|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 281, Issue 23, 15741-15746, June 9, 2006
The FATC Domains of PIKK Proteins Are Functionally Equivalent and Participate in the Tip60-dependent Activation of DNA-PKcs and ATM*
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
PIKK proteins are defined by the presence of several conserved protein domains. The N terminus of each is predicted to consist of multiple HEAT domains, a protein domain involved in mediating protein-protein interactions (10, 11). The C-terminal of PIKK proteins contains the conserved FAT/kinase domain/FATC structure that is present as a single unit in all known PIKK proteins (12). The FAT domain is weakly conserved between family members, whereas the kinase domain is highly conserved and is essential for the function of these proteins (2). The exception is Trrap. Trrap is the core component of NuA4, a multisubunit chromatin-remodeling complex containing both histone acetyltransferase (HAT) and ATPase activity (1, 13, 14). Trrap retains the conserved kinase domain but lacks the conserved amino acids required for ATP binding and catalytic activity (15). The extreme C-terminal of the PIKK proteins also contains the 33-amino acid FATC domain. This domain is required for the kinase activity of the mTor (16) and DNA-PKcs proteins (17, 18), indicating it plays a critical role in regulating kinase activity. Structural studies on DNA-PKcs indicate that the kinase domain forms a central domain from which the FAT and FATC domains protrude (19). However, the exact function of the FAT and FATC domains of PIKK proteins is unknown.
Recently, we demonstrated that the ATM protein forms a complex with the Tip60 histone acetyltransferase (20). Following exposure to ionizing radiation, Tip60 acetylates ATM, leading to the activation of ATM kinase activity. Tip60 is therefore a key upstream regulator of the ATM protein. The interaction between ATM and Tip60 is mediated by the FATC domain of ATM, and the introduction of point mutations into the FATC domain of ATM inhibits this interaction (20). One potential function for the FATC domain of ATM is to mediate the association between ATM and Tip60. Because the FATC domain is conserved between PIKK proteins, this predicts that the FATC domain of the PIKK proteins DNA-PKcs, Atr, and Trrap may also mediate association with Tip60. Here, we report on studies designed to test this possibility.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Immunoprecipitation, Kinase Assays, and HAT AssaysCells were lysed in lysis buffer (20 mM Hepes, pH 7.4, 150 mM NaCl, 0.2% Tween 20, 1.5 mM MgCl2, 1 mM EGTA, 2 mM dithiothreitol, 50 mM NaF, 500 µM Na3VO4, 1 mM phenylmethylsulfonyl fluoride, 3 µg/ml of aprotinin, 3 µg/ml of leupeptin). Immunoprecipitates were washed three times in lysis buffer and once in base buffer (10 mM Hepes, pH 7.4, 10 mM MgCl2, 50 mM NaCl, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride). For immunokinase assays, immunoprecipitates were washed twice in kinase buffer (10 mM Hepes, pH 7.4, 10 mM MgCl2, 50 mM NaCl, 10 mM MnCl2) and incubated in 50 µl of kinase buffer supplemented with 50 µM ATP, p53 peptide (2 µg of EPPLSQEAFADLWKK), and 10 µCi of [
-32P]ATP for 30 min at 30 °C. Reactions were terminated with 30% acetic acid (20 µl) and an aliquot spotted onto P81 paper. Filters were washed five times in 15% acetic acid, air dried, and counted. For HAT assays, immunoprecipitates were washed twice in HAT assay buffer (50 mM Tris, pH 8, 10% glycerol, 0.1 mM EDTA, 1 mM dithiothreitol) and incubated in 60 µl of HAT assay buffer supplemented with acetyl-CoA (100 µM) and biotinylated histone H4 peptide (0.5 µg) for 30 min at 30 °C. An aliquot of the reaction was immobilized onto streptavidin plates and acetylation detected using a HAT enzyme-linked immunosorbent assay according to the manufacturer's instructions (Upstate Biotechnology).
ATM ConstructsA Blp1-XhoI fragment encoding the C-terminal and 3'-untranslated region of ATM was subcloned into pBluescript. Point mutations were inserted by site-directed mutagenesis to create restriction sites for SpeI (nucleotide 9279: A9281T/G9282A) and EcoR1 (nucleotide 9373: A8378C). The nucleotide sequence encoding the C-terminus of ATM was then removed by SpeI/EcoR1 digestion. Oligonucleotides containing overhanging SpeI/EcoR1 sites encoding the FATC domains of Trrap, Atr, DNA-PKcs, or that inserted a stop codon to delete the FATC domain, were then inserted. Full-length ATM was digested with Blp1/XhoI to remove the FATC domain and the corresponding new constructs ligated in. Oligonucleotides used were: Deletion, ctagtctgatcttgagtagagg; Atr, ctagtccattaccttatacaagaagctactgatgaaaacttactatgccagatgtatcttggttggactccatatatgtg; Trrap, ctagtgaacaccctggtggccgcggcaaacagcctggacaatctgtgccgcatggaccccgcctggcacccctggctgtg; DNA-PKcs, ctagtgaagtgcctgatggaccaggcaacagaccccaacatccttggcagaacctgggaaggatgggagccctggatgtg.
| RESULTS |
|---|
|
|
|---|
FATC. In addition, 3 chimeric constructs, in which the FATC domain of ATM was replaced with the FATC domain of either Atr, Trrap, or DNA-PKcs, were constructed. Each of these chimeric constructs was expressed in the ATM-deficient GM5849 cell line, derived from an ataxia telangiectasia patient. ATMAtr, ATMDNAPK, and ATMTrrap constructs were expressed at similar levels to ATM, whereas ATM
FATC was present at lower levels compared with ATM (Fig. 1b). Deletion or replacement of the FATC domain of ATM did not, therefore, significantly destabilize the protein. To examine whether the interaction between ATM and Tip60 required the FATC domain, AT cells expressing either ATM, ATM
FATC, or the chimeric ATM proteins were immunoprecipitated with ATM antibody and then examined for the presence of co-precipitating Tip60. In AT cells that lack ATM expression no coprecipitating Tip60 was detected (Fig. 1b, Vector). When ATM was expressed in AT cells, Tip60 was readily detected in association with ATM (Fig. 1b). Further, the interaction between ATM and Tip60 was not altered following exposure to the DNA-damaging agent bleomycin. When the FATC domain of ATM was deleted, the interaction between ATM and Tip60 was abolished, indicating that the FATC domain is required to mediate this interaction. However, when the FATC domain of ATM was replaced with the FATC domain of Atr, DNA-PKcs, or Trrap, the interaction between ATM and Tip60 was restored. This demonstrates that the FATC domains of Atr, DNA-PKcs, and Trrap are functionally interchangeable.
|
|
FATC, were localized to the nucleus of the cell (supplemental Fig. S1). In Fig. 2a, immunokinase assays were carried out to monitor intrinsic ATM kinase activity. AT cells immunoprecipitated with ATM antibody displayed no significant ATM kinase activity (Fig. 2a, Vec). AT cells expressing ATM exhibited ATM kinase activity that was increased in response to bleomycin. ATM
FATC had similar basal kinase activity to full-length ATM; however, ATM
FATC did not exhibit DNA damage-induced activation of its kinase activity in response to bleomycin (Fig. 2a). Mutations in ATM frequently lead to loss of ATM kinase activity (24). The observation that the ATM
FATC protein retained basal kinase activity suggests that deletion of the FATC domain (which is adjacent to the kinase domain) did not significantly disrupt the overall protein structure. The inability of ATM
FATC to increase its kinase activity in response to DNA damage is therefore consistent with the observation that the association of Tip60 with the FATC domain of ATM is required for activation of ATM kinase activity (20). When the FATC domains Atr, DNA-PK, or Trrap were inserted into ATM
FATC, the activation of ATM kinase activity by bleomycin was restored (Fig. 2a). The ability of ATM to phosphorylate and activate key target proteins is required for ATM to regulate the cell response to ionizing radiation (21). Because the FATC domain of ATM is adjacent to the kinase domain, the FATC domain may influence the ability of ATM to phosphorylate key target proteins. That is, replacing the FATC domain of ATM with the FATC domain of Atr, Trrap, or DNA-PK may restore activation of ATM kinase activity but prevent ATM from efficiently phosphorylating downstream effector proteins. The failure of the chimeric proteins to correctly phosphorylate downstream effector proteins would prevent ATM from regulating the ability of the cells to survive exposure to ionizing radiation. To test this possibility, we examined whether the chimeric ATM proteins could complement the increased radiosensitivity of AT cells. In Fig. 2b, AT cells were sensitive to ionizing radiation and re-expression of ATM increased cell survival. In contrast, expression of ATM
FATC had no effect on radiosensitivity, consistent with the failure of this protein to exhibit either increased kinase activity or autophosphorylation of serine 1981 of ATM in response to bleomycin-induced DNA damage (Figs. 1b and 2a). ATMAtr, ATMDNAPK, and ATMTrrap were all able to complement the increased sensitivity of AT cells to ionizing radiation, although they were all slightly less effective then ATM. Figs. 1 and 2 demonstrate that the FATC domain of ATM is required for the formation of ATM-Tip60 complexes, the activation of ATM kinase activity, and the subsequent phosphorylation and acetylation of ATM. Further, the FATC domains of Trrap, Atr, and DNA-PK are functionally equivalent, implying that the FATC domains of these proteins mediate association with Tip60. Both ATM (Fig. 1b) and Trrap (1, 25, 26) have been previously found in association with the Tip60 protein. Here, we examined whether DNA-PKcs were also associated with Tip60. To identify the potential association between DNA-PKcs and Tip60, cell extracts were immunoprecipitated with Tip60 antibody and co-precipitating DNA-PKcs detected by Western blot analysis (Fig. 3a). DNA-PKcs was co-precipitated with Tip60 antibody, but not IgG (Fig. 3a, lanes 1 and 2). The levels of DNA-PKcs in whole cell extracts (lane 5) and immunoprecipitated with DNA-PKcs (lane 4) are shown for comparison. To further confirm this interaction between Tip60 and DNA-PKcs, we utilized HeLa cells that stably express HA-Tip60 (described in Refs. 20, 27). Fig. 3b demonstrates that immunoprecipitation of HeLa cells expressing HA-Tip60 with DNA-PKcs antibody yielded both DNA-PKcs and HA-Tip60. The reciprocal experiment, in which cells were immunoprecipitated with HA antibody, also yielded both HA-Tip60 and DNA-PKcs. Furthermore, this interaction between Tip60 and DNA-PKcs was constitutive, because there was no detectable change in the interaction between DNA-PKcs and HA-Tip60 after exposure to bleomycin (Fig. 3b). The Tip60-DNA-PKcs immune complex also contained associated Ku70 protein (supplemental Fig. 2a), a regulatory subunit of DNA-PKcs. Further, the Tip60-DNA-PKcs complex could not be dissociated by treatment with ethidium bromide (supplemental Fig. S2, panel b), demonstrating that DNA is not required for the interaction between Tip60 and DNA-PK. DNA-PKcs and Tip60 are therefore components of a complex containing the Ku70 regulatory protein in vivo. We also examined whether Atr could also associate with Tip60. However, no significant interaction between endogenous Atr and Tip60 was detected (data not shown). Whether this is a technical problem related to antibody specificity or availability of epitopes, or because Atr does not interact with Tip60 in vivo, is not known.
We previously demonstrated that the HAT activity of the Tip60 bound to ATM was specifically activated in response to DNA damage (20). Because DNA-PKcs is constitutively associated with Tip60, the HAT activity of Tip60 associated with DNA-PK may also be activated in response to DNA damage. Trrap is a key component of NuA4, a chromatin-remodeling complex that contains the Tip60 protein (13). In yeast, NuA4 is recruited to sites of DNA damage where it may acetylate histones at sites of DNA strand breaks (28). Thus, the Tip60 bound to NuA4 (via Trrap) may also be up-regulated in response to DNA damage. We therefore examined whether the HAT activity of the ATM-Tip60, DNA-PKcs-Tip60, and Trrap-Tip60 complexes was increased in response to bleomycin treatment.
|
The presence of a DNA-PKcs-Tip60 complex in cells and the activation of this DNA-PKcs-associated HAT activity implies that Tip60 activation may be required for the activation of the DNA-PKcs protein. Recent studies have shown that DNA-PKcs undergoes autophosphorylation at multiple sites in response to DNA damage (29). At least seven sites have been identified, with the majority clustered in a 38-amino acid domain located between amino acids 2609 and 2638 (29, 30). Mutations in these sites have been shown to impair double strand break repair and increase cellular sensitivity to ionizing radiation (3035). Although the exact role of these sites in regulating DNA-PKcs is still under investigation, autophosphorylation at serine 2056 and threonine 2609 has now been demonstrated to occur in vivo (32, 34). Further, mutations in these amino acids affect repair of DNA strand breaks and the ability of cells to survive exposure to ionizing radiation (32, 34). To test whether Tip60 was required for the autophosphorylation of DNA-PKcs, we examined whether silencing of Tip60 expression with siRNA blocked the autophosphorylation of DNA-PKcs at serine 2056 and threonine 2609.
In Fig. 4, Tip60 expression was reduced by expression of Tip60 siRNA but not by control green fluorescent protein siRNA. The role of Tip60 in the autophosphorylation of DNA-PKcs and the interaction of DNA-PKcs with the Ku70/Ku80 heterodimer was examined next. Immunoprecipitated DNA-PKcs underwent rapid autophosphorylation on both serine 2056 and threonine 2609 in response to bleomycin (Fig. 4). In cells depleted of Tip60 by siRNA, autophosphorylation of serine 2056 and threonine 2609 of DNA-PKcs was greatly reduced. This demonstrates a requirement for the Tip60 protein for the autophosphorylation of DNA-PKcs in response to DNA damage induced by bleomycin. It has been reported that the Ku70/Ku80 complex stimulates the kinase activity of DNA-PKcs in vitro (36, 37) and that Ku80 is required for the autophosphorylation of threonine 2609 of DNA-PKcs in response to DNA damage (34). Therefore, we examined whether Tip60 was required for the interaction between DNA-PKcs and its regulatory subunits Ku70 and Ku80. Fig. 4 demonstrates that the interaction between DNA-PKcs and the Ku70 and Ku80 proteins was not altered by either bleomycin treatment or depletion of Tip60 by siRNA (Fig. 4). Tip60 therefore does not regulate the autophosphorylation of DNA-PKcs through the assembly or disassembly of the DNA-PK complex. Although serine 2056 of DNA-PKcs is a well defined DNA-PKcs autophosphorylation site, autophosphorylation of threonine 2609 can be influenced by the ATM protein (34). Because Tip60 is required for the activation of the ATM protein kinase (20), the reduced autophosphorylation of threonine 2609 may result from impaired activation of both ATM and DNA-PKcs in Tip60-deficient cells. However, autophosphorylation of serine 2056 of DNA-PKcs is independent of ATM and reflects the endogenous kinase activity of the DNA-PKcs protein. Fig. 4 therefore shows that activation of DNA-PKcs kinase activity requires the Tip60 protein.
|
| DISCUSSION |
|---|
|
|
|---|
Our results provide several lines of evidence that indicate a crucial role for the Tip60 HAT in the activation of DNA-PKcs kinase activity. DNA-PKcs was constitutively associated with Tip60 in vivo, and the HAT activity associated with DNA-PKcs was increased
5-fold in response to bleomycin treatment. Further, silencing of Tip60 expression blocked the autophosphorylation of DNA-PKcs at serine 2056 and threonine 2609. Autophosphorylation of these 2 residues has been reported to be essential for DNA-PKcs to regulate both DNA repair and cell survival (32, 34). We interpret our results to indicate that the activation of DNA-PKcs kinase activity proceeds through a mechanism involving the Tip60 histone acetyltransferase and may involve the acetylation of key components of the DNA-PK complex by Tip60. Several other proteins, including the Ku70/Ku80 heterodimer (34) and the MDC1 protein (38), are also required for the recruitment of DNA-PKcs to sites of DNA damage and for the activation of its kinase activity. Whether the Ku70, Ku80, or mdc1 proteins mediate the activation of Tip60 bound to DNA-PKcs is not known. Finally, both ATM and DNA-PKcs are activated in response to genotoxic agents that give rise to DNA strand breaks. The finding that DNA-PKcs and ATM share a common activating step suggests that Tip60 plays a key role in the early detection and activation of both PIKK proteins in response to DNA strand breaks.
Trrap is the key organizing component of the NuA4 chromatin-remodeling complex (1), a 16-subunit complex containing both ATPase activity and HAT activity. The HAT activity of NuA4 is supplied by Tip60 (25), and the C-terminal of Trrap (including the FATC domain) is essential for the Trrap complex to recruit HAT activity to NuA4 (26). These results are consistent with the FATC domain of Trrap recruiting Tip60 to the NuA4 complex. In yeast, NuA4 has been shown to be recruited to sites of DNA damage through association with
H2AX, where it may regulate chromatin structure during DNA repair (28, 39). However, unlike the ATM-Tip60 and DNA-PKcs-Tip60, the HAT activity of the NuA4-Tip60 complex was not measurably increased in response to DNA damage. The recruitment of the active NuA4-Tip60 complex to sites of DNA damage, rather than up-regulation of the associated Tip60 HAT activity, may therefore be the main mechanism for NuA4-Tip60 function during DNA repair.
Several studies have examined the function of the FATC domain of PIKK proteins. In ataxia telangiectasia patients, truncating mutations within the C-terminus that delete part or all of the FATC domain are associated with decreased kinase activity (40). Mutations (18) or truncations (17) in the FATC domain of DNA-PKcs lead to decreased expression of DNA-PKcs protein and reduced intrinsic kinase activity. In mec1, the yeast homolog of Atr (23), and mTor (16), deletion or mutation of the FATC domain also reduces the intrinsic kinase activity of these proteins. Here, deletion of the FATC domain of ATM resulted in a small reduction in ATM protein levels and loss of the DNA damage-induced increase in ATM kinase activity. These observations demonstrate that the FATC domain of PIKK proteins is essential for the kinase activity of PIKK proteins. Further, the FATC domains of Trrap (26), ATM (20), and DNA-PKcs (this report) can function as sites to recruit HAT activity. Overall, this indicates two key functions for the FATC domain of PIKK proteins: to provide a binding domain for regulatory proteins such as Tip60 (ATM, Trrap, DNA-PKcs) or RPA (Atr) and to regulate the activity of the kinase domain. However, whether this association between Tip60 and the FATC domains of PIKK proteins is direct or is mediated by an intermediary protein is not known.
Structural analysis of DNA-PKcs has provided a low resolution three-dimensional structure for DNA-PKcs that has been used to predict the architecture of the ATM protein (19). In this model, the FAT and FATC domains are attached to either side of the kinase domain, with the FAT and FATC domains protruding from this central core region (19). Additional studies have shown that the FATC domain of Tor1 exists as a highly flexible
-helical structure (19, 41). Taken together, these structural studies have led to the proposal that changes in the conformation of the FAT and FATC domains can influence the catalytic activity of ATM (19, 41). These structural studies are consistent with reports that disruption of the FATC domain (either by mutation or truncation) greatly reduces the intrinsic kinase activity of DNA-PKcs (17, 18), Mec1 (23), Tor 1 (16), and ATM (this study). The FATC domain may therefore function as a highly flexible detector that regulates the kinase domain through conformational changes. The association of Tip60 with the FATC domain may mediate this conformational effect through acetylation within the FAT/kinase domain/FATC structure, resulting in conformational changes in the FATC domain that are then communicated to the kinase domain of ATM (or DNA-PKcs). Taken together, our results indicate that the FATC domain of PIKK proteins is an essential regulatory domain that can mediate the association of these proteins with Tip60 or other regulatory proteins. Further studies on the three-dimensional structure of FATC domain of these proteins will provide crucial insights into these functions.
| FOOTNOTES |
|---|
The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1 and S2. ![]()
1 Both authors contributed equally to this work. ![]()
2 To whom correspondence should be addressed:JF516, Dana-Farber Cancer Inst., 44 Binney St., Boston, MA 02115. Tel.: 617-632-4946; E-mail: brendan_price{at}dfci.harvard.edu.
3 The abbreviations used are: PIKK, phosphatidylinositol 3-kinase-related kinase; AT, ataxia telangiectasia; ATM, mutated in ataxia telangiectasia; HAT, histone acetyltransferase; DNA-PKcs, DNA-dependent protein kinase catalytic subunit; siRNA, small interfering RNA; HA, hemagglutinin. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. Kranz, C. Dohmesen, and M. Dobbelstein BRCA1 and Tip60 determine the cellular response to ultraviolet irradiation through distinct pathways J. Cell Biol., October 23, 2008; 182(1): 197 - 213. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Burrows and S. J. Elledge How ATR turns on: TopBP1 goes on ATRIP with ATR Genes & Dev., June 1, 2008; 22(11): 1416 - 1421. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Mordes, G. G. Glick, R. Zhao, and D. Cortez TopBP1 activates ATR through ATRIP and a PIKK regulatory domain Genes & Dev., June 1, 2008; 22(11): 1478 - 1489. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. B. Gomez, R. L. Nugent, S. Laria, and S. L. Forsburg Schizosaccharomyces pombe Histone Acetyltransferase Mst1 (KAT5) Is an Essential Protein Required for Damage Response and Chromosome Segregation Genetics, June 1, 2008; 179(2): 757 - 771. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, C. Szabo, C. Qian, P. G. Amadio, S. N. Thibodeau, J. R. Cerhan, G. M. Petersen, W. Liu, and F. J. Couch Mutational Analysis of Thirty-two Double-Strand DNA Break Repair Genes in Breast and Pancreatic Cancers Cancer Res., February 15, 2008; 68(4): 971 - 975. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sun, Y. Xu, K. Roy, and B. D. Price DNA Damage-Induced Acetylation of Lysine 3016 of ATM Activates ATM Kinase Activity Mol. Cell. Biol., December 15, 2007; 27(24): 8502 - 8509. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. Eliseeva, V. Valkov, M. Jung, and M. O. Jung Characterization of novel inhibitors of histone acetyltransferases Mol. Cancer Ther., September 1, 2007; 6(9): 2391 - 2398. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. D. Fernandes, Y. Sun, and B. D. Price Activation of the Kinase Activity of ATM by Retinoic Acid Is Required for CREB-dependent Differentiation of Neuroblastoma Cells J. Biol. Chem., June 1, 2007; 282(22): 16577 - 16584. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |