's instructions (Promega) and read using a luminometer (Dynex). The transfection efficiency was normalized to luciferase Renilla activity and corrected for protein content as determined by the Bradford protein assay (Bio-Rad).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
DNase I Accessibility of the TNFSF6 5' Regulatory Regions in TNFSF6-expressing Cells—The presence of DNase I-hypersensitive sites (HSS) in the 20-kilobase TNFSF6 5' regulatory region was assessed by indirect end-labeling and southern blotting using a probe mapping 3' to the TNFSF6 exon 2 (Fig. 1A). To identify regulatory elements associated with TNFSF6 gene active transcription, we compared DNase I hypersensitivity patterns in differentially expressing cells. In cells that do not actively transcribe TNFSF6 such as HeLa cells, (Fig. 1C), a closed chromatin structure was observed, as indicated by the lack of detectable DNase I-HSS over the analyzed region (Fig. 1B). Both unstimulated Jurkat and primary T lymphocytes displayed a similar closed chromatin structure even at high DNase I enzyme concentrations that correlated with the lack of TNFSF6 transcription and expression (Fig. 1, B–D). In contrast, a strong and specific HSS (called HSS1) appeared in a DNase I dose-dependent manner in both Jurkat and primary T lymphocytes stimulated by a combination of phorbol ester and calcium ionophore (P+I), a powerful mitogenic stimuli-inducing active transcription of TNFSF6 (Fig. 1B). The P+I-induced accessibility of HSS1 was further confirmed in numerous T cell lines (CEM, SupT1, and the JE6 and JA16 Jurkat T cell lines) and primary T lymphocytes obtained from different donors (data not show). Based on previous observations that NK cells constitutively express TNSF6 protein (54), we determined the presence of HSS1 in NK cell lines. HSS1 was detected in both the NKL and NK92 cell lines (Fig. 1B), in agreement with active TNFSF6 transcription and expression in these two cell lines (Fig. 1, C and D). Using the molecular weight markers, we mapped HSS1 between the BamH1 and BglII markers a region previously shown to mimic TNFSF6 gene transcriptional activity (Fig. 1A) (55).

Analysis of TNFSF6-HSS1 Chromatin Accessibility to Micrococcal Nuclease (MNase) and Restriction Enzymes—We next sought to map TNFSF6-HSS1 more precisely and to determine the nucleosomal organization within the TNFSF6 5' regulatory region. MNase preferentially digests nucleosome-free DNA and linker DNA and can, thus, be used to show nucleosome remodeling. Digestion of a nucleosomal array using limiting amounts of MNase will produce a ladder of DNA fragments corresponding to multiples of the nucleosome particle (~160 bp). Nuclei were isolated from Jurkat cells and digested with increasing amounts of MNase. A discrete band pattern (a– h in Fig. 2A) was revealed in unstimulated Jurkat cells, a result consistent with precise nucleosome positioning. Digestion of naked genomic DNA in vitro showed a quite similar, although not identical pattern of digestion to that obtained with in vivo digestion of chromatin, supporting the hypothesis that the pattern observed in vivo reflects TNFSF6 gene nucleosomal organization (Fig. 2A). In P+I-stimulated Jurkat cells, a unique change in MNase accessibility was found in the 20-kilobase DNA region under study (Fig. 2, A and B). This MNase-hypersensitive site mapped to HSS1.


Figure 1
View larger version (73K):
[in this window]
[in a new window]
 
FIGURE 1.
DNase I accessibility of the TNFSF6 5' regulatory regions. A, schematic organization of the TNFSF6 locus and of the HSS mapping. B, nuclei from normal T lymphocytes (TL), Jurkat T cells, HeLa epithelial cells, or two human Natural Killer cell lines (NK92 and NKL) left unstimulated (UN) or stimulated with PMA plus ionomycin (P+I) for 5 h were digested in vivo with DNase I followed by KpnI digestion in vitro and indirect end-labeling. DNase I was used at 0, 30, 50, and 80 units/ml (T Lymphocytes), 0, 10, 30, 50, 80, and 100 units/ml (Jurkat cells), 0 and 50 units/ml (HeLa cells), and 0, 30, and 50 units/ml (NKL and NK92). The asterisk indicates HSS present in only one cell type, and filled arrowhead indicates HSS1 (see "Results" for further details). Molecular weight markers (M) are a double digest of naked DNA by KpnI alone (20227 nt) plus EcoRV (10210 nt), BamHI (1926 nt), or BglII (1522 nt). C, mRNA from unstimulated (–) and P+I-stimulated (+) cells was reverse-transcribed and amplified by PCR to determine TNFSF6 and beta-actin mRNA. D, TNFSF6 protein levels were determined by enzyme-linked immunosorbent assay performed on cell culture supernatants collected from unstimulated and P+I-stimulated cells as indicated.

 
Next, nuclei from Jurkat cells and primary T lymphocytes were digested by different restriction endonucleases (REs) that cleave DNA within the TNFSF6 region of interest. The efficiency of chromatin digestion by a given RE depends on several variables, including DNA accessibility. As described for DNase I hypersensitivity analysis, and nuclei were prepared, digested with RE cutting at 11 and 7 distinct sites for the Jurkat and primary T lymphocytes preparations, respectively, followed by Southern blotting (Fig. 2, C and D). The efficiency of digestion at each site was plotted as a function of the position of the corresponding restriction site in the genome (Fig. 2D). One bimodal peak was identified corresponding to the HSS1 region. Because digestion by several REs located outside of this region was either unchanged or decreased upon P+I stimulation, the increased digestion most likely reflects a true increase in chromatin accessibility. In addition, for a given RE (for example BglI, in Fig. 2C, left panel), some restriction sites appeared to be cut more efficiently after the P+I stimulation (site 1), whereas others remained unaffected by this treatment (sites 2 and 3). Similar results were obtained using primary T lymphocytes (data not shown).

Based on the chromatin structure analysis of the TNFSF6 locus by means of DNase I, MNase, and RE, we established a tentative map of positioned nucleosomes within the TNFSF6 5' regulatory regions (Fig. 2D). In unstimulated Jurkat cells, the HSS1 region can accommodate two distinct nucleosomes linked by internucleosomal MNase-susceptible DNA (site d in Fig. 2D). Upon P+I stimulation, the relative HSSI region becomes susceptible to nuclease digestion, indicating remodeling of the two corresponding nucleosomes (dashed in Fig. 2D). In addition to the transcription and translation initiation sites, this region contains multiple binding sites for transcription factors (55), suggesting that the presence and the remodeling of the two nucleosomes may play a critical role in TNFSF6 transcriptional regulation.


Figure 2
View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 2.
Analysis of TNFSF6-HSS1 accessibility to MNase and restriction enzymes. A, nuclei from Jurkat cells either left unstimulated (UN) or induced by P+I for 5 h were digested using MNase followed by KpnI digestion and indirect end-labeling analysis. MNase was used at 0.027, 0.053, 0.08, or 0.12 units/ml. Naked DNA purified from the Jurkat cells was digested in vitro using 0.12 and 0.5 units/ml MNase as a control. Hypersensitive sites are labeled by lettering (a–h). Molecular weight markers (M) are a double digest of naked DNA by KpnI and EcoRV (10210 nt), SacI (6010 nt), XhoI (2858 nt), BamHI (1926 nt), BglII (1522 nt), BglI (1183 nt), Hind II (979 nt), or SpeI (667 nt). B, graphic representation of MNase cutting efficiency as assessed by densitometric scanning performed using the Macbas program. Results obtained for the 0.053 units/ml dose of MNase are presented as optical density (OD) arbitrary units. C, nuclei from unstimulated and P+I-induced Jurkat cells were digested in vivo with seven different REs (SphI, SfcI, BamHI, BglI, PvuII, BseRI, and DraII) cutting at 11 distinct sites within the TNFSF6 promoter region spanning nt –471 to +560. After DNA purification and secondary restriction in vitro using KpnI, the samples were analyzed by southern blotting. Representative results obtained using BglI and SfcI are presented. D, from top to bottom, the efficiency of cutting at a given site in panel C was assessed by densitometric scanning of the band resulting from digestion and is presented as a modification index obtained by dividing values obtained for stimulated nuclei by those obtained for unstimulated nuclei; Shown are tentative positioning of nucleosomes (circles) by extrapolation of the data presented in panel A, B, and C and a diagram indicating the locations of the different restriction sites spanning the promoter and the exon 1/intron 1 regions of the TNFSF6 gene. OD, optical density.

 
HSS1 Chromatin Remodeling in Lymphocytic Leukemia Cells—HSS1 accessibility was documented further in a physiopathological context using CLL since altered TNFSF6 expression was reported in these patients (56). To minimize the quantity of biological material required, HSS1 accessibility was investigated using in vivo BglI restriction, as described in Fig. 2C. Restriction of CLL cells yielded a similar restriction pattern as that observed in Jurkat cells, with increased restriction within HSS1 region upon P+I stimulation as compared with other regions that remained unchanged after P+I treatment (Fig. 3A). Increased HSS1 accessibility in P+I-treated CLL cells correlated with TNFSF6 mRNA (Fig. 3B). Collectively, these results support further the correlation between TNFSF6 expression and HSS1 accessibility.

Kinetics of TNFSF6-HSS1 Chromatin and TNFSF6 Gene Transcription—The kinetics of HSS1 chromatin remodeling was next monitored in parallel to TNFSF6 mRNA accumulation. Jurkat cells were stimulated with P+I for variable periods of time followed by DNase I hypersensitivity analysis. An increase in HSS1 DNase I accessibility was observed as early as 30 min after T cell activation (Fig. 4A). TNFSF6 mRNA accumulation, as detected by semiquantitative RT-PCR, increased between 1 and 2 h after T cell activation (Fig. 4B). Hence, HSS1 chromatin remodeling preceded detectable TNFSF6 mRNA accumulation (Fig. 4C), suggesting that HSS1 chromatin remodeling is a primary event in the transcriptional activation of TNFSF6 gene expression.

Requirements for TNFSF6-HSS1 Chromatin Remodeling—To precisely define the conditions leading to HSS1 remodeling and to determine whether these events are sufficient to induce gene transcription, we determined HSSI DNase I accessibility in different settings of T cell activation. A minimal TNFSF6 promoter construct fused to the luciferase reporter gene was used in parallel to monitor for the transcriptional activity induced by these stimuli. Each of the investigated signaling pathways induced HSS1 DNase I accessibility (Fig. 5A) as well as transcriptional activity of the luciferase reporter construct (Fig. 5B), with the exception of the phorbol ester PMA, which induced HSSI DNase I accessibility but not the luciferase reporter construct (Fig. 5, A and B).

Conversely, the P+I-induced transcriptional activity of TNFSF6 promoter was inhibited by CsA or GF109 (data not shown (57)), two drug inhibitors indirectly preventing NF-AT and NF-{kappa}B nuclear translocation, respectively, yet neither CsA nor GF109 impacted on P+I-induced HSSI accessibility (Fig. 5C). Cycloheximide, which inhibits de novo protein synthesis, blocked both P+I-induced HSSI accessibility (Fig. 5C) and endogenous TNFSF6 transcription but not the transcriptional activity of the transfected TNFSF6 luciferase-based reporter construct as assessed by RT-PCR analysis (Fig. 5D (58)). Together with the early P+I-induced HSSI accessibility shown in Fig. 4, these results suggest the involvement of neo-synthesized, immediate-early gene products in HSSI remodeling. Altogether, our results indicate that in Jurkat T cells, HSSI accessibility requires specific T cell activation signals that precede, and most likely are required for TNFSF6 transcription. However, active and efficient TNFSF6 gene transcription further requires additional induced "signals" such as the NF-AT or NF-{kappa}B transcription factors.


Figure 3
View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 3.
TNFSF6-HSS1 accessibility in lymphocytic leukemia cells. Nuclei from three independent unstimulated and P+I-stimulated chronic lymphocytic leukemia samples (CLL1–3) were digested in vivo with BglI followed by indirect end-labeling analysis as described in Fig. 2C. B, PCR amplification was performed using the same samples, with primers specific for TNFSF6 (34 cycles) or beta-actin (25 cycles). The efficiency of cutting at the site marked by an empty triangle in panel A was assessed by densitometric scanning of the band that resulted from the digestion. The efficiency is indicated as a chromatin remodeling index obtained as the ratio of values obtained for stimulated nuclei and those obtained for unstimulated nuclei. M, molecular weight markers.

 
Methylation Levels of TNFSF6-HSS1 Do Not Correlate with TNFSF6 Transcription—The differential accessibility of the TNFSF6 regulatory region HSS1 to nucleases in lymphocytes compared with HeLa cells led us to investigate the DNA methylation profile of HSS1 by sodium bisulfite DNA sequencing (Fig. 6). CpG methylation levels were high in both cell lines. Furthermore, no change of the methylation profile was found in the TNFSF6 regulatory region HSS1 in P+I-stimulated Jurkat cells (Fig. 6). These results show that the CpG methylation levels and patterns in the TNFSF6 regulatory region HSS1 do not correlate with the transcriptional activity of the TNFSF6 promoter.

Role of Histone Deacetylation in TNFSF6-HSS1 Chromatin Remodeling and TNFSF6 Transcription—Because recruitment of histone deacetylases leads to transcriptional repression of many genes, we next sought to determine the effect of histone deacetylase inhibitors on TNFSF6 HSS1 remodeling and transcription. Treatment of Jurkat cells with trichostatin A (TSA), a potent nanomolar inhibitor of class I and II histone deacetylases, induced a marked increase of acetylated histones as verified by Western blotting (Fig. 7A). However, a similar TSA treatment did not induce HSS1 chromatin remodeling, as determined by DNase I hypersensitivity analysis in Jurkat cells (Fig. 7B). In agreement with the lack of HSS1 remodeling, TSA treatment also failed to up-regulate TNFSF 6 transcription in Jurkat cells, as determined either by RT-PCR analysis (Fig. 7C) or by luciferase reporter gene assays (Fig. 7D). In these experiments TSA potently up-regulated IFN{gamma} mRNA levels (Fig. 7C) and promoter activity (Fig. 7D) as previously described. Similar results were observed in CLL despite basal mRNA levels (Fig. 7E) and in freshly isolated peripheral blood lymphocytes either using TSA or valproic acid, a class I selective histone deacetylase inhibitor (Fig. 7F). Selective inhibitors of the third class of deacetylases (class III), also named sirtuins, were also tested (nicotinamide and sirtinol) yet no impact on TNFSF6 transcription could be detected (Fig. 7G). We, thus, conclude from these results that TNFSF6 HSS1 chromatin remodeling can proceed independently of deacetylase activity and that TNFSF6 transcription cannot be induced by deacetylase inhibition.


Figure 4
View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 4.
Kinetics of TNFSF6-HSS1 chromatin remodeling in Jurkat T cells. A, the Jurkat T cells were stimulated by P+I for the indicated periods and analyzed by DNase I digestion followed by indirect end-labeling as described in Fig. 1. B, TNFSF6 mRNA was determined by semiquantitative RT-PCR using TNFSF6 (30 cycles), and beta-actin (25 cycles) primer pairs in non-saturating conditions. C, comparison kinetics of TNFSF6 HSS1 remodeling and mRNA expression. The efficiency of cutting and TNFSF6 mRNA levels were assessed by densitometric scanning of the corresponding band. M, molecular weight markers.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
TNFSF6 can exert either pro- or anti-inflammatory functions, but the effect largely depends on the context and level of expression rather than on TNFSF6 itself (10). Several checkpoints of TNFSF6 gene expression regulation have been described, including transcription control (57, 58), alternative splicing (59), degranulation, and cleavage by metalloproteinases, each contributing to differential TNFSF6 cell surface expression (2, 32). Moreover, the expression level of a decoy receptor, TNFRSF6B (DcR3, TR6), plays a regulatory role in TNFSF6-induced signaling (60). In this study we propose a new TNFSF6 expression regulatory level involving chromatin accessibility of the TNFSF6 promoter region. This conclusion is based on several observations. First, we show that in cells displaying inactive and/or inefficient TNFSF6 gene transcription, TNFSF6 5' regulatory regions displayed a poorly accessible chromatin configuration, as assessed by DNase I, specific restriction enzymes, and MNase restriction over the 20-kilobase DNA region we analyzed. By comparison, a similar study performed on the IL-4 locus identified a complex pattern of 5 clustered DNase I-HSS within a comparable 19-ki-lobase DNA fragment in cells competent for IL-4 production and none or only one HSS in cells not competent for IL-4 production (46). Second, in cells actively producing TNFSF6 (e.g. activated T lymphocytes or leukemia and Natural Killer cell lines), a unique region named HSSI and extending from nucleotide –189 to +185 according to the transcriptional start site, displayed hypersensitivity to digestion by nucleases. This hypersensitive site corresponds to the minimal promoter defined by reporter gene analysis performed in transfected T cells (57). DNase I and MNase preferentially restrict nucleosome-free DNA, whereas MNase also cleaves internucleosomal DNA. Hence, the discrete banding pattern generated by MNase restriction (Fig. 2) indicates precise nucleosome positioning over the analyzed chromatin region, and the MNase-hypersensitive site evidenced in cells actively transcribing TNFSF6 suggests remodeling and/or displacement of the corresponding nucleosome(s). However, a more extensive MNase mapping analysis will be required for high resolution of the HSS1 chromatin region and precise positioning of the corresponding nucleosomes, particularly to define potential candidate transcription factors involved in the process. Third, active TNFSF6 transcription strictly correlated with HSS1 chromatin remodeling that, conversely, did not depend on active and/or efficient gene transcription. In lymphoid T cell lines, agonists inducing TNFSF6 transcription also induced HSS1 chromatin remodeling, whereas agonists inducing HSS1 chromatin remodeling, such as PMA, did not induce TNFSF6 transcription. Drugs preventing HSS1 chromatin remodeling, such as CHX, also blocked TNFSF6 transcription. Fourth, HSS1 chromatin remodeling appears to precede TNFSF6 gene transcription as evidenced by RT-PCR analysis. Run-on experiments will be required to assess this point definitively. However, collectively, these results are in strong support of a localized chromatin remodeling in the TNFSF6 proximal promoter region, allowing or contributing to active and/or efficient gene transcription.


Figure 5
View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 5.
Correlation of TNFSF6 promoter transcriptional activity and chromatin remodeling. A and C, the Jurkat T cells were stimulated for 6 h as indicated in the presence or absence of CsA, GF109, or CHX and analyzed by DNase I digestion followed by indirect end-labeling and southern blotting as shown in Fig. 1. iono, ionomycin. B, the minimal human (nt –455 and –124) pTNFSF6 luciferase reporter gene construct was transfected in Jurkat cells and analyzed for luciferase activity upon the indicated stimuli. Results are representative of three independent experiments. NS, non-stimulated. RLU, relative light units. D, RT-PCR analysis of the TNFSF6 (35 cycles) gene expression and (nt –455 and –124) pTNFSF6 luciferase reporter gene (35 cycles) transcription in the presence or absence of CHX followed by a 4-h P+I stimulation. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (25 cycles) was used as a control. The absence of contaminating plasmid DNA was verified by PCR amplification before reverse transcription (w/o RT); M, molecular weight markers.

 


Figure 6
View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 6.
CpG methylation pattern of the HSS1 and exon 1 region of TNFSF6 in HeLa and Jurkat cell lines. The arrow in HSS1 region denotes the start site of transcription (nucleotide +1). Positions of CpG dinucleotides are shown by open circles and noted with respect to nt +1. Open circles, nonmethylated CpG residues; closed circles, methylated CpG residues. P+I, stimulation with PMA and ionomycin. Sodium bisulfite DNA sequences of independent clones are presented.

 
In an attempt to begin the characterization of the molecular basis for TNFSF6 HSSI chromatin accessibility to the transcriptional machinery, we determined the impact of drugs acting on TNFSF6 transcription and/or known for their effect on chromatin structure and evaluated the DNA methylation status of the TNFSF6 HSS1 region.

Recently it has been shown that nucleosomes positioned across the transcriptional control regions of different genes, including IL-12p35 (61), IL-12p40 (62, 63), IL-2 (64), IFNbeta (42, 65), and HIV-1 long terminal repeat (66), are remodeled upon cell activation. Together with TNFSF6, these genes share a common low (or undetectable) basal transcription rate coupled to a high transcription rate in response to activating factors. It has been proposed that precisely positioned nucleosomes within the promoter region of these genes repress the access of the transcriptional machinery to DNA. Thus, a common feature of several inducible regulatory regions studied to date, now including the TNFSF6 proximal promoter, is the selective remodeling in the chromatin structure in the promoter region upon cell activation. The steps leading to chromatin remodeling and preinitiation complex assembly differ significantly depending upon the gene and its biological context. Studies performed on the IFNbeta gene have identified the assembly of an enhanceosome (containing NF-{kappa}B, IRF-1 and -3, and ATF2) instructing a recruitment program of chromatin modifiers/remodelers and general transcription factors to the promoter (42, 65). A precisely positioned nucleosome blocks the core promoter in unstimulated cells, and the ordered recruitment of chromatin modifiers/remodelers instructed by the induced enhanceosome promotes its sliding to a downstream position, allowing active IFNbeta gene transcription (42, 65). The combined use of DNase I, MNase, and restriction endonucleases delineates nucleosomes positioned upstream and downstream of the TNFSF6 transcription start site (nt –181 according to the translation start site) in unactivated T cell lines, hence likely overlapping a previously identified NF-{kappa}B binding site (67) but leaving nucleosome-free the TNFSF6 transcription start site and the immediate proximal promoter region containing binding sites for various transcription factors, including NF-AT, Egr, and Sp1. Although both GF109 and CsA blocked TNFSF6 transcription, HSS1 chromatin region was still remodeled upon T cell stimulation in the presence of these drugs. These results strongly support the hypothesis that transcription factors downstream of protein kinase C and calcineurin, such as NF-{kappa}B and NF-AT, are not required for HSS1 chromatin remodeling despite their requirement for TNFSF6 gene transcription. However, chromatin immunoprecipitation experiments using specific antibodies against these transcription factors will be required to confirm in vivo this conclusion. Blocking of both TNFSF6 chromatin remodeling and gene transcription by CHX together with the fast kinetic of chromatin remodeling (<30 min) rather implicated the involvement of neo-synthesized immediate-early factors in these events. The identification of these factors will be important to further dissect the molecular events controlling TNFSF6 gene expression.


Figure 7
View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 7.
Impact of deacetylase inhibitors on TNFSF6-HSS1 chromatin remodeling and TNFSF6 transcription. A, the Jurkat T cells were treated or not for 22 h with P+I either in the presence or absence of TSA (300 nM) followed by anti-acetylated (Anti-Ac) H4 immunoblotting. B, Jurkat T cells were either left untreated or stimulated for 6 h by P+I or by TSA as indicated. Subsequently, nuclei were analyzed by DNase I digestion followed by indirect end-labeling and KpnI restriction in vitro. Endogenous TNFSF6 mRNA was determined by RT-PCR after treatment of Jurkat T cells (C and G), CLL cells (E), or isolated peripheral blood lymphocytes (F) with TSA (inhibitor of class I histone deacetylase, 300 nM), valproic acid (VPA, class II inhibitor, 5 mM), nicotinamide (Nam, class III inhibitor, 10 mM), sirtinol (Sir, class III inhibitor, 25 µM), or by P+I. The IFN{gamma} mRNA was used as a control. LTR, long terminal repeat. D, the Jurkat T cells were transfected by either pGL3basic-, pTNFSF6 (nt –486 and +1) or pIFN{gamma} (nt –538 and +63) luciferase reporter gene constructs and treated with either TSA (500 nM) or P+I followed by lysis and determination of luciferase activity. Results are presented as -fold induction obtained by dividing the luciferase values obtained for treated cells by values determined for untreated cells.

 
DNA methylation at the CpG dinucleotide is well known as a mechanism mediating transcriptional repression. Notably, a recent study evidenced a small region in the promoter-enhancer of the interleukin-2 gene that demethylates in T lymphocytes after activation and remains demethylated thereafter (68). We, thus, examined the CpG methylation pattern of the TNFSF6 promoter by sodium bisulfite genomic DNA sequencing in both TNFSF6-transcribing (activated Jurkat T cells) and -non-transcribing cells (HeLa and unstimulated Jurkat T cells). Although the HSS1 and the exon 1 DNA regions showed strong methylation of the CpG dinucleotides, methylation per se did not correlate with HSS1 chromatin accessibility, since the methylation pattern was indistinguishable in the different TNFSF6 transcribing and non-transcribing cells. This result does not exclude a differential recruitment of chromatin modifiers in TNFSF6-transcribing versus -non-transcribing conditions independently of the DNA methylation levels. Because recruitment of histone deacetylases leads to transcriptional repression, either dependent on or independent of DNA methylation (38, 69), we used inhibitors of this enzymatic activity to examine whether histone deacetylases play roles in TNFSF6 chromatin accessibility and transcriptional regulation. The use of distinct inhibitors yielded similar results; deacetylase inhibition yielded no significant HSS1 chromatin remodeling and undetectable TNFSF6 transcription despite efficient chromatin remodeling and/or induced transcription of control genes. Because three distinct classes of human histone deacetylases have been described (70, 71), inhibitors acting on class I (valproic acid), class I and II (TSA), or class III (nicotinamide and sirtinol) were used in our study (72). Of note, despite their enzymatic activity on histone substrates in vitro, recent experimental evidence suggests that class III deacetylases target nonhistone proteins for deacetylation (7375). These observations are in agreement with other studies reporting the lack of effect of deacetylase inhibitors on TNFSF6 transcription in normal or preleukemia cells from mice or from CD34+ cells from normal human donors, yet TNFSF6 transcription is significantly increased in a mouse model of acute promyelocytic leukemia and some human myeloid leukemias (76). On the other hand, deacetylase inhibitors can induce repression of activated TNFSF6 transcription in Jurkat cells, and overexpression of histone acetyltransferases does not impact on TNFSF6 transcriptional activity (77).6 We, thus, conclude from these results that TNFSF6 HSS1 chromatin remodeling can proceed independently of deacetylase activity and that TNFSF6 transcription cannot be induced by deacetylase inhibition.

TNFRSF6 is a frequent target for inactivation during oncogenesis, and TNFRSF6-induced apoptosis plays a crucial role not only in the biology and response of malignant, but also autoimmune and viral diseases. Altered expression of TNFSF6 or TNFRSF6 in tumor or infected cells enabled them to counterattack the immune system (78) and/or resist chemotherapy, likewise by epigenetic silencing (79). In a recent study published during the preparation of our manuscript, deacetylase inhibitors were shown to increase expression of TNFSF6 and TNFSF10, another pro-apoptotic member of the TNFSF family, in blasts from individuals with myelocytic leukemia but not in normal, CD34+ hematopoietic cells (76). In mice with promyelocytic leukemia valproic acid was also reported to up-regulate TNFSF6 expression in leukemia cells but not in preleukemia or in normal cells. This effect correlates with initiation of the caspase cascade and with induction of cellular apoptosis. B-cell chronic lymphocytic leukemia is the most frequent leukemia in the adult life of humans in western countries. Yet cells from chronic lymphocytic leukemia patients examined in the present work displayed a similar pattern of HSS1 chromatin accessibility as that observed in normal T cells (Fig. 3). It might, therefore, be interesting to search for altered chromatin remodeling of the TNFSF6 promoter region in such pathological conditions associated with altered expression of TNFSF6 that would, thus, provide a novel therapeutic target. The identification of the mechanisms involved in the herein-described TNFSF6 HSS1 chromatin remodeling would help to clarify that issue.


    FOOTNOTES
 
* This work was supported by grants from the INSERM and the Université Libre de Bruxelles ARC Program 04/09-309 and by grants from the Association Nationale de Recherche contre le Syndrome d'Immunodéficience acquise (SIDA), Fonds National de la Recherche Scientifique (Belgium), Télévie-program, the International Brachet Stiftung, Commissariat Général aux Relations Internationnales/INSERM cooperation, région Wallonne-Commission Européenne Fonds Européen de Développement Régional, and Theyskens-Mineur Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 These authors equally contributed to this work and are fellows from Association Nationale de Recherche contre le Syndrome d'Immunodéficience acquise (SIDA). Back

2 Aspirant of the Fonds National de la Recherche. Back

3 Maître de Recherches of the Fonds National de la Recherche. Back

4 To whom correspondence should be addressed: UMR599 INSERM, Centre de Recherche en Cancérologie de Marseille, 27 Boulevard Lei Roure, 13009 Marseille, France. Tel.: 33-491-75-84-13; Fax: 33-491-26-03-64; E-mail: collette{at}marseille.inserm.fr.

5 The abbreviations used are: IL, interleukin; CsA, cyclosporin A; CHX, cycloheximide; CLL, chronic lymphocytic leukemia; PMA, phorbol 12-myristate 13-acetate; TSA, trichostatin A; RT, reverse transcription; HSS, hypersensitive site; MNase, micrococcal nuclease; RE, restriction endonuclease; nt, nucleotides. Back

6 B. Vire and Y. Collette, unpublished results. Back



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Locksley, R. M., Killeen, N., and Lenardo, M. J. (2001) Cell 104, 487–501[CrossRef][Medline] [Order article via Infotrieve]
  2. Nagata, S. (1999) Annu. Rev. Genet. 33, 29–55[CrossRef][Medline] [Order article via Infotrieve]
  3. Fisher, G. H., Rosenberg, F. J., Straus, S. E., Dale, J. K., Middleton, L. A., Lin, A. Y., Strober, W., Lenardo, M. J., and Puck, J. M. (1995) Cell 81, 935–946[CrossRef][Medline] [Order article via Infotrieve]
  4. Rieux-Laucat, F., Le Deist, F., Hivroz, C., Roberts, I. A., Debatin, K. M., Fischer, A., and de Villartay, J. P. (1995) Science 268, 1347–1349[Abstract/Free Full Text]
  5. Drappa, J., Vaishnaw, A. K., Sullivan, K. E., Chu, J. L., and Elkon, K. B. (1996) N. Engl. J. Med. 335, 1643–1649[Abstract/Free Full Text]
  6. Sieg, S., Huang, Y., and Kaplan, D. (1997) J. Immunol. 159, 1192–1199[Abstract]
  7. Straus, S. E., Jaffe, E. S., Puck, J. M., Dale, J. K., Elkon, K. B., Rosen-Wolff, A., Peters, A. M., Sneller, M. C., Hallahan, C. W., Wang, J., Fischer, R. E., Jackson, C. M., Lin, A. Y., Baumler, C., Siegert, E., Marx, A., Vaishnaw, A. K., Grodzicky, T., Fleisher, T. A., and Lenardo, M. J. (2001) Blood 98, 194–200[Abstract/Free Full Text]
  8. Ramenghi, U., Bonissoni, S., Migliaretti, G., DeFranco, S., Bottarel, F., Gambaruto, C., DiFranco, D., Priori, R., Conti, F., Dianzani, I., Valesini, G., Merletti, F., and Dianzani, U. (2000) Blood 95, 3176–3182[Abstract/Free Full Text]
  9. Siegel, R. M., Chan, F. K., Chun, H. J., and Lenardo, M. J. (2000) Nat. Immunol. 1, 469–474[CrossRef][Medline] [Order article via Infotrieve]
  10. O'Connell, J., Houston, A., Bennett, M. W., O'Sullivan, G. C., and Shanahan, F. (2001) Nat. Med. 7, 271–274[CrossRef][Medline] [Order article via Infotrieve]
  11. Suda, T., Takahashi, T., Golstein, P., and Nagata, S. (1993) Cell 75, 1169–1178[CrossRef][Medline] [Order article via Infotrieve]
  12. Griffith, T. S., Brunner, T., Fletcher, S. M., Green, D. R., and Ferguson, T. A. (1995) Science 270, 1189–1192[Abstract/Free Full Text]
  13. Bellgrau, D., Gold, D., Selawry, H., Moore, J., Franzusoff, A., and Duke, R. C. (1995) Nature 377, 630–632[CrossRef][Medline] [Order article via Infotrieve]
  14. Suda, T., Okazaki, T., Naito, Y., Yokota, T., Arai, N., Ozaki, S., Nakao, K., and Nagata, S. (1995) J. Immunol. 154, 3806–3813[Abstract]
  15. Faris, M., Latinis, K. M., Kempiak, S. J., Koretzky, G. A., and Nel, A. (1998) Mol. Cell. Biol. 18, 5414–5424[Abstract/Free Full Text]
  16. Faris, M., Kokot, N., Latinis, K., Kasibhatla, S., Green, D. R., Koretzky, G. A., and Nel, A. (1998) J. Immunol. 160, 134–144[Abstract/Free Full Text]
  17. Holtz-Heppelmann, C. J., Algeciras, A., Badley, A. D., and Paya, C. V. (1998) J. Biol. Chem. 273, 4416–4423[Abstract/Free Full Text]
  18. Mittelstadt, P. R., and Ashwell, J. D. (1998) Mol. Cell. Biol. 18, 3744–3751[Abstract/Free Full Text]
  19. Kasibhatla, S., Brunner, T., Genestier, L., Echeverri, F., Mahboubi, A., and Green, D. R. (1998) Mol. Cell 1, 543–551[CrossRef][Medline] [Order article via Infotrieve]
  20. Li-Weber, M., Laur, O., Hekele, A., Coy, J., Walczak, H., and Krammer, P. H. (1998) Eur. J. Immunol. 28, 2373–2383[CrossRef][Medline] [Order article via Infotrieve]
  21. Li-Weber, M., Laur, O., and Krammer, P. H. (1999) Eur. J. Immunol. 29, 3017–3027[CrossRef][Medline] [Order article via Infotrieve]
  22. Xiao, S., Matsui, K., Fine, A., Zhu, B., Marshak-Rothstein, A., Widom, R. L., and Ju, S. T. (1999) Eur. J. Immunol. 29, 3456–3465[CrossRef][Medline] [Order article via Infotrieve]
  23. Kasibhatla, S., Genestier, L., and Green, D. R. (1999) J. Biol. Chem. 274, 987–992[Abstract/Free Full Text]
  24. Mittelstadt, P. R., and Ashwell, J. D. (1999) J. Biol. Chem. 274, 3222–3227[Abstract/Free Full Text]
  25. McClure, R. F., Heppelmann, C. J., and Paya, C. V. (1999) J. Biol. Chem. 274, 7756–7762[Abstract/Free Full Text]
  26. Chou, C. F., Peng, H. W., Wang, C. Y., Yang, Y. T., and Han, S. H. (2000) J. Biomed. Sci. 7, 136–143[CrossRef][Medline] [Order article via Infotrieve]
  27. Brunner, T., Kasibhatla, S., Pinkoski, M. J., Frutschi, C., Yoo, N. J., Echeverri, F., Mahboubi, A., and Green, D. R. (2000) J. Biol. Chem. 275, 9767–9772[Abstract/Free Full Text]
  28. Kavurma, M. M., Bobryshev, Y., and Khachigian, L. M. (2002) J. Biol. Chem. 277, 36244–36252[Abstract/Free Full Text]
  29. Anel, A., Buferne, M., Boyer, C., Schmitt-Verhulst, A. M., and Golstein, P. (1994) Eur. J. Immunol. 24, 2469–2476[Medline] [Order article via Infotrieve]
  30. Norian, L. A., Latinis, K. M., Eliason, S. L., Lyson, K., Yang, C., Ratliff, T., and Koretzky, G. A. (2000) J. Immunol. 164, 4471–4480[Abstract/Free Full Text]
  31. Li, J. H., Rosen, D., Ronen, D., Behrens, C. K., Krammer, P. H., Clark, W. R., and Berke, G. (1998) J. Immunol. 161, 3943–3949[Abstract/Free Full Text]
  32. Bossi, G., and Griffiths, G. M. (1999) Nat. Med. 5, 90–96[CrossRef][Medline] [Order article via Infotrieve]
  33. Kayagaki, N., Kawasaki, A., Ebata, T., Ohmoto, H., Ikeda, S., Inoue, S., Yoshino, K., Okumura, K., and Yagita, H. (1995) J. Exp. Med. 182, 1777–1783[Abstract/Free Full Text]
  34. Tanaka, M., Suda, T., Haze, K., Nakamura, N., Sato, K., Kimura, F., Motoyoshi, K., Mizuki, M., Tagawa, S., Ohga, S., Hatake, K., Drummond, A. H., and Nagata, S. (1996) Nat. Med. 2, 317–322[Medline] [Order article via Infotrieve]
  35. Levine, M., and Tjian, R. (2003) Nature 424, 147–151[CrossRef][Medline] [Order article via Infotrieve]
  36. Fry, C. J., and Peterson, C. L. (2002) Science 295, 1847–1848[Abstract/Free Full Text]
  37. Narlikar, G. J., Fan, H. Y., and Kingston, R. E. (2002) Cell 108, 475–487[CrossRef][Medline] [Order article via Infotrieve]
  38. Berger, S. L. (2002) Curr. Opin. Genet. Dev. 12, 142–148[CrossRef][Medline] [Order article via Infotrieve]
  39. Burgers, W. A., Fuks, F., and Kouzarides, T. (2002) Trends Genet. 18, 275–277[CrossRef][Medline] [Order article via Infotrieve]
  40. Gamble, M. J., and Freedman, L. P. (2002) Trends Biochem. Sci. 27, 165–167[CrossRef][Medline] [Order article via Infotrieve]
  41. Orphanides, G., and Reinberg, D. (2002) Cell 108, 439–451[CrossRef][Medline] [Order article via Infotrieve]
  42. Agalioti, T., Lomvardas, S., Parekh, B., Yie, J., Maniatis, T., and Thanos, D. (2000) Cell 103, 667–678[CrossRef][Medline] [Order article via Infotrieve]
  43. Agalioti, T., Chen, G., and Thanos, D. (2002) Cell 111, 381–392[CrossRef][Medline] [Order article via Infotrieve]
  44. Soutoglou, E., and Talianidis, I. (2002) Science 295, 1901–1904[Abstract/Free Full Text]
  45. Smale, S. T., and Fisher, A. G. (2002) Annu. Rev. Immunol. 20, 427–462[CrossRef][Medline] [Order article via Infotrieve]
  46. Agarwal, S., and Rao, A. (1998) Immunity 9, 765–775[CrossRef][Medline] [Order article via Infotrieve]
  47. Bird, J. J., Brown, D. R., Mullen, A. C., Moskowitz, N. H., Mahowald, M. A., Sider, J. R., Gajewski, T. F., Wang, C. R., and Reiner, S. L. (1998) Immunity 9, 229–237[CrossRef][Medline] [Order article via Infotrieve]
  48. Takemoto, N., Kamogawa, Y., Jun Lee, H., Kurata, H., Arai, K. I., O'Garra, A., Arai, N., and Miyatake, S. (2000) J. Immunol. 165, 6687–6691[Abstract/Free Full Text]
  49. Bagnasco, M., Nunes, J., Lopez, M., Cerdan, C., Pierres, A., Mawas, C., and Olive, D. (1989) Eur. J. Immunol. 19, 823–827[Medline] [Order article via Infotrieve]
  50. Costello, R., Cerdan, C., Pavon, C., Brailly, H., Hurpin, C., Mawas, C., and Olive, D. (1993) Eur. J. Immunol. 23, 608–613[Medline] [Order article via Infotrieve]
  51. Nunes, J., Klasen, S., Ragueneau, M., Pavon, C., Couez, D., Mawas, C., Bagnasco, M., and Olive, D. (1993) Int. Immunol. 5, 311–315[Abstract/Free Full Text]
  52. Collette, Y., Razanajaona, D., Ghiotto, M., and Olive, D. (1997) Eur. J. Immunol. 27, 3283–3289[Medline] [Order article via Infotrieve]
  53. Olek, A., Oswald, J., and Walter, J. (1996) Nucleic Acids Res. 24, 5064–5066[Abstract/Free Full Text]
  54. Kashii, Y., Giorda, R., Herberman, R. B., Whiteside, T. L., and Vujanovic, N. L. (1999) J. Immunol. 163, 5358–5366[Abstract/Free Full Text]
  55. Kavurma, M. M., and Khachigian, L. M. (2003) Cell Death Differ. 10, 36–44[CrossRef][Medline] [Order article via Infotrieve]
  56. Sampalo, A., Navas, G., Medina, F., Segundo, C., Camara, C., and Brieva, J. A. (2000) Blood 96, 3168–3174[Abstract/Free Full Text]
  57. Latinis, K. M., Carr, L. L., Peterson, E. J., Norian, L. A., Eliason, S. L., and Koretzky, G. A. (1997) J. Immunol. 158, 4602–4611[Abstract]
  58. Wang, R., Zhang, L., Zhang, X., Moreno, J., Luo, X., Tondravi, M., and Shi, Y. (2001) J. Immunol. 166, 1983–1990[Abstract/Free Full Text]
  59. Ayroldi, E., D'Adamio, F., Zollo, O., Agostini, M., Moraca, R., Cannarile, L., Migliorati, G., Delfino, D. V., and Riccardi, C. (1999) Blood 94, 3456–3467[Abstract/Free Full Text]
  60. Zhang, J., Salcedo, T. W., Wan, X., Ullrich, S., Hu, B., Gregorio, T., Feng, P., Qi, S., Chen, H., Cho, Y. H., Li, Y., Moore, P. A., and Wu, J. (2001) J. Clin. Investig. 107, 1459–1468[CrossRef][Medline] [Order article via Infotrieve]
  61. Goriely, S., Demonte, D., Nizet, S., De Wit, D., Willems, F., Goldman, M., and Van Lint, C. (2003) Blood 101, 4894–4902[Abstract/Free Full Text]
  62. Weinmann, A. S., Plevy, S. E., and Smale, S. T. (1999) Immunity 11, 665–675[CrossRef][Medline] [Order article via Infotrieve]
  63. Weinmann, A. S., Mitchell, D. M., Sanjabi, S., Bradley, M. N., Hoffmann, A., Liou, H. C., Smale, S. T., and Plevy, S. E. (2001) Nat. Immunol. 2, 51–57[CrossRef][Medline] [Order article via Infotrieve]
  64. Attema, J. L., Reeves, R., Murray, V., Levichkin, I., Temple, M. D., Tremethick, D. J., and Shannon, M. F. (2002) J. Immunol. 169, 2466–2476[Abstract/Free Full Text]
  65. Lomvardas, S., and Thanos, D. (2002) Cell 110, 261–271[CrossRef][Medline] [Order article via Infotrieve]
  66. Verdin, E., Paras, P., Jr., and Van Lint, C. (1993) EMBO J. 12, 3249–3259[Medline] [Order article via Infotrieve]
  67. Li-Weber, M., Laur, O., Dern, K., and Krammer, P. H. (2000) Eur. J. Immunol. 30, 661–670[CrossRef][Medline] [Order article via Infotrieve]
  68. Bruniquel, D., and Schwartz, R. H. (2003) Nat. Immunol. 4, 235–240[CrossRef][Medline] [Order article via Infotrieve]
  69. Jones, P. L., Veenstra, G. J., Wade, P. A., Vermaak, D., Kass, S. U., Landsberger, N., Strouboulis, J., and Wolffe, A. P. (1998) Nat. Genet. 19, 187–191[CrossRef][Medline] [Order article via Infotrieve]
  70. de Ruijter, A. J., van Gennip, A. H., Caron, H. N., Kemp, S., and van Kuilenburg, A. B. (2003) Biochem. J. 370, 737–749[CrossRef][Medline] [Order article via Infotrieve]
  71. Gasser, S. M., and Cockell, M. M. (2001) Gene (Amst.) 279, 1–16[CrossRef][Medline] [Order article via Infotrieve]
  72. Johnstone, R. W. (2002) Nat. Rev. Drug Discov. 1, 287–299[CrossRef][Medline] [Order article via Infotrieve]
  73. Luo, J., Nikolaev, A. Y., Imai, S., Chen, D., Su, F., Shiloh, A., Guarente, L., and Gu, W. (2001) Cell 107, 137–148[CrossRef][Medline] [Order article via Infotrieve]
  74. Motta, M. C., Divecha, N., Lemieux, M., Kamel, C., Chen, D., Gu, W., Bultsma, Y., McBurney, M., and Guarente, L. (2004) Cell 116, 551–563[CrossRef][Medline] [Order article via Infotrieve]
  75. Yeung, F., Hoberg, J. E., Ramsey, C. S., Keller, M. D., Jones, D. R., Frye, R. A., and Mayo, M. W. (2004) EMBO J. 23, 2369–2380[CrossRef][Medline] [Order article via Infotrieve]
  76. Insinga, A., Monestiroli, S., Ronzoni, S., Gelmetti, V., Marchesi, F., Viale, A., Altucci, L., Nervi, C., Minucci, S., and Pelicci, P. G. (2005) Nat. Med. 11, 71–76[CrossRef][Medline] [Order article via Infotrieve]
  77. Wang, R., Brunner, T., Zhang, L., and Shi, Y. (1998) Oncogene 17, 1503–1508[CrossRef][Medline] [Order article via Infotrieve]
  78. Poulaki, V., Mitsiades, C. S., and Mitsiades, N. (2001) Drug Resist. Updat. 4, 233–242[CrossRef][Medline] [Order article via Infotrieve]
  79. Maecker, H., Yun, Z., and Giaccia, A. (2002) Cancer Cells 2, 139–148

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/21/14719    most recent
M602373200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Castellano, R.
Right arrow Articles by Collette, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Castellano, R.
Right arrow Articles by Collette, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement