Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M601121200 on April 11, 2006

J. Biol. Chem., Vol. 281, Issue 24, 16757-16767, June 16, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/24/16757    most recent
M601121200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Canals, M.
Right arrow Articles by Milligan, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Canals, M.
Right arrow Articles by Milligan, G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Up-regulation of the Angiotensin II Type 1 Receptor by the MAS Proto-oncogene Is Due to Constitutive Activation of Gq/G11 by MAS*

Meritxell Canals, Laura Jenkins, Elaine Kellett, and Graeme Milligan1

From the Molecular Pharmacology Group, Division of Biochemistry and Molecular Biology, Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow G12 8QQ, Scotland, United Kingdom

Received for publication, February 6, 2006 , and in revised form, April 10, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Coexpression of the MAS proto-oncogene with the angiotensin II type 1 (AT1) receptor in CHO-K1 cells has been reported to increase the number of [3H]angiotensin II-binding sites, although MAS does not bind [3H]angiotensin II. In HEK293 cells stably expressing AT1 receptor-cyan fluorescent protein (CFP), MAS-yellow fluorescent protein (YFP) expression from an inducible locus caused strong up-regulation of AT1 receptor-CFP amounts and [3H]angiotensin II binding levels. The time course of AT1 receptor-CFP up-regulation was also markedly slower than that of induction of MAS expression. These effects were not mimicked by induced expression of I138D MAS-YFP, a mutant unable to cause constitutive loading of [35S]guanosine 5'-O-(thiotriphosphate) onto the phospholipase Cbeta-linked G protein G{alpha}11. Protein kinase C (PKC) inhibitors and the selective G{alpha}q/G{alpha}11 inhibitor YM-254890 fully blocked MAS-induced up-regulation of AT1 receptor-CFP amounts, whereas the PKC activator phorbol 12-myristate 13-acetate produced strong up-regulation of AT1 receptor-CFP without induction of MAS-YFP expression and in the presence of I138D MAS-YFP. The C-terminal tail of the AT1 receptor is a known target for PKC-mediated phosphorylation. In cells stably expressing a C-terminally truncated version of the AT receptor, induction of MAS expression did not up-regulate the truncated construct levels. These data demonstrate that the ability of MAS to up-regulate AT1 receptor levels reflects the constitutive capacity of MAS to activate G{alpha}q/G{alpha}11 and hence stimulate PKC-dependent phosphorylation of the AT1 receptor.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The octapeptide hormone angiotensin (Ang)2 II is one of the key components of the renin-angiotensin system and, as such, plays a major role in the regulation of blood pressure and cardiovascular homeostasis (1). Ang II exerts its effects through at least two subtypes of G protein-coupled receptors (GPCRs), the angiotensin II type 1 (AT1) and 2 (AT2) receptors. Whereas the functional role of the AT2 receptor is not fully understood (2, 3), important biological functions such as vasoconstriction, salt/water reabsorption, and stimulation of aldosterone release are mediated through AT1 receptor activation (4). However, in a number of situations, the AT1 receptor is modulated by other coexpressed GPCRs. For example, interactions with the AT2 receptor have been demonstrated in which the AT2 receptor acts as a functional antagonist of the AT1 receptor (5). AT1 and bradykinin B2 receptor interactions have also been shown, and these result in enhanced signaling of ligands at each receptor (6). Furthermore, in addition to interactions with GPCRs, agonist-induced functional interactions between the AT1 receptor and the single transmembrane-spanning tyrosine kinase epidermal growth factor receptor have also been reported (7, 8).

The MAS proto-oncogene was first detected in vivo by its tumorigenic activity (9) and later identified as a member of the rhodopsin-like class A GPCR subfamily. However, although suggested in early studies to be a potential candidate as an Ang II receptor (10, 11), it remained an "orphan" until recently, when it was demonstrated that the Ang II metabolite Ang-(1–7) is an endogenous agonist of MAS (12). In the last decade, there has been emerging evidence that, although not able to bind or respond directly to Ang II, MAS has a physiological role in modulating the functions of Ang II in both the neuronal (13) and cardiovascular (14) systems. In MAS knock-out mice, AT1 receptor signaling is altered in the amygdala (13); and, recently, Castro et al. (15) reported functional interactions between MAS and both the AT1 and AT2 receptors in mouse heart. In a previous study, we showed that MAS and the AT1 receptor interact in heterologous expression systems and that MAS acts as an functional antagonist of the AT1 receptor both in cotransfected CHO-K1 cells and in mesenteric microvessels of mice because greater levels of Ang II-mediated contraction were observed in vessels from MAS knock-out mice compared with wild-type controls (14). However, although Ang II produced lower levels of inositol phosphate accumulation and reduced increases in intracellular [Ca2+] in CHO-K1 cells coexpressing MAS and the AT1 receptor compared with those expressing the AT1 receptor alone, we also observed that MAS coexpression with the AT1 receptor resulted in an increase in [3H]Ang II binding capacity (14). The mechanism by which MAS increases [3H]Ang II binding has remained elusive. In this study, we demonstrate that it is due to the constitutive capacity of MAS to stimulate the G proteins G{alpha}q/G{alpha}11 and hence the activity of protein kinase C (PKC) and that this effect is cell type-independent.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—All materials for tissue culture were from Invitrogen (Paisley, UK). The PKC inhibitor Ro 31-8220, phorbol 12-myristate 13-acetate (PMA), doxycycline, and Ang II were from Sigma. GF 109203X was from Tocris (Avonmouth, UK), and YM-254890 was the kind gift of Astrellas Pharma Inc. (Osaka, Japan).

Site-directed Mutagenesis—To introduce amino acid substitutions into the primary structure of the human MAS receptor, site-directed mutagenesis of the encoding nucleotide sequence was performed using the QuikChange® II site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. The following primers were designed for the production of the I138D mutation (with the bases underlined): GTCCTTTACCCCGACTGGTACCGATGC (forward) and GCATCGGTACCAGTCGGGGTAAAGGAC (reverse).

Flp-In Constructs—To create MAS receptor constructs N-terminally tagged with the vesicular stomatitis virus G (VSV-G) epitope sequence and fused at the C terminus with yellow fluorescent protein (YFP), the human MAS receptor and I138D MAS were used as PCR templates. An oligonucleotide encoding a BamHI restriction site, the VSV-G epitope sequence, and the first 21 bases of the MAS receptor sequence was used as the forward primer (CGGGATCCATGTACACCGACATCGAAATGACCCGCCTTGGTAAGGATGGGTCAAACGTGACATCA), and an oligonucleotide containing the last 21 bases of the MAS sequence without its stop codon and a NotI restriction site was employed as the reverse primer (TTTTCCTTTTGCGGCCGCTGACGACAGTCTCAACTGTGACCGT). The PCR product was then inserted into vector pcDNA5/FRT/TO (Invitrogen) already containing YFP and previously digested with BamHI and NotI.

c-Myc-AT1 receptor (AT1R)-cyan fluorescent protein (CFP) was obtained using the same strategy as described above with the human AT1 receptor as a template; a forward primer encoding a HindIII restriction site, the c-Myc epitope sequence, and the first 21 bases of the receptor sequence (CCCAAGCTTATGGAACAAAAACTTATTTCTGAAGAAGATCTGATTCTCAACTCTTCTACTGAAGATTGG); and a reverse primer containing the last 21 bases of the AT1 receptor without its stop codon and a KpnI restriction site (CGGGGTACCCTCAACCTCAAAACATGGTGC). The PCR product was then inserted in pcDNA3.1 already containing CFP and previously digested with HindIII and KpnI. c-Myc-AT1R-YFP in pcDNA5/FRT/TO was subcloned by digesting c-Myc-AT1R-CFP with HindIII and KpnI and inserting it into pcDNA5/FRT/TO already containing YFP and previously digested with the same restriction enzymes. The truncated form of the AT1 receptor, c-Myc-{Delta}325AT1R-CFP, was obtained using the same strategy as described above with the human AT1 receptor as a template. The same primer encoding a HindIII restriction site, the c-Myc epitope sequence, and the first 21 bases of the receptor sequence was used as the forward primer, and the reverse primer contained the last 21 bases up to amino acid 325 of the AT1 receptor without its stop codon and a KpnI restriction site (CGGGGTACCTTTTGGGGGAATATATTT). The PCR product was then inserted in pcDNA3.1 already containing CFP and previously digested with HindIII and KpnI.

Cell Culture and Transfection—HEK293 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 0.292 g/liter L-glutamine and 10% (v/v) newborn calf serum at 37 °C in a 5% CO2 humidified atmosphere. Cells were grown to 60–80% confluence before transient transfection. Transfection was performed using Effectene® transfection reagent (Qiagen Inc., West Sussex, UK) according to the manufacturer's instructions.

CHO-K1 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 2 mmol/liter L-glutamine. Cells at 50–80% confluence were transfected transiently with the indicated cDNAs using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions.

Generation of Stable Flp-InTM T-RExTM HEK293 Cells—To generate Flp-In T-REx HEK293 cells able to inducibly express the receptors of interest, the cells were transfected with a mixture containing the desired receptor cDNA in the pcDNA5/FRT/TO vector and pOG44 vectors (1:9) using Effectene according to the manufacturer's instructions. Cell maintenance and selection were as described (16). Resistant clones were screened for receptor expression by both fluorescence and Western blotting. To induce expression of receptors cloned into the Flp-In locus, cells were treated with 0.1 µg/ml doxycycline for varying periods of time. PKC activation and inhibition, as well as G{alpha}q/G{alpha}11 inhibition treatments, were performed 6 h after inducing the receptors for an overnight period.

Live Cell Epifluorescence Microscopy—Cells expressing the appropriate receptors tagged with CFP or YFP were grown on poly-D-lysine-treated coverslips. The coverslips were placed into a microscope chamber containing physiological saline solution (130 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2, 20 mM HEPES, and 10 mM D-glucose, pH 7.4). Fluorescent images of the cells were acquired using a Nikon TE2000-E inverted microscope (Nikon Instruments, Melville, NY) equipped with a x40 (numerical aperture = 1.3) oil immersion Plan Fluor lens and a cooled digital CoolSNAPHQ charge-coupled device camera (Photometrics, Tucson, AZ) (see Ref. 17 for details).

Visualization of the Plasma Membrane—To fluorescently visualize the plasma membrane in live HEK293 cells expressing CFP- or YFP-fused receptors, cells were treated (as specified by the manufacturer) with the reagents in the Image-iT plasma membrane and nuclear labeling kit (Invitrogen), in which the plasma membrane is specifically labeled with wheat germ agglutinin-Alexa Fluor 594, and nuclei are stained simultaneously with Hoechst 33342. CFP and YFP were excited as described above, and Alexa Fluor 594 was excited at 575/12 nm and imaged using the following filter set: dichroic, Q595LP; and emitter, HQ645/75m. Using these filters, no bleed-through was observed, and the resultant sequential 12-bit images were overlaid using MetaMorph software (Version 6.3.5, Universal Imaging Corp., Downingtown, PA). For three-dimensional imaging, stacks of images (2 x 2 binning, 150–200-ms exposure/image) with a 0.339-µm Z step (~20–25 frames/stack) were sequentially acquired for each fluorescent dye.

[35S]GTP{gamma}S Binding—[35S]GTP{gamma}S binding experiments were initiated by the addition of membranes to assay buffer (20 mM HEPES, pH 7.4, 3 mM MgCl2, 100 mM NaCl, 1 µM GDP, 0.2 mM ascorbic acid, and 100 nCi of [32S]GTP{gamma}S) containing the indicated concentrations of receptor ligands. Nonspecific binding was determined under the same conditions but in the presence of 100 µM GTP{gamma}S. Reactions were incubated for 30 min at 30 °C and terminated by the addition of 0.5 ml of ice-cold buffer containing 20 mM HEPES, pH 7.4, 3 mM MgCl2, 100 mM NaCl, and 0.2 mM ascorbic acid. The samples were centrifuged at 16,000 x g for 10 min at 4 °C, and the resulting pellets were resuspended in solubilization buffer (100 mM Tris, 200 mM NaCl, 1 mM EDTA, and 1.25% Nonidet P-40) plus 0.2% SDS. Samples were precleared with Pansorbin (Calbiochem, Nottingham, UK), followed by immunoprecipitation with antiserum CQ (18). Finally, the immunocomplexes were washed twice with solubilization buffer, and bound [35S]GTP{gamma}S was measured by liquid scintillation spectrometry.

Cell-surface Receptor Measurement and Enzyme-linked Immunosorbent Assay—Cells were grown in 96-well poly-D-lysine-coated plates and induced with different concentrations of doxycycline for 24 h. Afterward, cell-surface receptors were labeled with anti-VSV-G antibody (1:1000) in growth medium for 30 min at 30 °C. The cells were then washed once with 20 mM HEPES and Dulbecco's modified Eagle's medium and then incubated for another 30 min at 37 °C in growth medium supplemented with horseradish peroxidase-conjugated anti-rabbit IgG as the secondary antibody and 1 µM Hoechst nuclear stain (Sigma) to determine the number of cells in each well. The cells were washed twice with phosphate-buffered saline, and the Hoechst fluorescence was measured. Finally, the cells were incubated with SureBlue (KPL, Inc., Gaithersburg, MD) for 5 min in the dark at room temperature, and the absorbance was read at 620 nm using a VICTOR2 plate reader (PerkinElmer Life Sciences).

Endoglycosidase Treatment—Endoglycosidase treatment was carried out overnight at 32 °C using peptide N-glycosidase F (Roche Diagnostics, Mannheim, Germany) at a final concentration of 1 unit/µl.

Cell Lysates and Western Blotting—Cell lysates were obtained by harvesting the cells with ice-cold radioimmune precipitation assay buffer (50 mM HEPES, 150 mM NaCl, 1% Triton X-100, and 0.5% sodium deoxycholate supplemented with 10 mM NaF, 5 mM EDTA, 10 mM NaH2PO4, 5% ethylene glycol, and Complete protease inhibitor mixture (Roche Diagnostics), pH 7.4). Cell extracts were then centrifuged for 30 min at 14,000 x g, and the supernatant was recovered.

After samples were heated at 65 °C for 15 min, cell lysates were subjected to SDS-PAGE analysis using 4–12% BisTris gels (NuPAGE, Invitrogen) and MOPS buffer. After electrophoresis, proteins were transferred onto nitrocellulose membranes that were incubated in a solution of 5% nonfat milk and 0.1% Tween 20 in Tris-buffered saline at room temperature on a rotating shaker for 2 h to block nonspecific binding sites. The membrane was incubated overnight with anti-c-Myc polyclonal antibody (Cell Signaling, Hertfordshire, UK) or anti-VSV-G antiserum and detected using horseradish peroxidase-linked anti-rabbit IgG secondary antiserum (Amersham Biosciences, Buckinghamshire, UK). Immunoblots were developed by application of enhanced chemiluminescence solution (Pierce).

Cell-surface Biotinylation Experiments—For cell-surface biotinylation, cells were grown in 6-well plates coated with poly-D-lysine and induced as described. Confluent cells were washed with ice-cold borate buffer (10 mM boric acid, 154 mM NaCl, 7.2 mM KCl, and 1.8 CaCl2, pH 9.0) and incubated on ice with 1 ml of 0.8 mM EZ-Link sulfosuccinimidyl 2-(biotinamido)ethyl-1,3-dithiopropionate (Pierce) in borate buffer for 15 min. The cells were then rinsed with a solution of 0.192 M glycine and 25 mM Tris, pH 8.3, to quench the excess biotin and lysed with radioimmune precipitation assay buffer. Lysates were centrifuged for 30 min at 14,000 x g, and the supernatant was recovered. An aliquot of the lysates was saved for Western blotting. Cell-surface biotinylated proteins were isolated using 100 µl of ImmunoPure immobilized streptavidin (Pierce). After 1 h of incubation at 4 °C with constant rotation, samples were spun, and the streptavidin beads were washed three times with radioimmune precipitation assay buffer. Finally, the biotinylated proteins were eluted with 100 µl of SDS sample buffer for 1 h at 37 °C, and SDS-PAGE and Western blotting were performed as described above.

Intact Cell Radioligand Binding Assays—Flp-In T-REx HEK293 cells expressing the wild-type or I138D MAS receptor with the constitutively expressed AT1 receptor were subcultured in 6-well plates coated with poly-D-lysine and grown to confluence. Each well was washed twice with prewarmed Krebs-Ringer buffer (145 mM NaCl, 20 mM HEPES, 1.3 mM MgCl2, 1.2 mM NaPO4, 5 mM KCl, 1.3 mM CaCl2, and 10 mM glucose, pH 7.4). Then, the Krebs-Ringer buffer was replaced with 0.8 ml of prewarmed [3H]Ang II (Amersham Biosciences) in Krebs-Ringer buffer supplemented with 0.25% (w/v) bovine serum albumin. Nonspecific binding was determined in the presence of 10 µM unlabeled Ang II. After 30 min at 37 °C (5% CO2 and 95% air), each well was washed twice with ice-cold Krebs-Ringer buffer, and the cells were solubilized by the addition of 1 ml of 0.1 M NaOH and 2% (w/v) SDS and incubated overnight at room temperature (20–25 °C). 1 ml of 0.1 M HCl was added to each well to neutralize the NaOH. The samples were mixed, and 1.6 ml was mixed with scintillation mixture and counted (Packard 2000 CA scintillation counter) to measure bound [3H]Ang II. The remaining cell lysates from each well were pooled and used for protein determination. A radioligand concentration of 10 nM [3H]Ang II was used for single point studies.


Figure 1
View larger version (67K):
[in this window]
[in a new window]
  		FIGURE 1.
Induced expression of MAS results in up-regulation of a coexpressed AT1 receptor. Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP at the Flp-In locus (A1 and B1) and constitutively expressing c-Myc-AT1R-CFP (A2 and B2) were left untreated (A1 and A2) or were treated with doxycycline (0.1 µg/ml) for 24 h (B1 and B2) to induce VSV-G-MAS-YFP expression. Fluorescence corresponding to YFP (A1 and B1) and CFP (A2 and B2) was then imaged.

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
We recently reported that coexpression of the GPCR MAS with the AT1 receptor in CHO-K1 cells results in a decreased capacity of Ang II to increase intracellular [Ca2+] and inositol phosphate accumulation (14). Paradoxically, however, this is associated with an increase in [3H]Ang II-binding sites, although MAS does not bind this ligand (14). We resolved to explore the molecular basis for this up-regulation of Ang II binding.

Generation of Flp-In T-REx HEK293 Cell Lines—A Flp-In T-REx HEK293 clonal cell line was established in which a form of the human AT1 receptor C-terminally tagged with CFP and N-terminally tagged with the c-Myc epitope sequence (c-Myc-AT1R-CFP) was expressed stably and constitutively. These cells also harbored, at the Flp-In locus, a form of human MAS C-terminally tagged with YFP and N-terminally tagged with the VSV-G epitope sequence (VSV-G-MAS-YFP). The Flp-In locus ensures a single defined site of chromosomal integration; and in the T-REx form of these cells, expression from this locus is controlled in a Tet-on-inducible fashion by the addition of either tetracycline or the related antibiotic doxycycline (16). In the absence of doxycycline, cell imaging demonstrated expression of c-Myc-AT1R-CFP predominantly in punctate intracellular vesicles, likely to represent recycling endosomes, and a lack of expression of VSV-G-MAS-YFP (Fig. 1A). The addition of doxycycline (0.1 µg/ml, 24 h) resulted in induction of VSV-G-MAS-YFP expression. This receptor construct had an unusual, widespread, cellular distribution, with at least some of the YFP signal overlapping with the nucleus (Fig. 1B). With expression of VSV-G-MAS-YFP, the fluorescent signal corresponding to c-Myc-AT1R-CFP was markedly increased (Fig. 1B), with much of the signal apparently inside the cell.


Figure 2
View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 2.
MAS, but not I138D MAS, causes constitutive activation of G{alpha}11. HEK293 cells were transfected transiently to express G{alpha}11, MAS and G{alpha}11, or I138D MAS and G{alpha}11, and membranes were prepared. Following incubation with [35S]GTP{gamma}S, samples were immunoprecipitated with anti-Gq/G11 antiserum (18) and counted. Data represent the means ± S.E. (n = 3).

 


Figure 3
View larger version (69K):
[in this window]
[in a new window]
  		FIGURE 3.
I138D MAS, but not MAS, is located predominantly at the cell surface. A and B, Flp-In T-REx HEK293 cells harboring VSV-G-I138D MAS-YFP at the Flp-In locus (left panels) and constitutively expressing c-Myc-AT1R-CFP (right panels) were left untreated (A) or were treated with doxycycline (0. 1 µg/ml) for 24 h (B) to induce VSV-G-I138D MAS-YFP expression. Fluorescence corresponding to YFP (left panels) and CFP (right panels) was then imaged. C, intact cell anti-VSV-G enzyme-linked immunosorbent assays were performed on Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP (open bars) or VSV-G-I138D MAS-YFP (closed bars) after treatment of the cells for 24 h with various concentrations of doxycycline (Dox). Abs, absorbance. D, cells as in C, harboring VSV-G-MAS-YFP (panels i and ii) or VSV-G-I138D MAS-YFP (panels iii and iv), were left untreated (panels i and iii) or were treated with doxycycline (0.1 µg/ml) for 24 h (panels ii and iv) and stained with Image-iT membrane dye (red).

 
MAS Constitutively Activates G{alpha}11—Transient transfection of MAS into HEK293 cells along with the phospholipase Cbeta-linked G protein G{alpha}11 resulted in loading of ~4-fold greater amounts of [35S]GTP{gamma}S onto the G protein than observed in the absence of MAS, consistent with the substantial ligand-independent, constitutive activity of this GPCR (Fig. 2). We have demonstrated previously that mutation of key hydrophobic residues in the second intracellular loop of many rhodopsin-like class A GPCRs ablates their capacity to activate cognate G proteins (18, 19). Conversion of Ile138 to Asp in MAS (I138D MAS) and expression of this form of the receptor with G{alpha}11 failed to enhance [35S]GTP{gamma}S binding to the G protein (Fig. 2).

I138D MAS Is Delivered to the Cell Surface but Does Not Up-regulate the AT1 Receptor—Based on the ability of the I138D mutation to eliminate constitutive MAS-induced loading of [35S]GTP{gamma}S onto G{alpha}11, we generated additional Flp-In T-REx HEK293 cell lines that constitutively expressed c-Myc-AT1R-CFP but also harbored VSV-G-I138D MAS-YFP at the Flp-in locus (Fig. 3A). Induction of VSV-G-I138D MAS-YFP expression by treatment with doxycycline resulted in a completely different distribution pattern compared with VSV-G-MAS-YFP. The I138D MAS construct appeared to be located largely at the plasma membrane (Fig. 3B). Expression of VSV-G-I138D MAS-YFP neither up-regulated c-Myc-AT1R-CFP nor markedly altered its cellular distribution (Fig. 3B). To confirm substantially more effective plasma membrane localization of VSV-G-I138D MAS-YFP, we performed a series of intact cell anti-VSV-G enzyme-linked immunosorbent assays. Although induction of VSV-G-MAS-YFP expression with increasing concentrations of doxycycline resulted in little increase in anti-VSV-G cell-surface immunoreactivity (Fig. 3C), a clear, doxycycline concentration-dependent increase in signal was obtained when VSV-G-I138D MAS-YFP expression was induced (Fig. 3C). Furthermore, staining and image overlay of cells induced to express either VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP with Image-iT membrane dye confirmed effective plasma membrane delivery of VSV-G-I138D MAS-YFP, but not VSV-G-MAS-YFP (Fig. 3D). Cell-surface biotinylation studies also confirmed cell-surface delivery of VSV-G-I138D MAS-YFP, but not VSV-G-MAS-YFP (Fig. 4A).


Figure 4
View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 4.
AT1 receptor glycosylation, biotinylation, and up-regulation studies. A, shown is the cell-surface biotinylation of Flp-InT-RExHEK293 cells harboring VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP at the Flp-In locus. Cells were left untreated or were treated with doxycycline (Dox; 0.1 µg/ml) for 24 h to induce expression of the forms of MAS-YFP, and cell-surface receptors were biotinylated and pulled down with streptavidin-agarose beads. Total lysates (l) and precipitated samples (b) were then resolved by SDS-PAGE and immunoblotted with anti-VSV-G antibody. B, membranes of cells induced to coexpress VSV-G-MAS-YFP and c-Myc-AT1R-CFP were treated with or without peptide N-glycosidase F (NGaseF), resolved by SDS-PAGE, and immunoblotted with anti-c-Myc antibody to identify forms of c-Myc-AT1R-CFP. C, shown is the cell-surface biotinylation of HEK293 cells expressing c-Myc-AT1R. Samples were resolved by SDS-PAGE and immunoblotted with anti-c-Myc antibody. ub, unbound; l, total lysates; b, cell-surface receptor. D, Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP at the Flp-In locus and constitutively expressing c-Myc-AT1R-CFP were left untreated or were treated with doxycycline (0.1µg/ml) for 24 h to induce expression of the forms of MAS-YFP. Lysates of these cells as well as from cells expressing only VSV-G-MAS-YFP in an inducible fashion were then resolved by SDS-PAGE and immunoblotted with anti-c-Myc antibody. E, shown are the results from Western blot densitometry of cell lysates of Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP at the Flp-In locus and constitutively expressing c-Myc-AT1R-CFP. A constant dose of 0.1 µg/ml doxycycline was used for different periods of induction. F, Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP (upper panel) or VSV-G-I138D MAS-YFP (lower panel) at the Flp-In locus and constitutively expressing c-Myc-AT1R-CFP were treated ({blacktriangleup}) or not ({square}) with doxycycline and used to perform intact cell binding of [3H]Ang II. prot, protein.

 


Figure 5
View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 5.
PKC inhibitors block and PKC activators mimic the effects of MAS on AT1 receptor up-regulation. A, Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP (open bars) or VSV-G-I138D MAS-YFP (closed bars) at the Flp-In locus and constitutively expressing c-Myc-AT1R-CFP were left untreated (– Dox) or were treated with doxycycline (0.1 µg/ml) for 24 h (+ Dox) to induce expression of the forms of MAS-YFP. Some of the cells were also treated with the PKC inhibitor Ro 31-8220 (1 µM). These cells were then used to measure the specific binding of [3H]Ang II (10 nM). prot, protein. B, cells as in A, induced or not to express VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP in the presence of constitutive expression of c-Myc-AT1R-CFP, were treated or not with 1 µM Ro 31-8220. Cell lysates were resolved by SDS-PAGE and immunoblotted with anti-c-Myc antibody (upper panel) or with an antiserum that identifies the total population of the MAPKs ERK1 and ERK2 (lower panel). C, Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP and constitutively expressing c-Myc-AT1R-CFP were left untreated or were treated with doxycycline (0.1µg/ml) for 24 h and with combinations of the PKC inhibitors Ro 31-8220 (1µM) and GF 109203X (100 nM) and the PKC activator PMA (100 nM). Cell lysates were resolved by SDS-PAGE and immunoblotted with anti-c-Myc antibody (upper panel) or with an antiserum that identifies the total population of the MAPKs ERK1 and ERK2 (lower panel). D, fluorescence corresponding to c-Myc-AT1R-CFP was measured in uninduced cells (open bars) and in doxycycline-treated cells induced to express VSV-G-MAS-YFP (closed bars) that were treated with Ro 31-8220 (1 µM), PMA (100 nM), or PMA and Ro 31-8220. A.F.U., arbitrary fluorescence units.

 
Only the Core Glycosylated Form of the AT1 Receptor Is Delivered to the Cell Surface—Many GPCRs are produced as immature forms that require final core glycosylation prior to effective plasma membrane delivery and insertion. Membranes of cells induced to coexpress VSV-G-MAS-YFP and c-Myc-AT1R-CFP were treated with or without peptide N-glycosidase F, resolved by SDS-PAGE, and immunoblotted with anti-c-Myc antibody to identify forms of c-Myc-AT1R-CFP (Fig. 4B). In the untreated samples, polypeptides with apparent masses of 60 and 90 kDa were detected as well as those with higher apparent molecular mass/lower mobility, which may represent dimeric or oligomeric complexes. Treatment with peptide N-glycosidase F resulted in the appearance of a predominant band at an apparent molecular mass of 50 kDa with substantially lower amounts of bands at ~60 kDa. These results suggest that both the 60- and 90-kDa forms are N-glycosylated and that the 90-kDa polypeptide is likely to represent the mature, core glycosylated receptor monomer. To confirm the concept that the higher molecular mass species was the mature form, we performed cell-surface biotinylation assays. In cells expressing the c-Myc-AT1R-CFP construct, such cell-surface biotinylation assays identified only the 90-kDa polypeptide, although immunoblots of total cell lysates indicated that the 60-kDa species was present at similar levels (Fig. 4C). Having identified the different forms of c-Myc-AT1R-CFP and to further validate the imaging studies, we treated cells constitutively expressing c-Myc-AT1R-CFP and harboring either VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP with or without doxycycline. Cell lysates from these cells were then immunoblotted with anti-c-Myc antibody (Fig. 4D). These results confirmed the up-regulation of c-Myc-AT1R-CFP upon coexpression of VSV-G-MAS-YFP, but not VSV-G-I138D MAS-YFP. Another Flp-In T-REx HEK293 cell line in which VSV-G-MAS-YFP expression could be induced but which did not express c-Myc-AT1R-CFP confirmed that the immunodetected polypeptides truly represent c-Myc-AT1R-CFP (Fig. 4D).

MAS Expression Precedes AT1 Receptor Up-regulation—If the presence of active MAS were required to cause up-regulation of the AT1 receptor construct, we reasoned that the time course of AT1 receptor up-regulation would be slower than that of induction of MAS expression. This was confirmed via a series of Western blot studies (Fig. 4E), in which the presence of VSV-G-MAS-YFP could be detected with in 6 h of doxycycline addition, whereas significant up-regulation of c-Myc-AT1R-CFP required 10–18 h. To confirm the previous observations, cells constitutively expressing c-Myc-AT1R-CFP were induced or not to express VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP, and the specific binding of increasing concentrations of [3H]Ang II was measured (Fig. 4F). As anticipated from the foregoing, the Bmax of [3H]Ang II binding was increased (0.2 ± 0.03 to 0.6 ± 0.06 pmol/mg of protein) by coexpression of VSV-G-MAS-YFP, but not VSV-G-I138D MAS-YFP (0.2 ± 0.02 versus 0.2 ± 0.06 pmol/mg of protein; means ± S.E., n = 3), whereas the affinity of [3H]Ang II (Kd = 0.9–1.7 nM in individual experiments) was unaltered.


Figure 6
View larger version (72K):
[in this window]
[in a new window]
  		FIGURE 6.
PMA treatment up-regulates AT1 receptor levels in cells expressing I138D MAS. Flp-In T-REx HEK293 cells harboring VSV-G-I138D MAS-YFP and constitutively expressing c-Myc-AT1R-CFP were uninduced (left panels) or treated with doxycycline (+ Dox) as indicated. Such cells were also treated with PMA alone or with Ro 31-8220 as described in the legend to Fig. 5D. Cells were then imaged. CFP fluorescence is quantitated in the graph. A.F.U., arbitrary fluorescence units. Open bar, –doxycycline; filled bars, +doxycycline.

 
Regulation of PKC Activity Modulates AT1 Receptor Levels—Because MAS is able to constitutively activate Gq/G11 (Fig. 2) and hence presumably activate PKC, we added the PKC inhibitor Ro 31-8220 to cells constitutively expressing c-Myc-AT1R-CFP with and without doxycycline to induce expression of VSV-G-MAS-YFP. Although without effect on [3H]Ang II binding in cells not induced to express VSV-G-MAS-YFP, Ro 31-8220 fully inhibited the increase in [3H]Ang II binding produced by expression of MAS (Fig. 5A). Ro 31-8220 was also without effect on [3H]Ang II binding in cells induced to express VSV-G-I138D MAS-YFP (Fig. 5A). Parallel immunoblots confirmed the effect of Ro 31-8220 (Fig. 5B), whereas equivalent immunoblots of total ERK1 and ERK2 MAPKs amounts confirmed equal sample loading. A second PKC inhibitor, GF 109203X, produced similar results (Fig. 5C). We reasoned that activation of PKC in the absence of MAS induction should also up-regulate c-Myc-AT1R-CFP levels. Treatment of cells harboring VSV-G-MAS-YFP with PMA produced a high level of c-Myc-AT1R-CFP up-regulation without induction of VSV-G-MAS-YFP expression (Fig. 5C). The effect of PMA was also blocked by the co-addition of Ro 31-8220 and was not increased further by induction of VSV-G-MAS-YFP expression (Fig. 5C). Simple quantitation of the levels of CFP fluorescence in living cells (Fig. 5D) confirmed the immunoblot results. As anticipated, PMA treatment of cells expressing c-Myc-AT1R-CFP and induced to express VSV-G-I138D MAS-YFP also resulted in marked up-regulation of c-Myc-AT1R-CFP, which was again blocked by the co-addition of Ro 31-8220 (Fig. 6).

A Novel Gq/G11 Inhibitor Prevents MAS-induced Up-regulation of the AT1 Receptor—Gq and G11 are upstream of PKC and, as shown in Fig. 2, are constitutively activated by MAS, but not I138D MAS. Recently, YM-254890 has been described as a selective Gq/G11 inhibitor (21). We initially tested the ability of YM-254890 to inhibit receptor activation of Gq/G11 by its capacity to prevent phenylephrine-mediated [35S]GTP{gamma}S binding to {alpha}1b-adrenoreceptor-G{alpha}q and {alpha}1b-adrenoreceptor-G{alpha}11 fusion proteins (19, 22). In membranes of HEK293 cells expressing these fusion proteins, YM-254890 inhibited agonist-mediated loading of [35S]GTP{gamma}S with EC50 = 4nM. This inhibition was highly selective. 100 nM YM-254890 had no ability to inhibit agonist-mediated activation of G{alpha}s via a corticotropin-releasing factor-1 receptor-G{alpha}s fusion protein, G{alpha}i3 via a GPR41-G{alpha}i3 fusion protein, or G{alpha}o1 via an {alpha}2A-adrenoreceptor-G{alpha}o1 fusion protein (Fig. 7). At 100 nM, YM-254890 also blocked the up-regulation of c-Myc-AT1R-CFP produced following induction of VSV-G-MAS-YFP expression (Fig. 8). Because PKC is downstream of Gq/G11, we predicted that YM-254890 would not be able to block PMA-mediated c-Myc-AT1R-CFP up-regulation, and this was confirmed (Fig. 8).


Figure 7
View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 7.
YM-254890 is a potent and highly selective inhibitor of G{alpha}q and G{alpha}11 activation. A, HEK293 cells were transfected to transiently express either the {alpha}1b-adrenoreceptor-G{alpha}q ({blacktriangleup}) or {alpha}1b-adrenoreceptor-G{alpha}11 ({square}) fusion protein. The stimulation of [35S]GTP{gamma}S binding in G{alpha}q/G{alpha}11 immunoprecipitates produced by 100 µM phenylephrine and the effect on this of varying concentrations of YM-254890 are displayed (means ± S.E., n = 3). B, HEK293 cells were transfected to express the {alpha}1b-adrenoreceptor-G{alpha}11, corticotropin-releasing factor-1 receptor (CRF)-G{alpha}s, GPR41-G{alpha}i3, or {alpha}2A-adrenoreceptor-G{alpha}o1 fusion protein as indicated. The stimulation of [35S]GTP{gamma}S binding by maximally effective concentrations of cognate receptor agonists and the effect of 100 nM YM-254890 on this were assessed following immunoprecipitation with an anti-G protein subunit antiserum specific for each construct.

 
Induction of MAS, but Not I138D MAS, Causes Constitutive Activation of Gq/G11 in Flp-In T-REx Cells—In membranes of Flp-In T-REx cells harboring VSV-G-MAS-YFP at the Flp-In locus, [35S]GTP{gamma}S binding assays followed by immunoprecipitation with antiserum CQ resulted in low levels of recovered nucleotide in the absence of doxycycline treatment. This was increased substantially when VSV-G-MAS-YFP expression was induced, and this elevated level of [35S]GTP{gamma}S binding was blocked by the presence of YM-254890, but not the AT1 receptor blocker losartan. Similar levels of basal [35S]GTP{gamma}S binding were present in equivalent experiments using cell membranes harboring VSV-G-I138D MAS-YFP at the Flp-In locus, but binding was not increased by induction of VSV-G-I138D MAS-YFP expression (Fig. 9).


Figure 8
View larger version (75K):
[in this window]
[in a new window]
  		FIGURE 8.
YM-254890 blocks MAS-induced but not PMA-mediated up-regulation of AT1 receptor levels. Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP at the Flp-In locus were left untreated (– Dox) or were treated with doxycycline (0.1 µg/ml) for 24 h (+ Dox) to induce VSV-G-MAS-YFP. Cells were also treated with combinations of PMA and YM-254890 (both at 100 nM). Cell lysates were resolved by SDS-PAGE and immunoblotted with anti-c-Myc antibody (upper panel) or anti-ERK1/ERK2 antibody (lower panel).

 
The AT1 Receptor Lacking C-terminal PKC Phosphorylation Sites Is Not Up-regulated by Coexpression of MAS—The AT1 receptor has a group of three potential PKC phosphorylation sites in the C-terminal tail, and phosphorylation of these residues in response to both Ang II and PKC activation has been explored previously (23–25). We generated a variant of c-Myc-AT1R-CFP (c-Myc-{Delta}325AT1R-CFP) that was truncated after amino acid 325 of the receptor and hence lacks the PKC phosphorylation sites and generated additional Flp-In T-REx HEK293 cell lines with VSV-G-MAS-YFP at the Flp-In locus and c-Myc-{Delta}325AT1R-CFP expressed constitutively. In the absence of VSV-G-MAS-YFP, the distribution pattern of c-Myc-{Delta}325AT1R-CFP was not different from that of c-Myc-AT1R-CFP (Fig. 10), but expression of VSV-G-MAS-YFP failed to substantially up-regulate c-Myc-{Delta}325AT1R-CFP levels judged by either CFP fluorescence or c-Myc immunoreactivity (Fig. 10).

To confirm that the PKC-based mechanism of MAS-induced up-regulation of the AT1 receptor is not produced only in HEK293 cells, CHO-K1 cells were transiently transfected to express c-Myc-AT1R-CFP with or without coexpression of VSV-G-MAS-YFP. These cells were subsequently treated with combinations of PMA to activate PKC and Ro 31-8220 to inhibit this activity. As in the Flp-In T-REx HEK293 cell lines, treatment with PMA in the absence of MAS resulted in strong up-regulation of c-Myc-AT1R-CFP levels detected in anti-c-Myc immunoblots, and this was blocked by co-administration of Ro 31-8220 (Fig. 11). MAS-induced up-regulation of c-Myc-AT1R-CFP immunoreactivity was largely blocked by treatment with Ro 31-8220 (Fig. 11). As an additional control for the effects of MAS in the Flp-In T-REx HEK293 system, which requires the addition of doxycycline to cause expression of MAS, we transiently transfected HEK293 cells with c-Myc-AT1R-CFP and confirmed that the addition of doxycycline did not result in c-Myc-AT1R-CFP up-regulation, whereas treatment with PMA produced strong up-regulation (Fig. 11).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The AT1 receptor and the MAS proto-oncogene are often coexpressed in, for example, vascular smooth muscle cells. After the cloning of MAS cDNA (9), some early experiments suggested that it might be a receptor for angiotensin peptides (10), but it is now well appreciated that MAS does not bind Ang II. However, Ang-(1–7), the product of ACE2 activity (26), has recently been described as an endogenous agonist of MAS (12). Furthermore, because Ang-(1–7) counters many of the regulatory actions of Ang II, there has been considerable interest in the interplay between MAS and the AT1 receptor. Following expression of the AT1 receptor in CHO-K1 cells, Ang II produces a strong, concentration-dependent increase in intracellular [Ca2+] (14). However, with coexpression of MAS, the effect of a maximally effective concentration of Ang II is substantially reduced, an effect also observed when inositol phosphate accumulation is measured (14). Despite these effects on Ang II-generated signals, coexpression with MAS actually results in higher levels of [3H]Ang II binding (14). The interplay between MAS and the AT1 receptor is further underlined when measuring Ang II-mediated contraction of mouse mesenteric microvessels. Ang II produces greater contraction in vessels from MAS knock-out animals than in vessels from wild-type controls (14). It was concluded that MAS forms a complex with the AT1 receptor that is inhibitory to AT1 receptor function, as had been described previously for AT2/AT1 receptor interactions (5).


Figure 9
View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 9.
Induction of MAS, but not I138D MAS, stimulates constitutive activation of G{alpha}q/G{alpha}11 in membranes of Flp-In T-REx HEK293 cells. Flp-In T-REx HEK293 cells constitutively expressing c-Myc-AT1R-CFP and harboring either VSV-G-MAS-YFP or VSV-G-I138D MAS-YFP at the Flp-In locus were left untreated (– Dox) or were treated with doxycycline (0.1 µg/ml) for 24 h (+ Dox). Membranes from these were used in [35S]GTP{gamma}S binding assays with end of assay G{alpha}q/G{alpha}11 immunoprecipitation. Assays received no ligand (Basal) or were treated with Ang II (1 µM), losartan (Los; 10 µM), YM-254890 (100 nM), or Ang II (1 µM) and YM-254890 (100 nM).

 
To confirm MAS-induced increases in [3H]Ang II binding when coexpressed with the AT1 receptor in a separate cell system and to explore the molecular basis of this effect required a means to control MAS expression in the face of AT1 receptor expression. We thus employed Flp-In T-REx HEK293 cells. Introduction of a construct at the single defined Flp-In locus results in induction of expression only when the cells are exposed to tetracycline or the related antibiotic doxycycline (16). These cells were also transfected to stably and constitutively express the AT1 receptor. By employing receptor constructs tagged at the C terminus with CFP and YFP, we could also monitor their cellular distribution. In the absence of MAS, AT1R-CFP was predominantly intracellular with a distribution pattern reminiscent of the endocytic recycling pathway. With induction of MAS expression, a marked up-regulation of AT1R-CFP could be easily visualized, although a significant fraction appeared trapped within the cells. Although MAS is a GPCR, little of the MAS-YFP construct was present at the plasma membrane; and indeed, the distribution apparently overlapped, at least in part, with the nucleus. Interestingly, following expression in HEK293 cells, a number of GPCRs that appear to have a nuclear localization sequence in their C-terminal tails have been reported to show nuclear localization (27). Although not tested directly, Lee et al. (27) did note a similar, potential nuclear localization sequence in MAS. MAS has also been suggested to show high levels of constitutive activity in a number of deorphanization/ligand screening programs, and we demonstrated the ability of MAS to load [35S]GTP{gamma}S onto the G protein G{alpha}11 in a ligand-independent fashion. Because we have shown that mutation of key hydrophobic residues in the second intracellular loop of many GPCRs eliminates both constitutive and agonist-dependent G protein activation (19, 20), we generated I138D MAS. I138D MAS had no ability to activate G{alpha}11; and when expressed as I138D MAS-YFP from the Flp-In locus of Flp-In T-REx HEK293 cells, this construct was plasma membrane-delineated and failed to cause up-regulation of AT1R-CFP. It is unclear if it is the constitutive activity of MAS that results in the unusual cellular distribution of MAS-YFP, but certainly I138D is not close (at least in the primary sequence) to the identified nuclear localization sequence in the C-terminal tail (27) and would not inherently be anticipated to alter this. However, it did seem possible that the constitutive activity of MAS could be responsible for the up-regulation of AT1R-CFP. A series of inhibitor studies confirmed this conclusion. The most direct was via inhibition of Gq/G11 using YM-254890 (21). This compound fully blocks the MAS-induced effect and is both a remarkably selective and potent Gq/G11 inhibitor.

The MAS-induced up-regulation of the AT1 receptor monitored in cell imaging studies showed substantial accumulation in an intracellular compartment that may be the Golgi. It is well established that effective core glycosylation is an important quality control check prior to cell-surface delivery of many GPCRs (28, 29) and that a substantial amount of expressed protein fails this control and is routed to the proteasome for destruction. Immunoblot studies showed strong up-regulation of the AT1 receptor by both MAS and activation of protein kinase C and also demonstrated a mixture of highly and less well glycosylated forms. Cell-surface biotinylation studies indicated that only the fully glycosylated form was delivered to the cell surface. Thus, because the imaging studies cannot discriminate between these forms, the combination of cell imaging, immunoblot, ligand binding, and cell-surface biotinylation studies offers the best means to understand the molecular diversity of the forms and cellular distribution of the AT1 receptor construct. Because PKC lies downstream of Gq/G11, we reasoned that PKC inhibitors should also block MAS-induced up-regulation of AT1R-CFP and that PKC activators should do so without induction of constitutively active MAS. Both these expectations were fully met. Many analyses have shown roles for agonist- and PKC-mediated phosphorylation of the C-terminal tail of the AT1 receptor (23–25). Although key previous studies have been performed with the rat receptor, the C-terminal tail of the AT1 receptor is well conserved between human and rat with three clear potential sites for PKC-mediated phosphorylation. Truncation to amino acid 325 removes these three sites. As such, it was satisfying that MAS-YFP was unable to cause significant up-regulation of c-Myc-{Delta}325AT1R-CFP.


Figure 10
View larger version (48K):
[in this window]
[in a new window]
  		FIGURE 10.
Induction of MAS does not cause up-regulation of the AT1 receptor lacking C-terminal PKC phosphorylation sites. Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP at the Flp-In locus (A1 and B1) and constitutively expressing c-Myc-{Delta}325AT1R-CFP (A2 and B2) were left untreated (A1 and A2) or were treated with doxycycline (Dox; 0.1 µg/ml) for 24 h (B1 and B2) to induce VSV-G-MAS-YFP expression. The fluorescence corresponding to YFP (A1 and B1) and CFP (A2 and B2) was then imaged in living cells. Cell lysates of Flp-In T-REx HEK293 cells harboring VSV-G-MAS-YFP at the Flp-In locus and either c-Myc-AT1R-CFP or c-Myc-{Delta}325AT1R-CFP were treated as described above, resolved by SDS-PAGE, and immunoblotted with anti-c-Myc antibody (C).

 


Figure 11
View larger version (44K):
[in this window]
[in a new window]
  		FIGURE 11.
Both MAS and PMA produce up-regulation of c-Myc-AT1R-CFP in transiently transfected CHO-K1 and HEK293 cells. CHO-K1 (left panel) or HEK293 (right panel) cells were transiently transfected with c-Myc-AT1R-CFP with (+) or without (–) VSV-G-MAS-YFP. 24 h after transfection, cells were treated for 16 h with combinations of PMA and Ro 31-8220 (both at 100 nM) or with 0.1µg/ml doxycycline (Dox). Cell lysates were then resolved by SDS-PAGE and immunoblotted with anti-c-Myc antibody.

 
Although our study does not directly address the mechanistic basis for enhanced Ang II-mediated contraction in mesenteric vessels of MAS knock-out mice, it is likely that it may also reflect a loss of constitutive MAS-induced activation of PKC and phosphorylation of the AT1 receptor. PKC-mediated phosphorylation of the AT1 receptor is associated with decreased function, whereas truncation to eliminate PKC phosphorylation sites, as in {Delta}325AT1R, is associated with an increased capacity of Ang II to stimulate inositol phosphate production because of reduced desensitization. Elimination of constitutive MAS-induced PKC activation and hence AT1 receptor phosphorylation in vessels of MAS knock-out animals is therefore also consistent with the enhanced function of Ang II in producing contraction of mesenteric microvessels from MAS knock-out mice (14); and of course, heterologous desensitization of a coexpressed receptor by either constitutive or agonist-induced activation of a GPCR is a commonly employed regulatory strategy (30). It still remains to be established if the MAS-Gq/G11-PKC-mediated up-regulation of the AT1 receptor reflects enhanced stability of the protein and hence slower turnover. Future studies will assess this issue.


   FOOTNOTES
 
* This work was supported by the Medical Research Council. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Div. of Biochemistry and Molecular Biology, University of Glasgow, Davidson Bldg., University Ave., Glasgow G12 8QQ, Scotland, UK. Tel.: 44-141-330-5557; Fax: 44-141-330-4620; E-mail: g.milligan{at}bio.gla.ac.uk.

2 The abbreviations used are: Ang, angiotensin; GPCRs, G protein-coupled receptors; AT1 and AT2, angiotensin II types 1 and 2, respectively; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; VSV-G, vesicular stomatitis virus G; YFP, yellow fluorescent protein; AT1R, angiotensin II type 1 receptor; CFP, cyan fluorescent protein; GTP{gamma}S, guanosine 5'-O-(thiotriphosphate); BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; MOPS, 4-morpholinepropanesulfonic acid; ERK, extracellular signal-regulated kinase; MAPK, mitogen-activated protein kinase. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Fleming, I., Kohlstedt, K., and Busse, R. (2006) Curr. Opin. Nephrol. Hypertens. 15, 8–13[Medline] [Order article via Infotrieve]
  2. Carey, R. M. (2005) Curr. Opin. Nephrol. Hypertens. 14, 67–71[Medline] [Order article via Infotrieve]
  3. Reudelhuber, T. L. (2005) Hypertension 46, 1261–1262[Free Full Text]
  4. Ruilope, L. M., Rosei, E. A., Bakris, G. L., Mancia, G., Poulter, N. R., Taddei, S., Unger, T., Volpe, M., Waeber, B., and Zannad, F. (2005) Blood Press. 14, 196–209[CrossRef][Medline] [Order article via Infotrieve]
  5. AbdAlla, S., Lother, H., Abdel-tawab, A. M., and Quitterer, U. (2001) J. Biol. Chem. 276, 39721–39726[Abstract/Free Full Text]
  6. AbdAlla, S., Lother, H., and Quitterer, U. (2000) Nature 407, 94–98[CrossRef][Medline] [Order article via Infotrieve]
  7. Smith, N. J., Chan, H. W., Osborne, J. E., Thomas, W. G., and Hannan, R. D. (2004) CMLS Cell. Mol. Life Sci. 61, 2695–2703
  8. Olivares-Reyes, J. A., Shah, B. H., Hernandez-Aranda, J., Garcia-Caballero, A., Farshori, M. P., Garcia-Sainz, J. A., and Catt, K. J. (2005) Mol. Pharmacol. 68, 356–364[Abstract/Free Full Text]
  9. Young, D., Waitches, G., Birchmeier, C., Fasano, O., and Wigler, M. (1986) Cell 45, 711–719[CrossRef][Medline] [Order article via Infotrieve]
  10. Jackson, T. R., Blair, L. A., Marshall, J., Goedert, M., and Hanley, M. R. (1998) Nature 335, 437–440
  11. Jackson, T. R., and Hanley, M. R. (1989) FEBS Lett. 251, 27–30[CrossRef][Medline] [Order article via Infotrieve]
  12. Santos, R. A., Simoes e Silva, A. C., Maric, C., Silva, D. M., Machado, R. P., de Buhr, I., Heringer-Walther, S., Pinheiro, S. V., Lopes, M. T., Bader, M., Mendes, E. P., Lemos, V. S., Campagnole-Santos, M. J., Schultheiss, H. P., Speth, R., and Walther, T. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 8258–8263[Abstract/Free Full Text]
  13. Von Bohlen Und Halbach, O., Walther, T., Bader, M., and Albrecht, D. (2000) J. Neurophysiol. 83, 2012–2020[Abstract/Free Full Text]
  14. Kostenis, E., Milligan, G., Christopoulos, A., Sanchez-Ferrer, C. F., Heringer-Walther, S., Sexton, P., Gembardt, F., Kellett, E., Martini, L., Vanderheyden, P., Schultheiss, H. P., and Walther, T. (2005) Circulation 111, 1806–1813[Abstract/Free Full Text]
  15. Castro, C. H., Santos, R. A., Ferreira, A. J., Bader, M., Alenina, N., and Almeida, A. P. (2005) Hypertension 46, 937–942[Abstract/Free Full Text]
  16. Milasta, S., Pediani, J., Appelebe, S., Trim, S., Wyatt, M., Cox, P., Fidock, M., and Milligan, G. (2006) Mol. Pharmacol. 69, 479–491[Abstract/Free Full Text]
  17. Carrillo, J. J., López-Gimenez, J. F., and Milligan, G. (2004) Mol. Pharmacol. 66, 1123–1137[Abstract/Free Full Text]
  18. Mitchell, F. M., Mullaney, I., Godfrey, P. P., Arkinstall, S. J., Wakelam, M. J. O., and Milligan, G. (1991) FEBS Lett. 287, 171–174[CrossRef][Medline] [Order article via Infotrieve]
  19. Carrillo, J. J., Pediani, J., and Milligan, G. (2003) J. Biol. Chem. 278, 42578–42587[Abstract/Free Full Text]
  20. Pascal, G., and Milligan, G. (2005) Mol. Pharmacol. 68, 905–915[Abstract/Free Full Text]
  21. Takasaki, J., Saito, T., Taniguchi, M., Kawasaki, T., Moritani, Y., Hayashi, K., and Kobori, M. (2004) J. Biol. Chem. 279, 47438–47445[Abstract/Free Full Text]
  22. Stevens, P. A., Pediani, J., Carrillo, J. J., and Milligan, G. (2001) J. Biol. Chem. 276, 35883–35890[Abstract/Free Full Text]
  23. Tang, H., Guo, D. F., Porter, J. P., Wanaka, Y., and Inagami, T. (1998) Circ. Res. 82, 523–531[Abstract/Free Full Text]
  24. Smith, R. D., Hunyady, L., Olivares-Reyes, J. A., Mihalik, B., Jayadev, S., and Catt, K. J. (1998) Mol. Pharmacol. 54, 935–941[Abstract/Free Full Text]
  25. Qian, H., Pipolo, L., and Thomas W. G. (1999) Biochem. J. 343, 637–644
  26. Santos, R. A., Ferreira, A. J., Pinheiro, S. V., Sampaio, W. O., Touyz, R., and Campagnole-Santos, M. J. (2005) Expert Opin. Investig. Drugs 14, 1019–1031[CrossRef][Medline] [Order article via Infotrieve]
  27. Lee, D. K., Lanca, A. J., Cheng, R., Nguyen, T., Ji, X. D., Gobeil, F., Jr., Chemtob, S., George, S. R., and O'Dowd, B. F. (2004) J. Biol. Chem. 279, 7901–7908[Abstract/Free Full Text]
  28. Petaja-Repo, U. E., Hogue, M., Laperriere, A., Bhalla, S., Walker, P., and Bouvier, M. (2001) J. Biol. Chem. 276, 4416–4423[Abstract/Free Full Text]
  29. Pietila, E. M., Tuusa, J. T., Apaja, P. M., Aatsinki, J. T., Hakalahti, A. E., Rajaniemi, H. J., and Petaja-Repo, U. E. (2005) J. Biol. Chem. 280, 26622–26629[Abstract/Free Full Text]
  30. Werry, T. D., Wilkinson, G. F., and Willars, G. B. (2003) Biochem. J. 374, 281–296[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
N. J. Smith, L. A. Stoddart, N. M. Devine, L. Jenkins, and G. Milligan
The Action and Mode of Binding of Thiazolidinedione Ligands at Free Fatty Acid Receptor 1
J. Biol. Chem., June 26, 2009; 284(26): 17527 - 17539.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. L. Hansen, J. T. Hansen, T. Speerschneider, C. Lyngso, N. Erikstrup, E. S. Burstein, D. M. Weiner, T. Walther, N. Makita, T. Iiri, et al.
Lack of Evidence for AT1R/B2R Heterodimerization in COS-7, HEK293, and NIH3T3 Cells: HOW COMMON IS THE AT1R/B2R HETERODIMER?
J. Biol. Chem., January 16, 2009; 284(3): 1831 - 1839.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. A. Stoddart, N. J. Smith, L. Jenkins, A. J. Brown, and G. Milligan
Conserved Polar Residues in Transmembrane Domains V, VI, and VII of Free Fatty Acid Receptor 2 and Free Fatty Acid Receptor 3 Are Required for the Binding and Function of Short Chain Fatty Acids
J. Biol. Chem., November 21, 2008; 283(47): 32913 - 32924.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
J. F. Lopez-Gimenez, M. T. Vilaro, and G. Milligan
Morphine Desensitization, Internalization, and Down-Regulation of the {micro} Opioid Receptor Is Facilitated by Serotonin 5-Hydroxytryptamine2A Receptor Coactivation
Mol. Pharmacol., November 1, 2008; 74(5): 1278 - 1291.
[Abstract] [Full Text] [PDF]

Home page
 Exp PhysiolHome page
N. Alenina, P. Xu, B. Rentzsch, E. L. Patkin, and M. Bader
Genetically altered animal models for Mas and angiotensin-(1-7)
Exp Physiol, May 1, 2008; 93(5): 528 - 537.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Canals and G. Milligan
Constitutive Activity of the Cannabinoid CB1 Receptor Regulates the Function of Co-expressed Mu Opioid Receptors
J. Biol. Chem., April 25, 2008; 283(17): 11424 - 11434.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
L. A. Stoddart, A. J. Brown, and G. Milligan
Uncovering the Pharmacology of the G Protein-Coupled Receptor GPR40: High Apparent Constitutive Activity in Guanosine 5'-O-(3-[35S]thio)triphosphate Binding Studies Reflects Binding of an Endogenous Agonist
Mol. Pharmacol., April 1, 2007; 71(4): 994 - 1005.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Ellis, J. D. Pediani, M. Canals, S. Milasta, and G. Milligan
Orexin-1 Receptor-Cannabinoid CB1 Receptor Heterodimerization Results in Both Ligand-dependent and -independent Coordinated Alterations of Receptor Localization and Function
J. Biol. Chem., December 15, 2006; 281(50): 38812 - 38824.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
F. Francke, R. J. Ward, L. Jenkins, E. Kellett, D. Richter, G. Milligan, and D. Bachner
Interaction of Neurochondrin with the Melanin-concentrating Hormone Receptor 1 Interferes with G Protein-coupled Signal Transduction but Not Agonist-mediated Internalization
J. Biol. Chem., October 27, 2006; 281(43): 32496 - 32507.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/24/16757    most recent
M601121200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Canals, M.
Right arrow Articles by Milligan, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Canals, M.
Right arrow Articles by Milligan, G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement