JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M509907200 on April 18, 2006

J. Biol. Chem., Vol. 281, Issue 25, 16861-16869, June 23, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/25/16861    most recent
M509907200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakamura, M.
Right arrow Articles by Yamaguchi, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakamura, M.
Right arrow Articles by Yamaguchi, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Ubiquitin-like Protein MNSFbeta Regulates ERK-MAPK Cascade*

Morihiko Nakamura{ddagger}1 and Seiji Yamaguchi{ddagger}§

From the {ddagger}Department of Cooperative Medical Research, Collaboration Center, and the §Department of Pediatrics, Faculty of Medicine, Shimane University, Izumo 693-8501, Japan

Received for publication, September 8, 2005 , and in revised form, April 3, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
MNSFbeta is a ubiquitously expressed member of the ubiquitin-like family that has been implicated in various biological functions. Previous studies have demonstrated that MNSFbeta covalently binds to intracellular proapoptotic protein Bcl-G in mitogen-activated murine T cells. In this study, we further investigated the intracellular mechanism of action of MNSFbeta in macrophage cell line, Raw 264.7 cells. We present evidence that MNSFbeta·Bcl-G complex associates with ERKs in non-stimulated Raw 264.7. We found that MNSFbeta·Bcl-G directly bound to ERKs and inhibited ERK activation by MEK1. In Raw 264.7 cells treated with MNSFbeta small interfering RNA (siRNA) lipopolysaccharide (LPS)-induced ERK1/2 activation was enhanced and LPS-induced JNK and p38 activation was unaffected. SiRNA-mediated knockdown of MNSFbeta increased tumor necrosis factor {alpha} (TNF{alpha}) expression at mRNA and protein levels in LPS-stimulated Raw 264.7 cells. Finally, we found that transfection with MNSFbeta expression construct resulted in a significant inhibition of LPS-induced ERK activation and TNF{alpha} production. Co-transfection experiments with MNSFbeta and Bcl-G greatly enhanced this inhibition. Collectively, these findings indicate that MNSFbeta might be implicated in the macrophage response to LPS.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The covalent attachment of ubiquitin to proteins is an important cellular function that is required for protein degradation, DNA repair, cell cycle control, stress response, transcriptional regulation, signal transduction, and vesicular traffic (1–6). The attachment of a single ubiquitin polypeptide (monoubiquitination) is important for cellular regulation (7). Polyubiquitination targets proteins for destruction by the proteasome. Polyubiquitin chains are formed via isopeptide bond linkages between the C-terminal Gly-76 of ubiquitin and the side chain -NH2 from Lys-48 of another. In addition to ubiquitin, it is evident that several ubiquitin-like proteins have been found to be covalently or noncovalently attached to target proteins (8–12). Interestingly, small ubiquitin-like modifier 1 (SUMO-1)2 conjugation of I{kappa}B occurs on the same residues used for ubiquitination, thus making the protein resistant to proteasome-mediated degradation and consequently inhibiting NF{kappa}B activation (13).

Monoclonal nonspecific suppressor factor (MNSF), a lymphokine produced by murine T cell hybridoma, possesses pleiotrophic antigen-nonspecific suppressive functions (14). We have cloned a cDNA encoding a subunit of MNSF, which was termed MNSFbeta (15). MNSFbeta cDNA encodes a protein of 133 amino acids consisting of a ubiquitin-like protein (36% identity with ubiquitin) fused to the ribosomal protein S30. The ubiquitin-like moiety of MNSFbeta shows MNSF-like biologic activity without cytotoxic action (16). Interferon {gamma} (IFN{gamma}) is involved in the mechanism of action of MNSFbeta. We have demonstrated that Ubi-L specifically binds to cell surface receptors on mitogen-activated lymphocytes and the T helper type 2 clone, the D.10 cells (17).

We have also shown that MNSFbeta covalently conjugates to acceptor proteins and forms MNSFbeta adducts including 33.5-kDa protein in concanavalin A- and IFN{gamma}-stimulated D.10 cells (18). Recently, we found that this MNSFbeta adduct consists of 8.5-kDa ubiquitin-like protein and Bcl-2-like protein (19), murine orthologue of previously cloned human BCL-G gene product with proapoptotic function (20). The BCL-G gene is a proapoptotic p53 target gene (21). Murine Bcl-G mRNA was highly expressed in testis and significantly in spleen (19).

In this study, we investigated the intracellular mechanism of action of MNSFbeta in murine macrophage cell line, Raw 264.7 cells. We observed that MNSFbeta siRNA increased ERK activation and TNF{alpha} production by LPS-stimulated Raw 264.7 cells. We will show that the MNSFbeta is implicated in the regulation of the ERK-MAPK cascade.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Rabbit polyclonal antibodies to p38, ERK1, and JNK (SAPK) were purchased from Santa Cruz Biotechnology. Rabbit polyclonal antibodies to phospho-p38 and phospho-JNK were from Promega, and rabbit anti-phospho-ERK1/2 antibodies were from Sigma. Rabbit polyclonal antibodies to MNSFbeta and Bcl-G were prepared as described (15, 19). MNSFbeta·Bcl-G complex was prepared as described (19).

Immunoprecipitation—Immunoprecipitation was performed with a horseradish peroxidase-conjugated antibody that recognizes native rabbit IgG (TrueBlotTM, eBioscience, San Diego, CA) according to the manufacturer's instructions. RIPA buffer (50 mM Tris, 1% Nonidet P-40, 0.25% deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, pH 7.4, containing 1 µg/ml each of the protease inhibitors aprotinin, leupeptin, and pepstatin) extracts of Raw cells were precleared with 50 µl of anti-rabbit IgG beads for 1 h on ice. Subsequently, 5 µg of primary antibody to MNSFbeta or ERK1 was added to precleared lysates and incubated on ice for additional 1 h. Samples were then incubated overnight at 4°C with 50 µl of anti-rabbit IgG bead. The beads were washed with five times with RIPA buffer, and immunoprecipitates were released from the beads by 10 min boiling in NuPAGE LDS sample buffer (Invitrogen) buffer. Immunoblotting was carried out with anti-ERK1 or anti-Bcl-G antibody. A rabbit IgG TrueBlot was employed as a second antibody.

Western Blot Analysis—The protein concentrations of the cell lysates were determined by Bradford assay (Bio-Rad). Equal amounts of protein were loaded onto an SDS-polyacrylamide gel (10% acrylamide), resolved by electrophoresis, and transferred onto polyvinylidene fluoride membranes. The membrane was incubated overnight at 4°C in a Tris-buffered saline solution with 5% milk to block nonspecific binding sites. Membranes were incubated with the primary antibodies for a minimum of 2 h at room temperature in Tris-buffered saline with 0.1% Tween 20 (Tris/Tween). Horseradish peroxidase secondary antibodies were incubated for 1 h at room temperature in Tris/Tween with 5% milk. Labeled proteins were visualized by chemiluminescence according to the manufacturer's instructions (Amersham Biosciences).

In-gel Digestion and MALDI-TOF—The 33.5-kDa MNSFbeta adduct was purified to homogeneity from Raw cell extracts by a combination of ion exchange chromatography, anti-MNSFbeta affinity chromatography and hydroxylapatite chromatography as described previously (19). Ingel digestion and MALDI-TOF were performed as described (19). Briefly, silver-stained spots were cut out of the gels and digested with 5 µg/ml V8 protease (Sigma) in 25 mM ammonium bicarbonate. Peptide mass fingerprinting was performed using a PerkinElmer Life Sciences/PerSeptive Biosystems Voyager-DE-RP MALDI-TOF mass spectrometer. The resulting sets of peptide masses were then used to search the NCBI data base for potential matches.

GST Pulldown Assay—Purified MNSFbeta·Bcl-G (0.5 µg) was incubated with 2 µg of GST or GST-ERK2 bound to GSH-Sepharose (Amersham Biosciences) for 3 h at 4°C with rocking followed by extensive washing of complexes. Bound proteins were eluted by boiling in 2x Laemmli. MNSFbeta·Bcl-G complex was separated by SDS-PAGE and detected by immunoblotting with anti-MNSFbeta antibody. Peptide competition assay was performed by using synthetic peptides derived from ERK2 (residues 181–199, including a MEK dual phosphorylation site: FLTEYVATRWYRAPEIMLN; residues 318–338, C-teminal: SDEPIAEAPFKFDMELDDLPK). GST-ERK2 (2 µg) was immobilized on GSH-Sepharose and incubated with MNSFbeta·Bcl-G (0.5 µg) in the presence of 200 µM peptide.

Peptide Affinity Chromatography—For affinity chromatography on peptide columns, synthetic peptides described above were coupled to Hi-Trap N-hydroxysuccinimide-activated agarose columns (Amersham Biosciences). Purified MNSFbeta·Bcl-G was incubated with peptide columns, washed extensively, and eluted with 50 mM triethylamine, pH. 11. The eluates were neutralized with 100 mM Tris-HCl, pH 7.4, subjected to SDS-PAGE, and detected by immunoblotting with anti-MNSFbeta antibody.

Kinase Assay—To examine the effect of MNSFbeta·Bcl-G complex on ERK activation, MEK kinase assay was performed. Activated GST-MEK1 (Upstate Biotechnology) was incubated with unphosphorylated GST-ERK2 (Upstate Biotechnology) in the presence or absence of MNSFbeta·Bcl-G complex (0.5–2 µg) in a buffer containing 20 mM MOPS, pH 7.2, 5 mM EGTA, 10 µM sodium fluoride, 25 mM beta-glycerophosphate, 1 mM sodium vanadate, 500 µM ATP, 75 mM, for 30 min at 30°C. The reaction mixture was immunoblotted with using anti-phospho-ERK1/2 antibody.

Cell Culture, the siRNAs, and Transfection of Cells—The Raw 264.7 macrophage-like cell line (ATCC TIB-71) was cultured routinely in Dulbecco's modified Eagle's medium with 10% fetal bovine serum (FBS) and penicillin-streptomycin at 37°C and 5% CO2. SiRNA duplexes (siRNAs) were synthesized and purified by Qiagen, Inc. (Chatsworth, CA). The target sequences were as follows: MNSFbeta siRNA-332 (5'-CCCAAGGTGGCCAAACAGGAA-3'), MNSFbeta siRNA-437 (5'-CCACCCTGCCATGCTAATAAA-3'), Bcl-G siRNA (5'-AGCATAATGGTTGGTAATTAA-3'. Scramble siRNA directed against 5'-GGACTCGACGCAATGGCGTCA-3' was the negative control. Cells were treated with siRNA according to the instructions provided with the RNAiFectTM transfection reagent (Qiagen, Inc.). Raw 264.7 cells (1.2 x 105) were treated with 3 µg of siRNA in RPMI 1640 medium supplemented with 10% FBS in the presence of the RNAiFectTM transfection reagent. After a 48-h incubation at 37°C, the medium containing the mixture of RNAiFectTM and siRNA was replaced by Dulbecco's modified Eagle's medium that contained 10% FBS and cells were incubated for a further 24 h.


Figure 1
View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 1.
MNSFbeta·Bcl-G complex associates with ERKs. A, Raw cell extracts (500 µg) were immunoprecipitated (IP) with antibodies directed against MNSFbeta (lanes 1–3) or normal IgG (lane 4). Immunoprecipitates were analyzed by Western blot (WB) analysis with antibodies directed against ERK1 (lanes 1 and 4), JNK (lane 2), or p38 (lane 3). As a control, whole cell lysates were immunoblotted with antibodies directed against JNK and p38. The asterisk indicates the 33.5-kDa MNSFbeta adduct. B, Raw cell extracts (500 µg) were immunoprecipitated with antibodies directed against ERK1 (lanes 2–4) or normal IgG (lane 1). Immunoprecipitates were analyzed by Western blot analysis with antibodies directed against MNSFbeta (lanes 1 and 2), Bcl-G (lane 3), and ERK1 (lane 4). WCL, whole cell lysate. C, purified MNSFbeta adduct analyzed by SDS-PAGE and immunostained for protein. Lane 1, silver-stained; lane 2, immunostained with anti-MNSFbeta; lane 3, anti-Bcl-G. Mobilities of the 33.5-kDa MNSFbeta adduct and the molecular mass standards (kDa) are indicated to the right and left of the figure, respectively.

 
Reverse Transcription (RT)-PCR—RT-PCR was performed for 30 cycles as described previously (19). The PCR primers used to detect mRNA are as follows: MNSFbeta, CGCCCAGGAACTACACACC (sense) and GCCTGCTACTTCCAGAGTGG (antisense) (222 bp); Bcl-G, CCCAAGCTCTCCAGAACAAG (sense) and CTGAGCTCGGATCTCCTTTG (antisense) (213 bp). All short amplified PCR products were isolated and sequenced to verify their identity. PCR products were separated in 2% agarose gel electrophoresis and stained with ethidium bromide. In some experiments, signals were quantitated by densitometry and optical densities for MNSFbeta and Bcl-G were normalized to the corresponding values for glyceraldehyde-3-phosphate dehydrogenase.

Mutagenesis and Transfection—Mutant MNSFbeta (G76A) was generated by replacing the codon for glycine 76 with the codon for alanine by utilizing QuikChange site-directed mutagenesis (Stratagene). cDNAs encoding MNSFbeta and Bcl-G were subcloned into the vector pcDNA3.1(+) (Invitrogen Corp.). Transient DNA transfections were conducted using Lipofectamine Plus reagent (Invitrogen) with the protocol provided by the manufacturer and 8 µg of plasmid DNA per 6-well plate.

Quantification of Cytokines—Murine cytokines were measured using sandwich ELISA (R&D System, Minneapolis, MN). The lower limits of detection for the cytokines were TNF{alpha}, 10 pg/ml; RANTES (regulated on activation normal T cell expressed and secreted), 20 pg/ml.

Electrophoretic Mobility Shift Assay (EMSA)—Nuclear extracts were prepared following the methods of Dignam et al. (22). Protein-DNA complexes were detected using biotin end-labeled double-stranded DNA probes. The sequence for the NF{kappa}B site was: GGGGACTTTCCC. Oligonucleotides were labeled in a reaction using terminal deoxynucleotide transferase and biotin-14-dCTP (Pierce). The binding reaction was performed using the LightShift kit according to the manufacture's instructions (Pierce). The reaction products were separated on a 5% polyacrylamide gel in 0.5% Tris borate-EDTA, transferred onto a nylon membrane, and fixed on the membrane by UV cross-linking. The biotin-labeled probe was detected using chemiluminescence (LightShift kit; Pierce).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
MNSFbeta Complex Is Associated with ERKs—It has been reported that ubiquitin-like protein, ISG15, covalently binds to ERK1 (8). Thus, first we addressed whether MNSFbeta could associate with the MAPK family including ERK, JNK, and p38 MAPK. Cell lysates were prepared from non-stimulated Raw 264.7 cells and immunoprecipitated with antibodies directed against MNSFbeta, and associated proteins were analyzed by Western blot analysis by using anti-ERK1, anti-JNK, and anti-p38 antibodies. As shown in Fig. 1A, MNSFbeta associated with ERKs, but not with other members of the MAPK family, under non-stimulated conditions. It should be noted that anti-ERK1 polyclonal antibodies recognize both the 44-kDa ERK1 and the 42-kDa ERK2. Immunoprecipitation of cell lysates with normal IgG followed by Western blot analysis revealed no detectable association of ERKs, indicating the specificity of MNSFbeta with ERKs. In addition, converse immunoprecipitation with anti-ERK1 antibody and immunoblot analysis with anti-MNSFbeta antibody confirmed the association between ERKs and the MNSFbeta adduct (Fig. 1B). It should be pointed out that anti-MNSFbeta antibody does not recognize free 8.5-kDa MNSFbeta in murine T helper type 2 clone, D.10 cells (18). In Raw macrophages as well as D.10 cells, anti-MNSFbeta antibody recognized several bands including a band of 33.5-kDa protein (Fig. 1A). We have demonstrated that Bcl-G, a novel proapoptotic member of the Bcl-2 family, is post-translationally modified by MNSFbeta (19). Thus, it seemed likely that the 33.5-kDa MNSFbeta adduct was the MNSFbeta·Bcl-G complex. To determine this, we carried out Western blot analysis with anti-Bcl-G antibody. As depicted in Fig. 1B, antibody directed against Bcl-G reacted with the 33.5-kDa MNSFbeta adduct, indicative of the covalent interaction of MNSFbeta and Bcl-G as described (19). To confirm the interaction between MNSFbeta and Bcl-G in Raw cells, MALDI-TOF was performed. The 33.5-kDa MNSFbeta adduct was purified to homogeneity from Raw cell lysates by a combination of ion exchange chromatography, anti-MNSFbeta affinity chromatography, and hydroxylapatite chromatography as described (19). The purified MNSFbeta adduct was digested by V8 protease and subjected to MALDI-MS analysis. Table 1 shows the peptide masses of observed by MALDI-TOF mass fingerprinting of 33.5-kDa MNSFbeta adduct purified from Raw cells. The resulting sets of peptide masses were then used to search the NCBI data base for potential matches, confirming the MNSFbeta adduct as MNSFbeta·Bcl-G complex. MNSFbeta may conjugate to Bcl-G with a linkage between the C-terminal Gly-74 and Lys-110, as described (19). These results indicate that covalent MNSFbeta·Bcl-G complex can specifically associate with ERKs in unstimulated Raw macrophages.


View this table:
[in this window]
[in a new window]
  		TABLE 1
Assignments of peptide fragments from a Staphylococcus V8 protease digest of the 33.5-kDa MNSFbeta adduct

The 33.5-kDa MNSFbeta adduct was digested by V8 protease and subjected to MALDI-MS analysis. The data in the second column are the mass values obtained experimentally, whereas the results in the third column are those calculated from the V8 protease fragmentation of the gene products of Bcl-G and MNSFbeta. The fourth column indicates the number of the first and last amino acid of the identified Bcl-G and MNSFbeta peptides, whereas the fifth shows the corresponding amino acid sequences. The amino acid sequences derived from MNSFbeta are shown in italic.

 


Figure 2
View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 2.
A, MNSFbeta·Bcl-G directly associates with ERK and regulates its activity. GST pulldown assay: purified MNSFbeta·Bcl-G was incubated with GST or GST-ERK2 bound to GSH-Sepharose as described under "Experimental Procedures." Bound proteins were separated by SDS-PAGE and detected by immunoblotting with anti-MNSFbeta antibody (top panel). Western blot analysis for GST was performed to confirm equal loading of proteins (bottom panel). The peptide competition assay was carried out by using peptide for the MEK dual phosphorylation site of ERK2. The data represent one of three independent experiments yielding similar results. B, peptide affinity chromatography. For affinity chromatography on peptide columns, synthetic peptides derived from ERK2 were coupled to N-hydroxysuccinimide-activated agarose columns. MNSFbeta·Bcl-G was incubated with peptide columns, washed extensively, and eluted. The eluates were subjected to SDS-PAGE and detected by immunoblotting with anti-MNSFbeta antibody. The flow-through (FT) and elusion material (Elu) are indicated. Lane C, MNSFbeta·Bcl-G as a control. C, MEK kinase assay. Activated GST-MEK1 was incubated with unactivated GST-ERK2 in a kinase assay buffer. To evaluate the effect of MNSFbeta·Bcl-G complex on ERK activation, unphosphorylated GST-ERK2 was preincubated with the MNSFbeta adduct (0.5 and 2µg) for 1 h at 4°C prior to addition of activated GST-MEK1. The reaction mixture was immunoblotted with using anti-phospho-ERK1/2 antibody. The data represent one of three independent experiments that gave similar results.

 


Figure 3
View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 3.
MNSFbeta siRNA increases LPS-induced TNF{alpha} production. A, Raw cells were transfected with RNAiFectTM transfection reagent alone or siRNA directed against MNSFbeta, Bcl-G, or scramble siRNA. After 72 h of siRNA transfection, Raw cells were stimulated with 100 ng/ml LPS for 4 h. Then the concentration of TNF{alpha} in the supernatant was determined by ELISA as described under "Experimental Procedures." The data represent one of three independent experiments with similar results. Values are shown as the mean ± S.D. of triplicate samples. *, p < 0.05 versus untreated; **, p < 0.01. B, transfection experiments were performed as described above, although Raw cells were stimulated with LPS for 12 h. The concentration of RANTES in the supernatant was determined by ELISA. The data represent one of three independent experiments with similar results. Values are shown as the mean ± S.D. of triplicate samples. *, p < 0.05 versus untreated; **, p < 0.01. C, MNSFbeta and Bcl-G mRNA expression was analyzed by RT-PCR after treatment with siRNAs for 48 h. D, 33.5-kDa MNSFbeta·Bcl-G complex was determined by Western blot analysis with antibody directed against MNSFbeta after transfection with siRNAs for 72 h. The data represent one of three independent experiments with similar results. Lane 1, no siRNA; lane 2, scramble; lane 3, MNSFbeta; lane 4, Bcl-G. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

 
MNSFbeta·Bcl-G Directly Binds to ERK2—We next investigated the nature of the binding of MNSFbeta·Bcl-G to ERKs. Purified MNSFbeta·Bcl-G complex was incubated with GST or GST-ERK2 bound to GSH-Sepharose. The bead matrices were extensively washed before eluting bound proteins off of the bead matrices. MNSFbeta·Bcl-G complex was separated by SDS-PAGE and detected by immunoblotting with anti-MNSFbeta antibody. As shown in Fig. 2A, MNSFbeta·Bcl-G bound to GST-ERK2 but not to GST. Excess peptide for the MEK dual phosphorylation site of ERK2 inhibited 50–60% this association, compared with a control peptide (mapping at the C terminus of ERK2), indicating that MNSFbeta·Bcl-G might bind to near the phosphorylation site. To confirm these results, we carried out peptide affinity chromatography. MNSFbeta·Bcl-G was incubated with peptides derived from ERK2 immobilized on agarose columns. Bound and eluted MNSFbeta·Bcl-G was resolved by SDS-PAGE and immunoblotted with anti-MNSFbeta antibody. As can be seen in Fig. 2B, MNSFbeta·Bcl-G bound to a column of immobilized the competitive peptide but not of control peptide, albeit this binding was not complete.

MNSFbeta·Bcl-G Inhibits ERK Activation—To investigate whether ERK function is directly modified by MNSFbeta·Bcl-G, we carried out MEK kinase assay. GST-MEK1 activated with c-Raf was employed in this assay. Activated GST-MEK1 was incubated with unphosphorylated GST-ERK2 in the presence or absence of MNSFbeta·Bcl-G as described under "Experimental Procedures." The reaction mixture was immunoblotted with using anti-phospho-ERK1/2 antibody. As depicted in Fig. 2C, ERK activation by MEK1 was significantly inhibited in the presence of MNSFbeta·Bcl-G. These observations were consistent with the results of GST pulldown experiments showing that MNSFbeta·Bcl-G directly binds to near the phosphorylation site of ERKs (Fig. 2A).


Figure 4
View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 4.
MNSFbeta·Bcl-G association with ERK is decreased after LPS stimulation. Raw cells were treated with 100 ng/ml LPS for 5, 15, 45, or 90 min. Immunoprecipitation (IP) assays were performed with either anti-ERK1 antibody followed by Western blot (WB) analysis with either anti-MNSFbeta antibody (top panel) or anti-ERK1 antibody (middle panel). Immunoprecipitation assays were also performed with normal IgG followed by Western blot analysis with anti-MNSFbeta antibody (bottom panel).

 
MNSFbeta siRNA Increases LPS-stimulated TNF{alpha} Production by Raw Cells—It has been reported that ERK pathway is involved in the regulation of TNF{alpha} production (23–26). Because our data suggested that covalent MNSFbeta·Bcl-G complex affects ERK activation, it seemed likely that inhibition of MNSFbeta expression would result in increased or decreased TNF{alpha} synthesis. Raw cells were transfected with scramble siRNA or siRNA directed against MNSFbeta. After 72 h of siRNA transfection, Raw cells were stimulated with 100 ng/ml of LPS for 4 h. Then the concentration of TNF{alpha} in the supernatant was determined by ELISA. Production of the TNF{alpha} in LPS-stimulated Raw cells transfected with MNSFbeta siRNA-437 was significantly (over 2-fold) up-regulated, compared with the cells with scramble siRNA (Fig. 3A). RT-PCR analysis demonstrated that MNSFbeta siRNA-437, but not control scramble siRNA, specifically reduced the expression of MNSFbeta but not glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Fig. 3C). Western blot analysis demonstrated that MNSFbeta siRNA-437 reduced complex formation of MNSFbeta with Bcl-G (33.5-kDa MNSFbeta adduct) (Fig. 3D, lane 3). Like MNSFbeta siRNA, Bcl-G siRNA also inhibited the complex formation of MNSFbeta with Bcl-G (Fig. 3D, lane 4). We also determined whether Bcl-G siRNA would affect TNF{alpha} production by LPS-stimulated Raw cells. As can be seen in Fig. 3A, Bcl-G siRNA caused a significantly increased TNF{alpha} production, although the effect was less than that seen with MNSFbeta siRNA. We did not observe a synergistic effect of transfection with both siRNA. To explore the RNAi effect at the mRNA level, we performed RT-PCR on total RNA isolated from siRNA-transfected Raw cells. MNSFbeta siRNA-437 up-regulated 60% TNF{alpha} expression (data not shown). We also investigated whether MNSFbeta siRNA would affect RANTES, a member of C-C chemokine superfamily, production by LPS-stimulated Raw cells. MNSFbeta siRNA-437 caused a significantly increased RANTES production (Fig. 3B), indicative of the involvement of MNSFbeta in RANTES production by LPS-stimulated Raw cells.

MNSFbeta·Bcl-G Association with ERK Is Decreased in a LPS-dependent Manner—To determine whether the interaction of MNSFbeta·Bcl-G with ERK could be altered by treatment with LPS, Raw cells were stimulated with 100 ng/ml of LPS followed by immunoprecipitation with antibody against ERK1 or IgG and Western blot analysis to detect MNSFbeta·Bcl-G complex. The binding of MNSFbeta adduct with ERKs was decreased at both 15 and 45 min post-LPS stimulation (Fig. 4, upper panel). This blot was subsequently re-probed to ensure equal loading of ERKs from each condition (Fig. 4, middle panel). Control immunoprecipitates with normal rabbit IgG did not demonstrate an association of MNSFbeta adduct with ERKs (Fig. 4, bottom panel). Taken together, these results, which were seen in three independent experiments, demonstrated that LPS treatment results in decreased interaction of MNSFbeta·Bcl-G and ERKs.


Figure 5
View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 5.
MNSFbeta·Bcl-G inhibits LPS-induced ERK activation. Raw cells were transfected with either MNSFbeta siRNA-437 (right in each panel) or scramble (left in each panel) siRNA. After 72 h of siRNA transfection, Raw cells were treated with 100 ng/ml LPS in the indicated time course. A, the phospo-ERK1/2 (top panel) and total ERK1/2 (bottom panel) in the cell lysates were detected by Western blot. The intensity of the signals as determined by densitometric scanning is expressed as -fold change relative to that of the untreated cells. Values are given as mean ± S.D. (n = 4). A representative autoradiograph is shown. *, p < 0.05. B, levels of phosphorylated (top panel) and total (bottom panel) p38. Values are given as mean ± S.D. (n = 4). A representative autoradiograph is shown. *, p < 0.05 compared with cells treated for 10 min. C, the phospho-JNK (top panel) and total JNK (bottom panel) in the cell lysates were detected. Values are given as mean ± S.D. (n = 4). *, p < 0.05 versus cells treated for 10 min.

 
MNSFbeta Inhibits LPS-induced ERK Activation—LPS is known to activate three major MAPKs, ERK1/2, p38, and JNK, which play an important role in LPS-induced cellular effects. We determined whether MNSFbeta is involved in these pathway by treating cells with an MNSFbeta-specific siRNA. In Raw 264.7 cells, LPS-stimulated ERK1/2 phosphorylation peaked at 20 min after LPS stimulation and was detected slowly over 1 h (Fig. 5A). Phosphorylation of p38 and JNK also peaked at 20 min and returned quickly to basal levels (Fig. 5, B and C). In Raw 264.7 cells treated with MNSFbeta siRNA-437 LPS-induced ERK1/2 phosphorylation was enhanced (Fig. 5A), and LPS-induced p38 and JNK phosphorylation were unaffected (Fig. 5, B and C). LPS-induced phosphorylation of all three MAPKs was unaffected in cells transfected with control siRNA. Taken together with the results of protein interaction experiments (Fig. 2), MNSFbeta may mediate negative regulation of the ERK-MAPK cascade.


Figure 6
View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 6.
Co-transfection of MNSFbeta and Bcl-G down-regulates LPS-induced ERK activation and TNF{alpha} production. A, Raw cells were transfected with MNSFbeta and mutant MNSFbeta (G74A) together with or without Bcl-G. Forty-eight h after transfection, cells were stimulated with 100 ng/ml LPS, and then the concentration of TNF{alpha} in the supernatant was identified by ELISA. Values are mean ± S.D. of four independent experiments carried out in triplicate. *, p < 0.01 versus untreated control (vector alone). B, Raw cells were transfected with Bcl-G together with either MNSFbeta or MNSFbeta (G74A). Forty-eight h after transfection, cell lysates were immunoprecipitated with anti-Bcl-G antibody and were analyzed by Western blot analysis with antibody directed against MNSFbeta. Lane 1, Raw cells transfected with vector alone; lane 2, transfected with Bcl-G together with MNSFbeta; lane 3, Bcl-G together with MNSFbeta (G74A). C, Raw cells were transfected with MNSFbeta together with Bcl-G. Forty-eight h after transfection, cells were stimulated with 100 ng/ml LPS, and then the phospo-ERK1/2 and total ERK1/2 in the cell lysates were detected by Western blot. The intensity of the signals as determined by densitometric scanning is expressed as -fold change relative to that of the untreated cells. Open bars represent vehicle-treated control cell. Closed bars represent transfected cells. Values are given as mean ± S.D. (n = 3). A representative autoradiograph is shown. *, p < 0.05 compared with transfected cells.

 
MNSFbeta Inhibits LPS-induced TNF{alpha} Production—The role of MNSFbeta in regulating LPS-induced TNF{alpha} production was addressed in transfection studies. As can be seen in Fig. 6A, transfection with pcDNA3.1-MNSFbeta resulted in a significant inhibition of LPS-induced TNF{alpha} production. In contrast to MNSFbeta, Bcl-G alone did not show any inhibitory effect. However, co-transfection with MNSFbeta and Bcl-G greatly decreased the TNF{alpha} production. Unlike co-transfection with wild-type MNSFbeta, co-transfection of a mutant MNSFbeta (G74A) and Bcl-G did not result in a decrease in the TNF{alpha} production. These results suggest that Bcl-G may enhance and/or stabilize the inhibitory activity of MNSFbeta by complex formation. Further supporting this idea is the observation that overexpression of mutant MNSFbeta (G74A) fails to form a MNSFbeta·Bcl-G complex (Fig. 6B, lane 3). We also determined whether ERK activation is affected by transfection with pcDNA3.1-MNSFbeta. Raw cells co-transfected with MNSFbeta and Bcl-G significantly decreased the ERK1/2 phosphorylation at 20–40 min (Fig. 6C). These results are in good accordance with findings by siRNA experiments (Fig. 5).


Figure 7
View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 7.
MNSFbeta siRNA slightly enhances LPS-induced NF{kappa}B activation. Raw cells were transfected with either MNSFbeta siRNA-437 or scramble siRNA. After 72 h of siRNA transfection, Raw cells were treated with 100 ng/ml LPS for 60 min. EMSAs were performed with a consensus NF{kappa}B probe in the presence or absence of 100x excess of unlabeled competitor. A representative blot is shown in the upper panel. The means ± S.D. of six experiments are shown in the bottom panel.*, p < 0.05 versus control (LPS plus scramble).

 
MNSFbeta Inhibits LPS-induced NF{kappa}B Activation—NF{kappa}B is involved in the LPS signaling cascade leading to TNF{alpha} production. Gel shift assay was performed to determine whether MNSFbeta is relevant to LPS-induced NF{kappa}B activation. Raw cells were transfected with either siRNA directed against MNSFbeta or scramble siRNA. After 72 h of siRNA transfection, Raw cells were treated with 100 ng/ml LPS for 60 min. Then EMSA was performed as described under "Experimental Procedures." NF{kappa}B activation in LPS-stimulated Raw cells transfected with MNSFbeta siRNA-437 was slightly enhanced, compared with the cells with scramble siRNA (Fig. 7). We also examined whether Bcl-G siRNA could affect LPS-induced NF{kappa}B activation in Raw cells. Bcl-G siRNA treatment did not affect NF{kappa}B activation induced by LPS (Fig. 7).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
LPS induces the signaling pathways leading to the activation of the mitogen-activated protein kinases, including ERK1/2, JNK, and p38 (27–29). LPS-induced ERK activation is required for the expression of TNF{alpha}, a potent proinflammatory cytokine, in Raw cells (23, 25, 26). In this study, we present data that the MNSFbeta regulates LPS-mediated ERK activity in Raw cells. First, MNSFbeta siRNA increases LPS-stimulated TNF{alpha} and RANTES production (Fig. 3). Second, MNSFbeta siRNA up-regulates LPS-mediated ERK activation (Fig. 5). Third, transfection with MNSFbeta expression construct significantly decreased ERK1/2 phosphorylation and TNF{alpha} production (Fig. 6). These results suggest that MNSFbeta functions as a negative regulator of the MAPK pathway likely by down-regulating ERK activity following LPS treatment.

We have previously demonstrated that Bcl-G, a novel proapoptotic member of Bcl-2 family, is covalently modified by MNSFbeta in concanavalin A-stimulated D.10 G4.1 cells, a murine T helper clone type 2 (19). In this study, we showed that MNSFbeta covalently binds to Bcl-G in unstimulated Raw 264.7 macrophage cell line. Thus, the mechanism of modification of Bcl-G by MNSFbeta may differ in each cell type. We also demonstrated that MNSFbeta conjugates to Bcl-G with a linkage between the C-terminal Gly-74 and Lys-110 as previously described in D.10 cells (19). We presented data showing that this isopeptide bond is important for MNSFbeta·Bcl-G interaction in Raw cells (Fig. 6).

We showed that MNSFbeta·Bcl-G directly binds to ERK inhibiting ERK phosphorylation by MEK (Figs. 1 and 2). This association is decreased in a LPS-dependent manner (Fig. 4). Interestingly, blocking peptide for the phosphorylation site on ERK2 inhibited this association, suggesting that this phosphorylation site is critical for the association with the MNSFbeta adduct (Fig. 2). It cannot be ruled out that another molecule(s) might be implicated in the complex formation in vivo. This is an intriguing possibility that needs to be carefully addressed experimentally. Shin et al. (30) mentioned that the p21-activated kinase 2 (PAK2) directly binds to ERKs. The formation of a multimeric complex consisting of ERK/PAK2/PAK-interacting exchange factor (PIX) is required for fibroblast growth factor-induced neurite outgrowth (30). In addition, complex formation among ERK, 14-3-3{epsilon}, and heat shock factor 1 during stress is evident (31).

We presented the evidence that the MNSFbeta adduct directly regulates ERK activation (Fig. 2). It should be pointed out that MNSFbeta is an aggregable polypeptide (14, 15). Even recombinant MNSFbeta has a tendency to form aggregation (15). Thus, it might be inferred that Bcl-G functions as a stabilizer of this aggregable polypeptide. Indeed, knock-down experiments using Bcl-G siRNA showed a significant increased TNF{alpha} production (Fig. 3). In addition, transfection experiments using a point mutation showed that covalent interaction between MNSFbeta and Bcl-G enhances the inhibitory activity (Fig. 6). Interestingly, ubiquitin-related BAG-1 (Bcl-2-associated athanogene-1) interacts with anti-apoptotic protein, Bcl-2, and enhances the anti-apoptotic activity of Bcl-2 (32). Thus, it is possible that MNSFbeta may regulate the pro-apoptotic protein, Bcl-G. We are currently investigating whether MNSFbeta is involved in the mechanism of apoptosis.

Like MNSFbeta, other ubiquitin-like proteins are also implicated in MAPK pathway. The ubiquitin-related BAG-1 described above binds to and activates the kinase Raf-1 (33). Modification of Smad4 with the ubiquitin-like protein SUMO-1 is enhanced by TGFbeta-induced activation of the p38 MAP kinase pathway (34). Recently, Malakhov et al. (8) demonstrated that ubiquitin-like protein ISG15 modifies three key regulators of signal transduction, phospholipase C{gamma}1, Jak1, and ERK1. ISG15 conjugates to these target proteins via an isopeptide bond in a manner similar to ubiquitin and other ubiquitin-like proteins. In contrast to ISG15, MNSFbeta non-covalently binds to ERK. In addition, MNSFbeta failed to bind to Jak1 (data not shown). It might be inferred that ubiquitin-like proteins are differentially involved in the regulation of the ERK-MAPK cascade. Interestingly, MNSFbeta, ISG15, and FAT10, a ubiquitin-like protein involved in apoptosis, are induced by IFN{gamma} (16, 35–38).

It is well known that NF{kappa}B and MAPK signaling proteins are activated by LPS. Many reports have demonstrated that inhibition of both NF{kappa}B and ERK-MAPK signaling affects LPS-mediated TNF{alpha} production in Raw cells (23, 25, 26). In this study, we demonstrated that MNSFbeta affects ERK-MAPK cascade rather than NF{kappa}B signaling (Figs. 5, 6, 7). However, we observed that MNSFbeta siRNA was effective in suppressing LPS-induced NF{kappa}B activation, albeit its effect was weak. To clarify the role of MNSFbeta in LPS-induced NF{kappa}B activation, careful experiments must be carried out.


   FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed. Tel.: 81-853-20-2916; Fax: 81-853-20-2913; E-mail: nkmr0515{at}med.shimane-u.ac.jp.

2 The abbreviations used are: SUMO-1, small ubiquitin-like modifier 1; MNSF, monoclonal nonspecific suppressor factor; RANTES, the regulated on activation normal T cell expressed and secreted; siRNA, small interfering RNA; PAK2, p21-activated kinase 2; IFN, interferon; TNF, tumor necrosis factor; LPS, lipopolysaccharide; ERK, extracellular signal-regulated kinase; JNK, c-Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; SAPK, stress-activated protein kinase; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; GST, glutathione S-transferase; MOPS, 4-morpholinepropanesulfonic acid; FBS, fetal bovine serum; RNAi, RNA interference. Back


   ACKNOWLEDGMENTS
 
thank S. Omura for skillful technical assistance.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Jentsch, S., McGrath, J. P., and Varshavsky, A. (1987) Nature 329, 131–134[CrossRef][Medline] [Order article via Infotrieve]
  2. Skowyra, D., Koepp, D. M., Kamura, T., Conrad, M. N., Conaway. R. C., Conaway, J. W., Elledge, S. J., and Harper, J. W. (1999) Science 284, 662–665[Abstract/Free Full Text]
  3. Pickart, C. M. (2001) Annu. Rev. Biochem. 70, 503–533[CrossRef][Medline] [Order article via Infotrieve]
  4. Weissman, A. M. (2001) Nat. Rev. Mol. Cell. Biol. 2, 169–178[CrossRef][Medline] [Order article via Infotrieve]
  5. Hicke, L., and Dunn, R. (2003) Annu. Rev. Cell Dev. Biol. 19, 141–172[CrossRef][Medline] [Order article via Infotrieve]
  6. Passmore, L. A., and Barford, D. (2004) Biochem. J. 379, 513–525[CrossRef][Medline] [Order article via Infotrieve]
  7. Hicke, L. (2001) Nat. Rev. Mol. Cell. Biol. 2, 195–201[CrossRef][Medline] [Order article via Infotrieve]
  8. Malakhov, M. P., Keun Il Kim, K. I., Malakhova, O. A., Jacobs, B. S., Borden, E. C., and Zhang, D. E. (2003) J. Biol. Chem. 278, 16608–16613[Abstract/Free Full Text]
  9. Raasi, S., Schmidtke, G., and Groettrup, M. (2001) J. Biol. Chem. 276, 35334–35343[Abstract/Free Full Text]
  10. Hemelaar, J., Lelyveld, V. S., Benedikt, M. Kessler, B. M., and Ploegh, H. L. (2003) J. Biol. Chem. 278, 51841–51850[Abstract/Free Full Text]
  11. Marx. J. (2005) Science 307, 836–839[Abstract/Free Full Text]
  12. Mahajan, R., Delphin, C., Guan, T., Gerace, L., and Melchior, F. (1997) Cell 88, 97–107[CrossRef][Medline] [Order article via Infotrieve]
  13. Desterro, J. M. P., Rodriguez, M. S., and Hay, R. T. (1998) Mol. Cell 2, 233–239[CrossRef][Medline] [Order article via Infotrieve]
  14. Nakamura, M., Ogawa, H., and Tsunematsu, T. (1986) J. Immunol. 136, 2904–2909[Abstract]
  15. Nakamura, M., Xavier, R. M., Tsunematsu, T., and Tanigawa, Y. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 3463–3467[Abstract/Free Full Text]
  16. Nakamura, M., Xavier, R. M., and Tanigawa, Y. (1996) J. Immunol. 156, 532–538[Abstract]
  17. Nakamura, M., and Tanigawa, Y. (1999) J. Biol. Chem. 274, 18026–18032[Abstract/Free Full Text]
  18. Nakamura, M., and Tanigawa, Y. (1998) Biochem. J. 330, 683–688[Medline] [Order article via Infotrieve]
  19. Nakamura, M., and Tanigawa, Y. (2003) Eur. J. Biochem. 270, 4052–4058[Medline] [Order article via Infotrieve]
  20. Guo, B., Godzik, A., and Reed, J. C. (2001) J. Biol. Chem. 276, 2780–2785[Abstract/Free Full Text]
  21. Miled, C., Pontoglio, M., Garbay. S., Yaniv, M., and Weitzman, J. B. (2005) Cancer Res. 65, 5096–5104[Abstract/Free Full Text]
  22. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475–1489[Abstract/Free Full Text]
  23. Schröder, N. W. J., Pfeil, D., Opitz, B., Michelsen, K. S., Amberger, J., Zähringer, U., Göbel, U. B., and Schumann, R. R. (2001) J. Biol. Chem. 276, 9713–9719[Abstract/Free Full Text]
  24. Dumitru, C. D., Ceci, J. D., Tsatsanis, C., Kontoyiannis, D., Stamatakis, K., Lin, J. H., Patriotis, C., Jenkins, N. A., Copeland, N. G., Kollias, G., and Tsichlis, P. N. (2000) Cell 103, 1071–1083[CrossRef][Medline] [Order article via Infotrieve]
  25. Shi, L., Kishore, R., McMullen, M. R., and Nagy, L. E. (2002) Am. J. Physiol. 282, C1205–C1211
  26. Fu, S. L., Hsu, Y. H., Lee, P. Y., Hou, W. C., Hung, L. C., Lin, C. H., Chen, C. M., Huang, Y. J. (2006) Biochem. Biophys. Res. Commun. 339, 137–144[Medline] [Order article via Infotrieve]
  27. Han, J., Lee, J. D., Bibbs, L., and Ulevitch, R. J. (1994) Science 265, 808–811[Abstract/Free Full Text]
  28. Hambleton, J., Weinstein, S. L., Lem, L., and DeFranco, A. L. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 2774–2778[Abstract/Free Full Text]
  29. Lee, J. C., Laydon, J. T., McDonnell, P. C., Gallagher, T. F., Kumar, S., Green, D., McNulty, D., Blumenthal, M. J., Heys, J. R., Landvatter, S. W., Strickler, J. E., McLaughlin, M. M., Siemens, I. R., Fisher, S. M., Livi, G. P., White, J. R., Adams, J. L., and Young, P. R. (1994) Nature 372, 739–746[CrossRef][Medline] [Order article via Infotrieve]
  30. Shin, E. Y., Shin, K. S., Lee, C. S., Woo, K. N., Quan, S. H., Soung, N. K., Kim, Y. G., Cha, C. I., Kim, S. R., Park, D., Bokoch, G. M., and Kim, E. G. (2002) J. Biol. Chem. 277, 44417–44430[Abstract/Free Full Text]
  31. Wang, X., Grammatikakis, N., Siganou, A., Stevenson, M. A., and Calderwood, S. K. (2004) J. Biol. Chem. 279, 49460–49469[Abstract/Free Full Text]
  32. Takayama, S., Sato, T., Krajewski, S., Kochel, K., Irie, S., Millan, J. A., and Reed, J. C. (1995) Cell 80, 279–284[CrossRef][Medline] [Order article via Infotrieve]
  33. Wang, H.-G., Takayama, S., Rapp, U. R., and Reed, J. C. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7063–7068[Abstract/Free Full Text]
  34. Ohshima, T., and Shimotohno, K. (2003) J. Biol. Chem. 278, 50833–50842[Abstract/Free Full Text]
  35. Loeb, K. R., and Haas, A. L. (1994) Mol. Cell. Biol. 14, 8408–8419[Abstract/Free Full Text]
  36. Malakhova, O., Malakhov, M., Hetherington, C., and Zhang, D. E. (2002) J. Biol. Chem. 277, 14703–14711[Abstract/Free Full Text]
  37. Liu, Y., Pan, J., Zhang, C., Fan, W., Collinge, M., Bender, J. R., and Weissman, S. M. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 4313–4318[Abstract/Free Full Text]
  38. Raasi, S., Schmidtke, G., Giuli, R. D., and Groettrup, M. (1999) Eur. J. Immunol. 29, 4030–4036[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Circ. Res.Home page
J. Herrmann, L. O. Lerman, and A. Lerman
Ubiquitin and Ubiquitin-Like Proteins in Protein Regulation
Circ. Res., May 11, 2007; 100(9): 1276 - 1291.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/25/16861    most recent
M509907200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakamura, M.
Right arrow Articles by Yamaguchi, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation