HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 281, Issue 24, 16757-16767, June 16, 2006

This Article Abstract Full Text (PDF) All Versions of this Article: 281/24/16757    most recent M601121200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Canals, M. Articles by Milligan, G. Search for Related Content PubMed PubMed Citation Articles by Canals, M. Articles by Milligan, G. Social Bookmarking                      What's this?

Up-regulation of the Angiotensin II Type 1 Receptor by the MAS Proto-oncogene Is Due to Constitutive Activation of G_q/G₁₁ by MAS^*

From the Molecular Pharmacology Group, Division of Biochemistry and Molecular Biology, Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow G12 8QQ, Scotland, United Kingdom

Received for publication, February 6, 2006 , and in revised form, April 10, 2006.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Coexpression of the MAS proto-oncogene with the angiotensin II type 1 (AT₁) receptor in CHO-K1 cells has been reported to increase the number of [³H]angiotensin II-binding sites, although MAS does not bind [³H]angiotensin II. In HEK293 cells stably expressing AT₁ receptor-cyan fluorescent protein (CFP), MAS-yellow fluorescent protein (YFP) expression from an inducible locus caused strong up-regulation of AT₁ receptor-CFP amounts and [³H]angiotensin II binding levels. The time course of AT₁ receptor-CFP up-regulation was also markedly slower than that of induction of MAS expression. These effects were not mimicked by induced expression of I138D MAS-YFP, a mutant unable to cause constitutive loading of [³⁵S]guanosine 5'-O-(thiotriphosphate) onto the phospholipase C-linked G protein G₁₁. Protein kinase C (PKC) inhibitors and the selective G_q/G₁₁ inhibitor YM-254890 fully blocked MAS-induced up-regulation of AT₁ receptor-CFP amounts, whereas the PKC activator phorbol 12-myristate 13-acetate produced strong up-regulation of AT₁ receptor-CFP without induction of MAS-YFP expression and in the presence of I138D MAS-YFP. The C-terminal tail of the AT₁ receptor is a known target for PKC-mediated phosphorylation. In cells stably expressing a C-terminally truncated version of the AT receptor, induction of MAS expression did not up-regulate the truncated construct levels. These data demonstrate that the ability of MAS to up-regulate AT₁ receptor levels reflects the constitutive capacity of MAS to activate G_q/G₁₁ and hence stimulate PKC-dependent phosphorylation of the AT₁ receptor.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The octapeptide hormone angiotensin (Ang)² II is one of the key components of the renin-angiotensin system and, as such, plays a major role in the regulation of blood pressure and cardiovascular homeostasis (1). Ang II exerts its effects through at least two subtypes of G protein-coupled receptors (GPCRs), the angiotensin II type 1 (AT₁) and 2 (AT₂) receptors. Whereas the functional role of the AT₂ receptor is not fully understood (2, 3), important biological functions such as vasoconstriction, salt/water reabsorption, and stimulation of aldosterone release are mediated through AT₁ receptor activation (4). However, in a number of situations, the AT₁ receptor is modulated by other coexpressed GPCRs. For example, interactions with the AT₂ receptor have been demonstrated in which the AT₂ receptor acts as a functional antagonist of the AT₁ receptor (5). AT₁ and bradykinin B₂ receptor interactions have also been shown, and these result in enhanced signaling of ligands at each receptor (6). Furthermore, in addition to interactions with GPCRs, agonist-induced functional interactions between the AT₁ receptor and the single transmembrane-spanning tyrosine kinase epidermal growth factor receptor have also been reported (7, 8).

The MAS proto-oncogene was first detected in vivo by its tumorigenic activity (9) and later identified as a member of the rhodopsin-like class A GPCR subfamily. However, although suggested in early studies to be a potential candidate as an Ang II receptor (10, 11), it remained an "orphan" until recently, when it was demonstrated that the Ang II metabolite Ang-(1–7) is an endogenous agonist of MAS (12). In the last decade, there has been emerging evidence that, although not able to bind or respond directly to Ang II, MAS has a physiological role in modulating the functions of Ang II in both the neuronal (13) and cardiovascular (14) systems. In MAS knock-out mice, AT₁ receptor signaling is altered in the amygdala (13); and, recently, Castro et al. (15) reported functional interactions between MAS and both the AT₁ and AT₂ receptors in mouse heart. In a previous study, we showed that MAS and the AT₁ receptor interact in heterologous expression systems and that MAS acts as an functional antagonist of the AT₁ receptor both in cotransfected CHO-K1 cells and in mesenteric microvessels of mice because greater levels of Ang II-mediated contraction were observed in vessels from MAS knock-out mice compared with wild-type controls (14). However, although Ang II produced lower levels of inositol phosphate accumulation and reduced increases in intracellular [Ca²⁺] in CHO-K1 cells coexpressing MAS and the AT₁ receptor compared with those expressing the AT₁ receptor alone, we also observed that MAS coexpression with the AT₁ receptor resulted in an increase in [³H]Ang II binding capacity (14). The mechanism by which MAS increases [³H]Ang II binding has remained elusive. In this study, we demonstrate that it is due to the constitutive capacity of MAS to stimulate the G proteins G_q/G₁₁ and hence the activity of protein kinase C (PKC) and that this effect is cell type-independent.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Materials—All materials for tissue culture were from Invitrogen (Paisley, UK). The PKC inhibitor Ro 31-8220, phorbol 12-myristate 13-acetate (PMA), doxycycline, and Ang II were from Sigma. GF 109203X was from Tocris (Avonmouth, UK), and YM-254890 was the kind gift of Astrellas Pharma Inc. (Osaka, Japan).

Site-directed Mutagenesis—To introduce amino acid substitutions into the primary structure of the human MAS receptor, site-directed mutagenesis of the encoding nucleotide sequence was performed using the QuikChange® II site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. The following primers were designed for the production of the I138D mutation (with the bases underlined): GTCCTTTACCCCGACTGGTACCGATGC (forward) and GCATCGGTACCAGTCGGGGTAAAGGAC (reverse).

Flp-In Constructs—To create MAS receptor constructs N-terminally tagged with the vesicular stomatitis virus G (VSV-G) epitope sequence and fused at the C terminus with yellow fluorescent protein (YFP), the human MAS receptor and I138D MAS were used as PCR templates. An oligonucleotide encoding a BamHI restriction site, the VSV-G epitope sequence, and the first 21 bases of the MAS receptor sequence was used as the forward primer (CGGGATCCATGTACACCGACATCGAAATGACCCGCCTTGGTAAGGATGGGTCAAACGTGACATCA), and an oligonucleotide containing the last 21 bases of the MAS sequence without its stop codon and a NotI restriction site was employed as the reverse primer (TTTTCCTTTTGCGGCCGCTGACGACAGTCTCAACTGTGACCGT). The PCR product was then inserted into vector pcDNA5/FRT/TO (Invitrogen) already containing YFP and previously digested with BamHI and NotI.

c-Myc-AT₁ receptor (AT₁R)-cyan fluorescent protein (CFP) was obtained using the same strategy as described above with the human AT₁ receptor as a template; a forward primer encoding a HindIII restriction site, the c-Myc epitope sequence, and the first 21 bases of the receptor sequence (CCCAAGCTTATGGAACAAAAACTTATTTCTGAAGAAGATCTGATTCTCAACTCTTCTACTGAAGATTGG); and a reverse primer containing the last 21 bases of the AT₁ receptor without its stop codon and a KpnI restriction site (CGGGGTACCCTCAACCTCAAAACATGGTGC). The PCR product was then inserted in pcDNA3.1 already containing CFP and previously digested with HindIII and KpnI. c-Myc-AT₁R-YFP in pcDNA5/FRT/TO was subcloned by digesting c-Myc-AT₁R-CFP with HindIII and KpnI and inserting it into pcDNA5/FRT/TO already containing YFP and previously digested with the same restriction enzymes. The truncated form of the AT₁ receptor, c-Myc-³²⁵AT₁R-CFP, was obtained using the same strategy as described above with the human AT₁ receptor as a template. The same primer encoding a HindIII restriction site, the c-Myc epitope sequence, and the first 21 bases of the receptor sequence was used as the forward primer, and the reverse primer contained the last 21 bases up to amino acid 325 of the AT₁ receptor without its stop codon and a KpnI restriction site (CGGGGTACCTTTTGGGGGAATATATTT). The PCR product was then inserted in pcDNA3.1 already containing CFP and previously digested with HindIII and KpnI.

Cell Culture and Transfection—HEK293 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 0.292 g/liter L-glutamine and 10% (v/v) newborn calf serum at 37 °C in a 5% CO₂ humidified atmosphere. Cells were grown to 60–80% confluence before transient transfection. Transfection was performed using Effectene® transfection reagent (Qiagen Inc., West Sussex, UK) according to the manufacturer's instructions.

CHO-K1 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 2 mmol/liter L-glutamine. Cells at 50–80% confluence were transfected transiently with the indicated cDNAs using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions.

Generation of Stable Flp-In^TM T-REx^TM HEK293 Cells—To generate Flp-In T-REx HEK293 cells able to inducibly express the receptors of interest, the cells were transfected with a mixture containing the desired receptor cDNA in the pcDNA5/FRT/TO vector and pOG44 vectors (1:9) using Effectene according to the manufacturer's instructions. Cell maintenance and selection were as described (16). Resistant clones were screened for receptor expression by both fluorescence and Western blotting. To induce expression of receptors cloned into the Flp-In locus, cells were treated with 0.1 µg/ml doxycycline for varying periods of time. PKC activation and inhibition, as well as G_q/G₁₁ inhibition treatments, were performed 6 h after inducing the receptors for an overnight period.

Live Cell Epifluorescence Microscopy—Cells expressing the appropriate receptors tagged with CFP or YFP were grown on poly-D-lysine-treated coverslips. The coverslips were placed into a microscope chamber containing physiological saline solution (130 mM NaCl, 5 mM KCl, 1 mM CaCl₂, 1 mM MgCl₂, 20 mM HEPES, and 10 mM D-glucose, pH 7.4). Fluorescent images of the cells were acquired using a Nikon TE2000-E inverted microscope (Nikon Instruments, Melville, NY) equipped with a x40 (numerical aperture = 1.3) oil immersion Plan Fluor lens and a cooled digital CoolSNAP_HQ charge-coupled device camera (Photometrics, Tucson, AZ) (see Ref. 17 for details).

Visualization of the Plasma Membrane—To fluorescently visualize the plasma membrane in live HEK293 cells expressing CFP- or YFP-fused receptors, cells were treated (as specified by the manufacturer) with the reagents in the Image-iT plasma membrane and nuclear labeling kit (Invitrogen), in which the plasma membrane is specifically labeled with wheat germ agglutinin-Alexa Fluor 594, and nuclei are stained simultaneously with Hoechst 33342. CFP and YFP were excited as described above, and Alexa Fluor 594 was excited at 575/12 nm and imaged using the following filter set: dichroic, Q595LP; and emitter, HQ645/75m. Using these filters, no bleed-through was observed, and the resultant sequential 12-bit images were overlaid using MetaMorph software (Version 6.3.5, Universal Imaging Corp., Downingtown, PA). For three-dimensional imaging, stacks of images (2 x 2 binning, 150–200-ms exposure/image) with a 0.339-µm Z step (20–25 frames/stack) were sequentially acquired for each fluorescent dye.

[³⁵S]GTPS Binding—[³⁵S]GTPS binding experiments were initiated by the addition of membranes to assay buffer (20 mM HEPES, pH 7.4, 3 mM MgCl₂, 100 mM NaCl, 1 µM GDP, 0.2 mM ascorbic acid, and 100 nCi of [³²S]GTPS) containing the indicated concentrations of receptor ligands. Nonspecific binding was determined under the same conditions but in the presence of 100 µM GTPS. Reactions were incubated for 30 min at 30 °C and terminated by the addition of 0.5 ml of ice-cold buffer containing 20 mM HEPES, pH 7.4, 3 mM MgCl₂, 100 mM NaCl, and 0.2 mM ascorbic acid. The samples were centrifuged at 16,000 x g for 10 min at 4 °C, and the resulting pellets were resuspended in solubilization buffer (100 mM Tris, 200 mM NaCl, 1 mM EDTA, and 1.25% Nonidet P-40) plus 0.2% SDS. Samples were precleared with Pansorbin (Calbiochem, Nottingham, UK), followed by immunoprecipitation with antiserum CQ (18). Finally, the immunocomplexes were washed twice with solubilization buffer, and bound [³⁵S]GTPS was measured by liquid scintillation spectrometry.

Cell-surface Receptor Measurement and Enzyme-linked Immunosorbent Assay—Cells were grown in 96-well poly-D-lysine-coated plates and induced with different concentrations of doxycycline for 24 h. Afterward, cell-surface receptors were labeled with anti-VSV-G antibody (1:1000) in growth medium for 30 min at 30 °C. The cells were then washed once with 20 mM HEPES and Dulbecco's modified Eagle's medium and then incubated for another 30 min at 37 °C in growth medium supplemented with horseradish peroxidase-conjugated anti-rabbit IgG as the secondary antibody and 1 µM Hoechst nuclear stain (Sigma) to determine the number of cells in each well. The cells were washed twice with phosphate-buffered saline, and the Hoechst fluorescence was measured. Finally, the cells were incubated with SureBlue (KPL, Inc., Gaithersburg, MD) for 5 min in the dark at room temperature, and the absorbance was read at 620 nm using a VICTOR² plate reader (PerkinElmer Life Sciences).

Endoglycosidase Treatment—Endoglycosidase treatment was carried out overnight at 32 °C using peptide N-glycosidase F (Roche Diagnostics, Mannheim, Germany) at a final concentration of 1 unit/µl.

Cell Lysates and Western Blotting—Cell lysates were obtained by harvesting the cells with ice-cold radioimmune precipitation assay buffer (50 mM HEPES, 150 mM NaCl, 1% Triton X-100, and 0.5% sodium deoxycholate supplemented with 10 mM NaF, 5 mM EDTA, 10 mM NaH₂PO₄, 5% ethylene glycol, and Complete protease inhibitor mixture (Roche Diagnostics), pH 7.4). Cell extracts were then centrifuged for 30 min at 14,000 x g, and the supernatant was recovered.

After samples were heated at 65 °C for 15 min, cell lysates were subjected to SDS-PAGE analysis using 4–12% BisTris gels (NuPAGE, Invitrogen) and MOPS buffer. After electrophoresis, proteins were transferred onto nitrocellulose membranes that were incubated in a solution of 5% nonfat milk and 0.1% Tween 20 in Tris-buffered saline at room temperature on a rotating shaker for 2 h to block nonspecific binding sites. The membrane was incubated overnight with anti-c-Myc polyclonal antibody (Cell Signaling, Hertfordshire, UK) or anti-VSV-G antiserum and detected using horseradish peroxidase-linked anti-rabbit IgG secondary antiserum (Amersham Biosciences, Buckinghamshire, UK). Immunoblots were developed by application of enhanced chemiluminescence solution (Pierce).

Cell-surface Biotinylation Experiments—For cell-surface biotinylation, cells were grown in 6-well plates coated with poly-D-lysine and induced as described. Confluent cells were washed with ice-cold borate buffer (10 mM boric acid, 154 mM NaCl, 7.2 mM KCl, and 1.8 CaCl₂, pH 9.0) and incubated on ice with 1 ml of 0.8 mM EZ-Link sulfosuccinimidyl 2-(biotinamido)ethyl-1,3-dithiopropionate (Pierce) in borate buffer for 15 min. The cells were then rinsed with a solution of 0.192 M glycine and 25 mM Tris, pH 8.3, to quench the excess biotin and lysed with radioimmune precipitation assay buffer. Lysates were centrifuged for 30 min at 14,000 x g, and the supernatant was recovered. An aliquot of the lysates was saved for Western blotting. Cell-surface biotinylated proteins were isolated using 100 µl of ImmunoPure immobilized streptavidin (Pierce). After 1 h of incubation at 4 °C with constant rotation, samples were spun, and the streptavidin beads were washed three times with radioimmune precipitation assay buffer. Finally, the biotinylated proteins were eluted with 100 µl of SDS sample buffer for 1 h at 37 °C, and SDS-PAGE and Western blotting were performed as described above.

Intact Cell Radioligand Binding Assays—Flp-In T-REx HEK293 cells expressing the wild-type or I138D MAS receptor with the constitutively expressed AT₁ receptor were subcultured in 6-well plates coated with poly-D-lysine and grown to confluence. Each well was washed twice with prewarmed Krebs-Ringer buffer (145 mM NaCl, 20 mM HEPES, 1.3 mM MgCl₂, 1.2 mM NaPO₄, 5 mM KCl, 1.3 mM CaCl₂, and 10 mM glucose, pH 7.4). Then, the Krebs-Ringer buffer was replaced with 0.8 ml of prewarmed [³H]Ang II (Amersham Biosciences) in Krebs-Ringer buffer supplemented with 0.25% (w/v) bovine serum albumin. Nonspecific binding was determined in the presence of 10 µM unlabeled Ang II. After 30 min at 37 °C (5% CO₂ and 95% air), each well was washed twice with ice-cold Krebs-Ringer buffer, and the cells were solubilized by the addition of 1 ml of 0.1 M NaOH and 2% (w/v) SDS and incubated overnight at room temperature (20–25 °C). 1 ml of 0.1 M HCl was added to each well to neutralize the NaOH. The samples were mixed, and 1.6 ml was mixed with scintillation mixture and counted (Packard 2000 CA scintillation counter) to measure bound [³H]Ang II. The remaining cell lysates from each well were pooled and used for protein determination. A radioligand concentration of 10 nM [³H]Ang II was used for single point studies.

View larger version (67K): [in this window] [in a new window]   FIGURE 1. Induced expression of MAS results in up-regulation of a coexpressed AT1 receptor. Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP at the Flp-In locus (A1 and B1) and constitutively expressing c-Myc-AT1R-CFP (A2 and B2) were left untreated (A1 and A2) or were treated with doxycycline (0.1 µg/ml) for 24 h (B1 and B2) to induce VSV-G-MAS-YFP expression. Fluorescence corresponding to YFP (A1 and B1) and CFP (A2 and B2) was then imaged.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Generation of Flp-In T-REx HEK293 Cell Lines—A Flp-In T-REx HEK293 clonal cell line was established in which a form of the human AT₁ receptor C-terminally tagged with CFP and N-terminally tagged with the c-Myc epitope sequence (c-Myc-AT₁R-CFP) was expressed stably and constitutively. These cells also harbored, at the Flp-In locus, a form of human MAS C-terminally tagged with YFP and N-terminally tagged with the VSV-G epitope sequence (VSV-G-MAS-YFP). The Flp-In locus ensures a single defined site of chromosomal integration; and in the T-REx form of these cells, expression from this locus is controlled in a Tet-on-inducible fashion by the addition of either tetracycline or the related antibiotic doxycycline (16). In the absence of doxycycline, cell imaging demonstrated expression of c-Myc-AT₁R-CFP predominantly in punctate intracellular vesicles, likely to represent recycling endosomes, and a lack of expression of VSV-G-MAS-YFP (Fig. 1A). The addition of doxycycline (0.1 µg/ml, 24 h) resulted in induction of VSV-G-MAS-YFP expression. This receptor construct had an unusual, widespread, cellular distribution, with at least some of the YFP signal overlapping with the nucleus (Fig. 1B). With expression of VSV-G-MAS-YFP, the fluorescent signal corresponding to c-Myc-AT₁R-CFP was markedly increased (Fig. 1B), with much of the signal apparently inside the cell.

View larger version (17K): [in this window] [in a new window]   FIGURE 2. MAS, but not I138D MAS, causes constitutive activation of G11. HEK293 cells were transfected transiently to express G11, MAS and G11, or I138D MAS and G11, and membranes were prepared. Following incubation with [35S]GTPS, samples were immunoprecipitated with anti-Gq/G11 antiserum (18) and counted. Data represent the means ± S.E. (n = 3).

View larger version (69K): [in this window] [in a new window]   FIGURE 3. I138D MAS, but not MAS, is located predominantly at the cell surface. A and B, Flp-In T-REx HEK293 cells harboring VSV-G-I138D MAS-YFP at the Flp-In locus (left panels) and constitutively expressing c-Myc-AT1R-CFP (right panels) were left untreated (A) or were treated with doxycycline (0. 1 µg/ml) for 24 h (B) to induce VSV-G-I138D MAS-YFP expression. Fluorescence corresponding to YFP (left panels) and CFP (right panels) was then imaged. C, intact cell anti-VSV-G enzyme-linked immunosorbent assays were performed on Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP (open bars) or VSV-G-I138D MAS-YFP (closed bars) after treatment of the cells for 24 h with various concentrations of doxycycline (Dox). Abs, absorbance. D, cells as in C, harboring VSV-G-MAS-YFP (panels i and ii) or VSV-G-I138D MAS-YFP (panels iii and iv), were left untreated (panels i and iii) or were treated with doxycycline (0.1 µg/ml) for 24 h (panels ii and iv) and stained with Image-iT membrane dye (red).

I138D MAS Is Delivered to the Cell Surface but Does Not Up-regulate the AT₁ Receptor—Based on the ability of the I138D mutation to eliminate constitutive MAS-induced loading of [³⁵S]GTPS onto G₁₁, we generated additional Flp-In T-REx HEK293 cell lines that constitutively expressed c-Myc-AT₁R-CFP but also harbored VSV-G-I138D MAS-YFP at the Flp-in locus (Fig. 3A). Induction of VSV-G-I138D MAS-YFP expression by treatment with doxycycline resulted in a completely different distribution pattern compared with VSV-G-MAS-YFP. The I138D MAS construct appeared to be located largely at the plasma membrane (Fig. 3B). Expression of VSV-G-I138D MAS-YFP neither up-regulated c-Myc-AT₁R-CFP nor markedly altered its cellular distribution (Fig. 3B). To confirm substantially more effective plasma membrane localization of VSV-G-I138D MAS-YFP, we performed a series of intact cell anti-VSV-G enzyme-linked immunosorbent assays. Although induction of VSV-G-MAS-YFP expression with increasing concentrations of doxycycline resulted in little increase in anti-VSV-G cell-surface immunoreactivity (Fig. 3C), a clear, doxycycline concentration-dependent increase in signal was obtained when VSV-G-I138D MAS-YFP expression was induced (Fig. 3C). Furthermore, staining and image overlay of cells induced to express either VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP with Image-iT membrane dye confirmed effective plasma membrane delivery of VSV-G-I138D MAS-YFP, but not VSV-G-MAS-YFP (Fig. 3D). Cell-surface biotinylation studies also confirmed cell-surface delivery of VSV-G-I138D MAS-YFP, but not VSV-G-MAS-YFP (Fig. 4A).

View larger version (27K): [in this window] [in a new window]   FIGURE 4. AT1 receptor glycosylation, biotinylation, and up-regulation studies. A, shown is the cell-surface biotinylation of Flp-InT-RExHEK293 cells harboring VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP at the Flp-In locus. Cells were left untreated or were treated with doxycycline (Dox; 0.1 µg/ml) for 24 h to induce expression of the forms of MAS-YFP, and cell-surface receptors were biotinylated and pulled down with streptavidin-agarose beads. Total lysates (l) and precipitated samples (b) were then resolved by SDS-PAGE and immunoblotted with anti-VSV-G antibody. B, membranes of cells induced to coexpress VSV-G-MAS-YFP and c-Myc-AT1R-CFP were treated with or without peptide N-glycosidase F (NGaseF), resolved by SDS-PAGE, and immunoblotted with anti-c-Myc antibody to identify forms of c-Myc-AT1R-CFP. C, shown is the cell-surface biotinylation of HEK293 cells expressing c-Myc-AT1R. Samples were resolved by SDS-PAGE and immunoblotted with anti-c-Myc antibody. ub, unbound; l, total lysates; b, cell-surface receptor. D, Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP at the Flp-In locus and constitutively expressing c-Myc-AT1R-CFP were left untreated or were treated with doxycycline (0.1µg/ml) for 24 h to induce expression of the forms of MAS-YFP. Lysates of these cells as well as from cells expressing only VSV-G-MAS-YFP in an inducible fashion were then resolved by SDS-PAGE and immunoblotted with anti-c-Myc antibody. E, shown are the results from Western blot densitometry of cell lysates of Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP at the Flp-In locus and constitutively expressing c-Myc-AT1R-CFP. A constant dose of 0.1 µg/ml doxycycline was used for different periods of induction. F, Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP (upper panel) or VSV-G-I138D MAS-YFP (lower panel) at the Flp-In locus and constitutively expressing c-Myc-AT1R-CFP were treated () or not () with doxycycline and used to perform intact cell binding of [3H]Ang II. prot, protein.

View larger version (35K): [in this window] [in a new window]   FIGURE 5. PKC inhibitors block and PKC activators mimic the effects of MAS on AT1 receptor up-regulation. A, Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP (open bars) or VSV-G-I138D MAS-YFP (closed bars) at the Flp-In locus and constitutively expressing c-Myc-AT1R-CFP were left untreated (– Dox) or were treated with doxycycline (0.1 µg/ml) for 24 h (+ Dox) to induce expression of the forms of MAS-YFP. Some of the cells were also treated with the PKC inhibitor Ro 31-8220 (1 µM). These cells were then used to measure the specific binding of [3H]Ang II (10 nM). prot, protein. B, cells as in A, induced or not to express VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP in the presence of constitutive expression of c-Myc-AT1R-CFP, were treated or not with 1 µM Ro 31-8220. Cell lysates were resolved by SDS-PAGE and immunoblotted with anti-c-Myc antibody (upper panel) or with an antiserum that identifies the total population of the MAPKs ERK1 and ERK2 (lower panel). C, Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP and constitutively expressing c-Myc-AT1R-CFP were left untreated or were treated with doxycycline (0.1µg/ml) for 24 h and with combinations of the PKC inhibitors Ro 31-8220 (1µM) and GF 109203X (100 nM) and the PKC activator PMA (100 nM). Cell lysates were resolved by SDS-PAGE and immunoblotted with anti-c-Myc antibody (upper panel) or with an antiserum that identifies the total population of the MAPKs ERK1 and ERK2 (lower panel). D, fluorescence corresponding to c-Myc-AT1R-CFP was measured in uninduced cells (open bars) and in doxycycline-treated cells induced to express VSV-G-MAS-YFP (closed bars) that were treated with Ro 31-8220 (1 µM), PMA (100 nM), or PMA and Ro 31-8220. A.F.U., arbitrary fluorescence units.

MAS Expression Precedes AT₁ Receptor Up-regulation—If the presence of active MAS were required to cause up-regulation of the AT₁ receptor construct, we reasoned that the time course of AT₁ receptor up-regulation would be slower than that of induction of MAS expression. This was confirmed via a series of Western blot studies (Fig. 4E), in which the presence of VSV-G-MAS-YFP could be detected with in 6 h of doxycycline addition, whereas significant up-regulation of c-Myc-AT₁R-CFP required 10–18 h. To confirm the previous observations, cells constitutively expressing c-Myc-AT₁R-CFP were induced or not to express VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP, and the specific binding of increasing concentrations of [³H]Ang II was measured (Fig. 4F). As anticipated from the foregoing, the B_max of [³H]Ang II binding was increased (0.2 ± 0.03 to 0.6 ± 0.06 pmol/mg of protein) by coexpression of VSV-G-MAS-YFP, but not VSV-G-I138D MAS-YFP (0.2 ± 0.02 versus 0.2 ± 0.06 pmol/mg of protein; means ± S.E., n = 3), whereas the affinity of [³H]Ang II (K_d = 0.9–1.7 nM in individual experiments) was unaltered.

View larger version (72K): [in this window] [in a new window]   FIGURE 6. PMA treatment up-regulates AT1 receptor levels in cells expressing I138D MAS. Flp-In T-REx HEK293 cells harboring VSV-G-I138D MAS-YFP and constitutively expressing c-Myc-AT1R-CFP were uninduced (left panels) or treated with doxycycline (+ Dox) as indicated. Such cells were also treated with PMA alone or with Ro 31-8220 as described in the legend to Fig. 5D. Cells were then imaged. CFP fluorescence is quantitated in the graph. A.F.U., arbitrary fluorescence units. Open bar, –doxycycline; filled bars, +doxycycline.

A Novel G_q/G₁₁ Inhibitor Prevents MAS-induced Up-regulation of the AT₁ Receptor—G_q and G₁₁ are upstream of PKC and, as shown in Fig. 2, are constitutively activated by MAS, but not I138D MAS. Recently, YM-254890 has been described as a selective G_q/G₁₁ inhibitor (21). We initially tested the ability of YM-254890 to inhibit receptor activation of G_q/G₁₁ by its capacity to prevent phenylephrine-mediated [³⁵S]GTPS binding to _1b-adrenoreceptor-G_q and _1b-adrenoreceptor-G₁₁ fusion proteins (19, 22). In membranes of HEK293 cells expressing these fusion proteins, YM-254890 inhibited agonist-mediated loading of [³⁵S]GTPS with EC₅₀ = 4nM. This inhibition was highly selective. 100 nM YM-254890 had no ability to inhibit agonist-mediated activation of G_s via a corticotropin-releasing factor-1 receptor-G_s fusion protein, G_i3 via a GPR41-G_i3 fusion protein, or G_o1 via an _2A-adrenoreceptor-G_o1 fusion protein (Fig. 7). At 100 nM, YM-254890 also blocked the up-regulation of c-Myc-AT₁R-CFP produced following induction of VSV-G-MAS-YFP expression (Fig. 8). Because PKC is downstream of G_q/G₁₁, we predicted that YM-254890 would not be able to block PMA-mediated c-Myc-AT₁R-CFP up-regulation, and this was confirmed (Fig. 8).

View larger version (20K): [in this window] [in a new window]   FIGURE 7. YM-254890 is a potent and highly selective inhibitor of Gq and G11 activation. A, HEK293 cells were transfected to transiently express either the 1b-adrenoreceptor-Gq () or 1b-adrenoreceptor-G11 () fusion protein. The stimulation of [35S]GTPS binding in Gq/G11 immunoprecipitates produced by 100 µM phenylephrine and the effect on this of varying concentrations of YM-254890 are displayed (means ± S.E., n = 3). B, HEK293 cells were transfected to express the 1b-adrenoreceptor-G11, corticotropin-releasing factor-1 receptor (CRF)-Gs, GPR41-Gi3, or 2A-adrenoreceptor-Go1 fusion protein as indicated. The stimulation of [35S]GTPS binding by maximally effective concentrations of cognate receptor agonists and the effect of 100 nM YM-254890 on this were assessed following immunoprecipitation with an anti-G protein subunit antiserum specific for each construct.

View larger version (75K): [in this window] [in a new window]   FIGURE 8. YM-254890 blocks MAS-induced but not PMA-mediated up-regulation of AT1 receptor levels. Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP at the Flp-In locus were left untreated (– Dox) or were treated with doxycycline (0.1 µg/ml) for 24 h (+ Dox) to induce VSV-G-MAS-YFP. Cells were also treated with combinations of PMA and YM-254890 (both at 100 nM). Cell lysates were resolved by SDS-PAGE and immunoblotted with anti-c-Myc antibody (upper panel) or anti-ERK1/ERK2 antibody (lower panel).

To confirm that the PKC-based mechanism of MAS-induced up-regulation of the AT₁ receptor is not produced only in HEK293 cells, CHO-K1 cells were transiently transfected to express c-Myc-AT₁R-CFP with or without coexpression of VSV-G-MAS-YFP. These cells were subsequently treated with combinations of PMA to activate PKC and Ro 31-8220 to inhibit this activity. As in the Flp-In T-REx HEK293 cell lines, treatment with PMA in the absence of MAS resulted in strong up-regulation of c-Myc-AT₁R-CFP levels detected in anti-c-Myc immunoblots, and this was blocked by co-administration of Ro 31-8220 (Fig. 11). MAS-induced up-regulation of c-Myc-AT₁R-CFP immunoreactivity was largely blocked by treatment with Ro 31-8220 (Fig. 11). As an additional control for the effects of MAS in the Flp-In T-REx HEK293 system, which requires the addition of doxycycline to cause expression of MAS, we transiently transfected HEK293 cells with c-Myc-AT₁R-CFP and confirmed that the addition of doxycycline did not result in c-Myc-AT₁R-CFP up-regulation, whereas treatment with PMA produced strong up-regulation (Fig. 11).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The AT₁ receptor and the MAS proto-oncogene are often coexpressed in, for example, vascular smooth muscle cells. After the cloning of MAS cDNA (9), some early experiments suggested that it might be a receptor for angiotensin peptides (10), but it is now well appreciated that MAS does not bind Ang II. However, Ang-(1–7), the product of ACE2 activity (26), has recently been described as an endogenous agonist of MAS (12). Furthermore, because Ang-(1–7) counters many of the regulatory actions of Ang II, there has been considerable interest in the interplay between MAS and the AT₁ receptor. Following expression of the AT₁ receptor in CHO-K1 cells, Ang II produces a strong, concentration-dependent increase in intracellular [Ca²⁺] (14). However, with coexpression of MAS, the effect of a maximally effective concentration of Ang II is substantially reduced, an effect also observed when inositol phosphate accumulation is measured (14). Despite these effects on Ang II-generated signals, coexpression with MAS actually results in higher levels of [³H]Ang II binding (14). The interplay between MAS and the AT₁ receptor is further underlined when measuring Ang II-mediated contraction of mouse mesenteric microvessels. Ang II produces greater contraction in vessels from MAS knock-out animals than in vessels from wild-type controls (14). It was concluded that MAS forms a complex with the AT₁ receptor that is inhibitory to AT₁ receptor function, as had been described previously for AT₂/AT₁ receptor interactions (5).

View larger version (23K): [in this window] [in a new window]   FIGURE 9. Induction of MAS, but not I138D MAS, stimulates constitutive activation of Gq/G11 in membranes of Flp-In T-REx HEK293 cells. Flp-In T-REx HEK293 cells constitutively expressing c-Myc-AT1R-CFP and harboring either VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP at the Flp-In locus were left untreated (– Dox) or were treated with doxycycline (0.1 µg/ml) for 24 h (+ Dox). Membranes from these were used in [35S]GTPS binding assays with end of assay Gq/G11 immunoprecipitation. Assays received no ligand (Basal) or were treated with Ang II (1 µM), losartan (Los; 10 µM), YM-254890 (100 nM), or Ang II (1 µM) and YM-254890 (100 nM).

The MAS-induced up-regulation of the AT₁ receptor monitored in cell imaging studies showed substantial accumulation in an intracellular compartment that may be the Golgi. It is well established that effective core glycosylation is an important quality control check prior to cell-surface delivery of many GPCRs (28, 29) and that a substantial amount of expressed protein fails this control and is routed to the proteasome for destruction. Immunoblot studies showed strong up-regulation of the AT₁ receptor by both MAS and activation of protein kinase C and also demonstrated a mixture of highly and less well glycosylated forms. Cell-surface biotinylation studies indicated that only the fully glycosylated form was delivered to the cell surface. Thus, because the imaging studies cannot discriminate between these forms, the combination of cell imaging, immunoblot, ligand binding, and cell-surface biotinylation studies offers the best means to understand the molecular diversity of the forms and cellular distribution of the AT₁ receptor construct. Because PKC lies downstream of G_q/G₁₁, we reasoned that PKC inhibitors should also block MAS-induced up-regulation of AT₁R-CFP and that PKC activators should do so without induction of constitutively active MAS. Both these expectations were fully met. Many analyses have shown roles for agonist- and PKC-mediated phosphorylation of the C-terminal tail of the AT₁ receptor (23–25). Although key previous studies have been performed with the rat receptor, the C-terminal tail of the AT₁ receptor is well conserved between human and rat with three clear potential sites for PKC-mediated phosphorylation. Truncation to amino acid 325 removes these three sites. As such, it was satisfying that MAS-YFP was unable to cause significant up-regulation of c-Myc-³²⁵AT₁R-CFP.

View larger version (48K): [in this window] [in a new window]   FIGURE 10. Induction of MAS does not cause up-regulation of the AT1 receptor lacking C-terminal PKC phosphorylation sites. Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP at the Flp-In locus (A1 and B1) and constitutively expressing c-Myc-325AT1R-CFP (A2 and B2) were left untreated (A1 and A2) or were treated with doxycycline (Dox; 0.1 µg/ml) for 24 h (B1 and B2) to induce VSV-G-MAS-YFP expression. The fluorescence corresponding to YFP (A1 and B1) and CFP (A2 and B2) was then imaged in living cells. Cell lysates of Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP at the Flp-In locus and either c-Myc-AT1R-CFP or c-Myc-325AT1R-CFP were treated as described above, resolved by SDS-PAGE, and immunoblotted with anti-c-Myc antibody (C).

View larger version (44K): [in this window] [in a new window]   FIGURE 11. Both MAS and PMA produce up-regulation of c-Myc-AT1R-CFP in transiently transfected CHO-K1 and HEK293 cells. CHO-K1 (left panel) or HEK293 (right panel) cells were transiently transfected with c-Myc-AT1R-CFP with (+) or without (–) VSV-G-MAS-YFP. 24 h after transfection, cells were treated for 16 h with combinations of PMA and Ro 31-8220 (both at 100 nM) or with 0.1µg/ml doxycycline (Dox). Cell lysates were then resolved by SDS-PAGE and immunoblotted with anti-c-Myc antibody.

	FOOTNOTES

 
^* This work was supported by the Medical Research Council. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom correspondence should be addressed: Div. of Biochemistry and Molecular Biology, University of Glasgow, Davidson Bldg., University Ave., Glasgow G12 8QQ, Scotland, UK. Tel.: 44-141-330-5557; Fax: 44-141-330-4620; E-mail: g.milligan{at}bio.gla.ac.uk.

² The abbreviations used are: Ang, angiotensin; GPCRs, G protein-coupled receptors; AT₁ and AT₂, angiotensin II types 1 and 2, respectively; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; VSV-G, vesicular stomatitis virus G; YFP, yellow fluorescent protein; AT₁R, angiotensin II type 1 receptor; CFP, cyan fluorescent protein; GTPS, guanosine 5'-O-(thiotriphosphate); BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; MOPS, 4-morpholinepropanesulfonic acid; ERK, extracellular signal-regulated kinase; MAPK, mitogen-activated protein kinase.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Fleming, I., Kohlstedt, K., and Busse, R. (2006) Curr. Opin. Nephrol. Hypertens. 15, 8–13[Medline] [Order article via Infotrieve]
2. Carey, R. M. (2005) Curr. Opin. Nephrol. Hypertens. 14, 67–71[Medline] [Order article via Infotrieve]
3. Reudelhuber, T. L. (2005) Hypertension 46, 1261–1262[Free Full Text]
4. Ruilope, L. M., Rosei, E. A., Bakris, G. L., Mancia, G., Poulter, N. R., Taddei, S., Unger, T., Volpe, M., Waeber, B., and Zannad, F. (2005) Blood Press. 14, 196–209[CrossRef][Medline] [Order article via Infotrieve]
5. AbdAlla, S., Lother, H., Abdel-tawab, A. M., and Quitterer, U. (2001) J. Biol. Chem. 276, 39721–39726[Abstract/Free Full Text]
6. AbdAlla, S., Lother, H., and Quitterer, U. (2000) Nature 407, 94–98[CrossRef][Medline] [Order article via Infotrieve]
7. Smith, N. J., Chan, H. W., Osborne, J. E., Thomas, W. G., and Hannan, R. D. (2004) CMLS Cell. Mol. Life Sci. 61, 2695–2703
8. Olivares-Reyes, J. A., Shah, B. H., Hernandez-Aranda, J., Garcia-Caballero, A., Farshori, M. P., Garcia-Sainz, J. A., and Catt, K. J. (2005) Mol. Pharmacol. 68, 356–364[Abstract/Free Full Text]
9. Young, D., Waitches, G., Birchmeier, C., Fasano, O., and Wigler, M. (1986) Cell 45, 711–719[CrossRef][Medline] [Order article via Infotrieve]
10. Jackson, T. R., Blair, L. A., Marshall, J., Goedert, M., and Hanley, M. R. (1998) Nature 335, 437–440
11. Jackson, T. R., and Hanley, M. R. (1989) FEBS Lett. 251, 27–30[CrossRef][Medline] [Order article via Infotrieve]
12. Santos, R. A., Simoes e Silva, A. C., Maric, C., Silva, D. M., Machado, R. P., de Buhr, I., Heringer-Walther, S., Pinheiro, S. V., Lopes, M. T., Bader, M., Mendes, E. P., Lemos, V. S., Campagnole-Santos, M. J., Schultheiss, H. P., Speth, R., and Walther, T. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 8258–8263[Abstract/Free Full Text]
13. Von Bohlen Und Halbach, O., Walther, T., Bader, M., and Albrecht, D. (2000) J. Neurophysiol. 83, 2012–2020[Abstract/Free Full Text]
14. Kostenis, E., Milligan, G., Christopoulos, A., Sanchez-Ferrer, C. F., Heringer-Walther, S., Sexton, P., Gembardt, F., Kellett, E., Martini, L., Vanderheyden, P., Schultheiss, H. P., and Walther, T. (2005) Circulation 111, 1806–1813[Abstract/Free Full Text]
15. Castro, C. H., Santos, R. A., Ferreira, A. J., Bader, M., Alenina, N., and Almeida, A. P. (2005) Hypertension 46, 937–942[CrossRef][Medline] [Order article via Infotrieve]
16. Milasta, S., Pediani, J., Appelebe, S., Trim, S., Wyatt, M., Cox, P., Fidock, M., and Milligan, G. (2006) Mol. Pharmacol. 69, 479–491[Abstract/Free Full Text]
17. Carrillo, J. J., López-Gimenez, J. F., and Milligan, G. (2004) Mol. Pharmacol. 66, 1123–1137[Abstract/Free Full Text]
18. Mitchell, F. M., Mullaney, I., Godfrey, P. P., Arkinstall, S. J., Wakelam, M. J. O., and Milligan, G. (1991) FEBS Lett. 287, 171–174[CrossRef][Medline] [Order article via Infotrieve]
19. Carrillo, J. J., Pediani, J., and Milligan, G. (2003) J. Biol. Chem. 278, 42578–42587[Abstract/Free Full Text]
20. Pascal, G., and Milligan, G. (2005) Mol. Pharmacol. 68, 905–915[Abstract/Free Full Text]
21. Takasaki, J., Saito, T., Taniguchi, M., Kawasaki, T., Moritani, Y., Hayashi, K., and Kobori, M. (2004) J. Biol. Chem. 279, 47438–47445[Abstract/Free Full Text]
22. Stevens, P. A., Pediani, J., Carrillo, J. J., and Milligan, G. (2001) J. Biol. Chem. 276, 35883–35890[Abstract/Free Full Text]
23. Tang, H., Guo, D. F., Porter, J. P., Wanaka, Y., and Inagami, T. (1998) Circ. Res. 82, 523–531[Abstract/Free Full Text]
24. Smith, R. D., Hunyady, L., Olivares-Reyes, J. A., Mihalik, B., Jayadev, S., and Catt, K. J. (1998) Mol. Pharmacol. 54, 935–941[Abstract/Free Full Text]
25. Qian, H., Pipolo, L., and Thomas W. G. (1999) Biochem. J. 343, 637–644
26. Santos, R. A., Ferreira, A. J., Pinheiro, S. V., Sampaio, W. O., Touyz, R., and Campagnole-Santos, M. J. (2005) Expert Opin. Investig. Drugs 14, 1019–1031[CrossRef][Medline] [Order article via Infotrieve]
27. Lee, D. K., Lanca, A. J., Cheng, R., Nguyen, T., Ji, X. D., Gobeil, F., Jr., Chemtob, S., George, S. R., and O'Dowd, B. F. (2004) J. Biol. Chem. 279, 7901–7908[Abstract/Free Full Text]
28. Petaja-Repo, U. E., Hogue, M., Laperriere, A., Bhalla, S., Walker, P., and Bouvier, M. (2001) J. Biol. Chem. 276, 4416–4423[Abstract/Free Full Text]
29. Pietila, E. M., Tuusa, J. T., Apaja, P. M., Aatsinki, J. T., Hakalahti, A. E., Rajaniemi, H. J., and Petaja-Repo, U. E. (2005) J. Biol. Chem. 280, 26622–26629[Abstract/Free Full Text]
30. Werry, T. D., Wilkinson, G. F., and Willars, G. B. (2003) Biochem. J. 374, 281–296[CrossRef][Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles: