HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 281, Issue 25, 17054-17060, June 23, 2006

This Article Abstract Full Text (PDF) All Versions of this Article: 281/25/17054    most recent M603042200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Paone, G. Articles by Moss, J. Search for Related Content PubMed PubMed Citation Articles by Paone, G. Articles by Moss, J. Social Bookmarking                      What's this?

ADP-ribosyltransferase-specific Modification of Human Neutrophil Peptide-1^*

Gregorino Paone¹², Linda A. Stevens¹, Rodney L. Levine, Christelle Bourgeois³, Wendy K. Steagall, Bernadette R. Gochuico, and Joel Moss⁴

From the Pulmonary-Critical Care Medicine Branch and Laboratory of Biochemistry, NHLBI, National Institutes of Health, Bethesda, Maryland 20892-1590

Received for publication, March 30, 2006

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Epithelial cells lining human airways and cells recruited to airways participate in the innate immune response in part by releasing human neutrophil peptides (HNP). Arginine-specific ADP-ribosyltransferases (ART) on the surface of these cells can catalyze the transfer of ADP-ribose from NAD to proteins. We reported that ART1, a mammalian ADP-ribosyltransferase, present in epithelial cells lining the human airway, modified HNP-1, altering its function. ADP-ribosylated HNP-1 was identified in bronchoalveolar lavage fluid (BALF) from patients with asthma, idiopathic pulmonary fibrosis, or a history of smoking (and having two common polymorphic forms of ART1 that differ in activity), but not in normal volunteers or patients with lymphangioleiomyomatosis. Modified HNP-1 was not found in the sputum of cystic fibrosis patients or in leukocyte granules of normal volunteers. The finding of ADP-ribosyl-HNP-1 in BALF but not in leukocyte granules suggests that the modification occurred in the airway. Most of the HNP-1 in the BALF from individuals with a history of smoking was, in fact, mono- or di-ADP-ribosylated. ART1 synthesized in Escherichia coli, glycosylphosphatidylinositol-anchored ART1 released with phosphatidylinositol-specific phospholipase C from transfected NMU cells, or ART1 expressed endogenously on C2C12 myotubes modified arginine 14 on HNP-1 with a secondary site on arginine 24. ADP-ribosylation of HNP-1 by ART1 was substantially greater than that by ART3, ART4, ART5, Pseudomonas aeruginosa exoenzyme S, or cholera toxin A subunit. Mouse ART2, which is an NAD:arginine ADP-ribosyltransferase, was able to modify HNP-1, but to a lesser extent than ART1. Although HNP-1 was not modified to a significant degree by ART5, it inhibited ART5 as well as ART1 activities. Human -defensin-1 (HBD1) was a poor transferase substrate. Reduction of the cysteine-rich defensins enhanced their ability to serve as ADP-ribose acceptors. We conclude that ADP-ribosylation of HNP-1 appears to be primarily an activity of ART1 and occurs in inflammatory conditions and disease.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Inflammatory cells, such as neutrophils, are recruited to the airway of patients with chronic lung disorders (1, 2). Protein mediators of innate immunity, such as defensins, are produced by these cells and epithelial cells lining the airway. Defensins constitute over 5% of the protein content of neutrophils (3) and are the major component of azurophilic granules; degranulation may be responsible for the increased defensin amount found in airway inflammation. Neutrophils and defensins have been found in airways of patients with cystic fibrosis, ₁-antitrypsin deficiency, and other inflammatory lung diseases. Increased numbers of neutrophils were found in the airway of patients with asthma (4, 5).

-Defensins (human neutrophil peptide 1–4) are members of a family of low molecular weight, multifunctional cationic peptides. Defensins have 29 to 35 amino acids, are arginine-rich, and contain three disulfide bridges. They are antimicrobial for Gram-negative and Gram-positive bacteria, fungi, and enveloped viruses, cytotoxic for epithelial cells, and chemotactic for T cells. They induce cytokine production, and modulate cell proliferation (6). HNP⁵-1, -2, and -3 are reported to have antiviral activity against human immunodeficiency virus-1 and adenovirus (7, 8) and HNP-1 was shown to inhibit lethal factor, an important component of anthrax toxin (9).

Mono-ADP-ribosylation, in which the ADP-ribose moiety of NAD is transferred to a protein substrate, is catalyzed by amino acid-specific ADP-ribosyltransferases (ARTs) (10). This post-translational modification occurs in viruses, bacterial, and eukaryotic cells. Most ARTs also have NAD glycohydrolase activity, generating free ADP-ribose from NAD. The best studied ADP-ribosylation reactions are those catalyzed by certain bacterial toxins, in particular, cholera toxin, which, in many cells, transfers ADP-ribose to an arginine residue in the guanine nucleotide-binding protein, G_s (11). Like cholera toxin, mammalian ADP-ribosyltransferases catalyze arginine-specific transferase reactions, but specific cellular substrates differ.

In mammalian cells, the known ADP-ribosyltransferases share less than 10% sequence identity, but are structurally similar in their catalytic sites. Only ART1, -3, -4, and -5 have been identified in the human genome and they exhibit restricted tissue distributions (12). Human ART1 has a polymorphism in codon 302, resulting in isoforms that differ in their capacity to ADP-ribosylate membrane-associated proteins (13). ART1, -3, and -4 appear to be glycosylphosphatidylinositol (GPI)-anchored, whereas ART5, expressed in lymphocytes, lacks the carboxyl-terminal signal sequence for addition of a GPI anchor and is predicted to be secreted (14). Both ART1 and ART5 are arginine-specific transferases.

HNP-1 is a substrate for ART. ADP-ribosylation altered its biological properties assayed in vitro, decreasing cytotoxic and antimicrobial activity while maintaining its function as a T-cell chemoattractant and stimulant of interleukin-8 release from epithelial cells (15). Consistent with a biological role for this modification, ADP-ribosylated HNP-1 was found in bronchoalveolar lavage fluid (BALF) of some, but not all smokers, possibly related to expression of an ART1 polymorphism. Epithelial cells in human airways as well as other immune response participants, e.g. polymorphonuclear leukocytes and lymphocytes, express different ARTs including ART1, -3, and -4 (16, 17). Conceivably, ARTs found on airway epithelial and leukocytes surfaces could modify the arginine-rich defensins released from polymorphonuclear leukocytes and epithelial cells in response to lung inflammation and affect anti-microbial activity.

We investigated whether modification of HNP-1 was specific for ART1 and whether free ADP-ribose generated by NAD glycohydrolase activity of ARTs might react with the cationic defensin in vitro. To determine whether the modified form of HNP-1 occurs in vivo, HNP was isolated and analyzed for modifications from the BALF of patients with several pulmonary diseases. Moreover, to assess a potential regulatory effect of HNP-1 concentration on transferase activity, we investigated the effect of HNP-1 on ART1 and -5 activities.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Preparation of ART1, ART3, ART4, ART5, ART2.2, and CTA1—Rabbit ART1 (rART1) and mouse ART5 (mART5) were synthesized in Escherichia coli and purified as described (15, 18). Briefly, ART1, cloned from a rabbit skeletal muscle cDNA library by PCR, and mouse lymphocyte ART5 cDNAs, were subcloned into a pFLAG-MAC (Sigma) expression vector and used to transform E. coli BL-21(DE3) competent cells (Novagen). Cells were sonified, centrifuged, and purified on anti-FLAG M2 affinity gels (Sigma) according to the manufacturer's instructions. ART2.2 cDNA was inserted into pCMV-Neo vector (Clontech, Palo Alto, CA) and the protein was expressed as a GPI-linked protein on the surface of COS1 cells. Protein was collected following treatment of intact cells with phosphatidylinositol-specific phospholipase C (PI-PLC) as described (19). Mouse ART1 (mART1) or mART4 (20) open reading frames were subcloned in pMH vector and the hemagglutinin tag sequence (TACCCATACGACGTCCCAGACTACGCT) was inserted in-frame at the amino terminus of the protein sequence using the QuikChange site-directed mutagenesis kit (Stratagene). NMU cells (rat adenocarcinoma cells) were transfected with vector constructs of mART1, or mART4 using the Lipofectamine Plus Reagent (Invitrogen) according to manufacturer's instructions. Transfected cells were selected with Geneticin (G418; Invitrogen), 0.5 mg/ml. NMU cells expressing mART4 or mART1 were incubated for 1 h with 0.05 units of PI-PLC (ICN) in 0.3 ml of Dulbecco's phosphate-buffered saline. Cells were sedimented (1000 x g) and the supernatant containing PI-PLC-released protein was collected. pGex-2T vector containing the ART3 cDNA was transfected into E. coli BL21. Protein expression was induced with isopropyl 1-thio--D-galactopyranoside and the glutathione S-transferase fusion protein was purified on a glutathione-Sepharose 4B column according to the manufacturer's instructions (Amersham Biosciences). ART2b and Pseudomonas aeruginosa exoenzyme S ADP-ribosyltransferase (transferase domain) and its activator, FAS (factor activating exoenzyme S), were gifts from Dr. Rita Bortell (University of Massachusetts Medical Center, Worcester, MA) and Dr. Joseph Barbieri (Medical College of Wisconsin, Milwaukee, WI), respectively. Reduced and alkylated cholera toxin A1 subunit, the catalytic component of cholera toxin (CTA, List Biological Laboratories, Campbell CA), was prepared and purified as described (21).

ADP-ribosyltransferase Assay—Activities of rART1, mART1, mART5, ART2.2, exoenzyme S, or CTA were assayed by monitoring transfer of ADP-ribose to agmatine (ADP-ribosyltransferase activity: ART1, CTA, ART2.2, auto-ADP-ribosylated-ART5) or the formation of nicotinamide from NAD (NAD glycohydrolase activity, ART5, ART2b) as described (11, 22). mART4 protein expression was determined by Western blot analysis using anti-hemagglutinin peroxidase antibody (clone BMG-3F10, rat IgG, Roche). mART4 was quantified by comparing the immunoreactivity of mART4 and mART1 (ChemiImager, Alpha, Innotech Corp.). Purified ART3 was quantified by comparison to Coomassie-stained bovine serum albumin after SDS-PAGE separation. Modification of HNP-1 was determined by incubation overnight (17 h) at 30 °C with rART1, mART1, auto-ADP-ribosylated-ART5 synthesized in E. coli, alkylated CTA1 or mART4 (25-fold the immunoreactivity of mART1), synthetic HNP-1 (Bachem, Torrance, CA), and NAD as indicated in the figure legends. ART3 (20 ng), exoenzyme S (transferase domain, 100 nM, 10 nmol activity) with FAS (factor activating exoenzyme S) (100 nM), ART2b (4 nmol activity), or ART2.2 (4 nmol activity) were incubated with 5 nmol of HNP-1 and 5 mM NAD in 50 mM phosphate buffer, pH 7.5, 150 µl at 30 °C overnight followed by HPLC separation of the products. To determine the extent of modification, the results were compared with the same reaction conditions with ART1 (4 nmol) incubated with HNP-1 (5 nmol) and 5 mM NAD. In preparation for RP-HPLC, guanidine HCl was added to a final concentration of 6 M. The mixture was applied to a Vydac C18 HPLC column (Nest Group, Southboro, MA) or a Discovery BioWide Pore C18 HPLC column (Supelco, Bellefonte, PA), equilibrated with HPLC-grade water, 0.1% trifluoroacetic acid (solution A). Reaction products were separated by gradient elution, flow = 0.8 ml/min. Solution A for 20 min was followed by a linear gradient for 60 min of 0 to 60% solution B (100% isopropyl alcohol, 0.2% trifluoroacetic acid), then 95% solution B, for 25 min. Separation was monitored by absorbance at 210, 258, and 280 nm. Fractions were analyzed by MALDI-MS (Ciphergen, Biosystem). Products of NAD glycohydrolase reactions were isolated by HPLC anion exchange separation using a DuPont SAX column (4.6 x 250 mm, Thomson Instruments, Clear Brook, VA) by gradient elution. Solution A (20 mM sodium phosphate, pH 4.5), for 30 min, was followed by a linear gradient for 10 min to 100% solution B (solution A + 1.0 M NaCl), followed by 10 min at 100% B, flow = 1.0 ml/min.

MS Analysis of ADP-ribosylated HNP-1—MALDI-TOF mass spectrometry and HPLC electrospray mass spectrometric mapping of ADP-ribosylation sites were performed as described (15).

Cell Culture—C2C12 (mouse skeletal muscle) cells were grown in Dulbecco's modified Eagle's medium with 10% fetal bovine serum at 37 °C in 5% CO₂. COS1 cells were grown in Dulbecco's modified Eagle's medium, 55 µM 2-mercaptoethanol, 10% fetal bovine serum, with 0.45/mg/ml Geneticin (G-418, Invitrogen Inc.). Rat mammary adenocarcinoma cells (NMU) transfected with plasmids containing mART1, or mART4 cDNA were grown at 37 °C, 5% CO₂ in Eagle's minimal essential medium (Invitrogen) with 10% fetal bovine serum (Invitrogen) with 0.5 mg/ml G-418. All cells were supplied by American Type Culture Collection (Manassas, VA).

Isolation of ADP-ribosyl-HNP-1 from Human BALF—Clinical protocols were approved by the NHLBI, National Institutes of Health Institutional Review Board. Written informed consent was obtained for all subjects. Proteins from 10-ml samples of BALF (cells: 127 ± 15 x 10⁶) from 20 cigarette smokers (protocol 95-H-167) were prepared as described (15) before separation by RP-HPLC. Seven samples had HNP-1. Peaks (absorbance at 210 nm) corresponding to HNP-1 and ADP-ribosyl-HNP-1 were analyzed by MALDI-MS. HNP from 8 ml of BALF from patients with biopsy-proven idiopathic pulmonary fibrosis (protocol 99-H-0068), asthma (protocol 99-H-0076), lymphangioleiomyomatosis (protocol 95-H-0186), and normal volunteers (protocol 96-H-0100) was prepared for MS analysis without separation by RP-HPLC. HNP-1 was quantified by MS analysis from normal volunteers with a history of smoking (protocol 95-H-0167) without RP-HPLC separation.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
To determine the modification state of HNP-1 in patients with airway diseases, HNP-1 was isolated from the BALF of patients with pulmonary disease, e.g. lymphangioleiomyomatosis, idiopathic pulmonary fibrosis, and asthma, and compared with HNP isolated from BALF of smokers and leukocyte granules of normal volunteers as reported (Table 1) (15). BALF from normal volunteers did not contain HNP-1 (data not shown). In isolated HNPs, HNP-1 was the isoform present at the highest concentration; little or no HNP-2 or -3 was detected. In idiopathic pulmonary fibrosis and asthma BALF, both mono- and di-modified HNP-1 were identified suggesting that, in these patients, neutrophils were recruited to the airway where the released defensin could come in contact with epithelial cells expressing an arginine-specific ADP-ribosyltransferase. HNP was also isolated from leukocyte granules (four patients), but modified forms were not identified, consistent with the modification of HNP-1 occurring after its release from neutrophils. The extent of modification of HNP-1 was determined in individuals with a history of smoking. BALF was purified by Sep-Pak C₁₈ and then analyzed by mass spectroscopy. Most of the HNP-1 was either mono- or di-ADP-ribosylated, based on recovery assessed with controls containing ART1-modified HNP-1 (Table 2). Sputum from cystic fibrosis patients had been reported to contain defensins at a concentration of 0.3–1.6 mg/ml (23). ADP-ribosylated HNP was not detected in HNP isolated from cystic fibrosis sputum. The absence of ADP-ribosylated HNP-1 in cystic fibrosis sputum could be because of the inhibition of ADP-ribosyltransferase activity by the high concentrations of chloride and sodium ions in cystic fibrosis airway surface liquid (24). A concentration as high as 225 mM NaCl, did not, however, inhibit ADP-ribosylation of HNP-1 by ART1 in vitro (data not shown). Alternatively, HNP-1 could be cytotoxic to the epithelial cells expressing ART1 or perhaps prevented from contact with cell-associated ART1 due to the bacterial biofilm.

ADP-ribosylated HNP-1 was not formed in the presence of NADP, consistent with an ART1 preference for NAD as substrate (Figs. 1 and 2a). HNP-1 is a basic protein containing multiple lysine and arginine residues. ADP-ribose can react non-enzymatically with lysine (27) and ARTs are known to exhibit NAD glycohydrolase activity, which produces ADP-ribose. Free ADP-ribose did not react with HNP-1, consistent with the conclusion that the modification of HNP-1 by ART1 was not due to the non-enzymatic addition of ADP-ribose generated by ART NAD glycohydrolase activity (Figs. 1 and 2b).

View larger version (15K): [in this window] [in a new window]   FIGURE 1. RP-HPLC separation of reaction products from the incubation of HNP-1 with mono-ADP-ribosyltransferases. a, C2C12 cells were grown in Dulbecco's modified Eagle's medium to 2 x 103 cells/cm2. On day 6, intact differentiated cells (exhibiting myotube formation) that have mART1 (0.24 nmol/h/100-mm culture dish) on the surface were washed twice with Dulbecco's phosphate-buffered saline and incubated with HNP-1 (10 µg) and 2 mM NAD for 1 h at 37°C before collection of medium for analysis. b, HNP-1 (2 µg) was incubated with recombinant rART1 (1.0 nmol/h) synthesized in E. coli, and 1 mM NAD in 200 µl. c, HNP-1 (10 µg) was incubated with 5 mM NAD and recombinant mART1 (0.74 nmol/h) (synthesized in NMU cells), in 150 µl. d, undifferentiated C2C12 cells that lack mART1 were washed twice with Dulbecco's phosphate-buffered saline and incubated as above. e, auto-ADP-ribosylated ART5 (1.8 nmol/h) synthesized in E. coli; f, alkylated CTA1 (0.74 nmol/h); or g, recombinant mART4 (expression determined by Western blot) was incubated at 30 °C with 2 µg of HNP-1 and 3 mM NAD in 150 µl. mART1 (4 nmol/h) (synthesized in NMU cells) was incubated with HNP-1 (5µg) and either 5 mM NADP (Fig. 2a) or ADP-ribose (Fig. 2b) in place of NAD. Reactions in 50 mM potassium phosphate, pH 7.5, with enzyme, were incubated overnight (except where noted) at 30 °C, and were terminated by adding guanidine HCl to the medium or reaction mixture at a concentration of 6 M, before separation by HPLC. Activity of the transferases was determined by quantifying ADP-ribosylation of agmatine. Reaction mixture HPLC analysis at a wavelength of 210 nm is described under "Materials and Methods." • indicates unmodified HNP-1; *, mono-ADP-ribosylated-HNP-1; and , di-ADP-ribosylated-HNP-1; see text for details. Data are representative of at least two experiments.

View larger version (22K): [in this window] [in a new window]   FIGURE 2. Modification of defensin. a, effect of HNP-1 or agmatine on nicotinamide release from NAD catalyzed by ART1. mART1 (3.6 nmol/h) synthesized in NMU cells was incubated with 0.1 mM [nicotinamide-U-14C]NAD (0.05 µCi), in 50 mM potassium phosphate, pH 7.5, for 1.5 h at 30 °C, with the indicated concentrations of agmatine (•) or HNP-1 () in 150 µl. Two samples (50 µl) were applied to Dowex AG1-X2 (Bio-Rad) columns and [14C]nicotinamide was eluted with 5 ml of water for liquid scintillation counting as described (34). Data are mean ± S.D. of values from three experiments (agmatine) or one-half the ranges of two experiments (HNP-1). b, time course modification of HNP-1. mART1 (24.5 nmol/h) and HNP-1 (1.5 nmol) were incubated with 5 mM NAD in 50 mm potassium phosphate, pH 7.5, at 30 °C for the indicated times. The reactions were stopped by the addition of guanidine HCl and subjected to HPLC as described under "Materials and Methods." Amounts of mono-ADP-ribosylated-HNP-1 () or di-ADP-ribosylated-HNP1 (•) were calculated from the area under the absorbance peak at 210 nm. Data are representative of those from two experiments. c, ADP-ribosylation of HNP-1 and HBD1 by ART1 and ART5. mART1 (4 nmol/h) or mART5 (4 nmol/h) were incubated with HNP-1 (1 nmol) or HBD1 (1 nmol), as indicated, in 50 mM potassium phosphate, pH 7.5, 10 µM [adenylate-32P]NAD (1 µCi/assay), and 100 µM ADP-ribose in 100 µl at 30 °C for 1 h, followed by 5 mM NAD overnight. After trichloroacetic acid precipitation, the proteins were separated on 16% Tricine gels (Invitrogen). The gels were stained with Coomassie Blue, dried, and exposed to x-ray film (BioMax, Kodak). Data shown are representative of two experiments.

The catalytic activity of ART5 in the presence of NAD and HNP-1 was evaluated by monitoring the production of ADP-ribose and ADP-ribosyl-agmatine, as well as automodification of ART5. Addition of HNP-1 dramatically reduced both NAD:agmatine ADP-ribosyltransferase (Fig. 3a) and NAD glycohydrolase activities (Fig. 3b). HNP-1 also reduced automodification of ART5 (Fig. 3c). As had been reported (18), ART5 is primarily a NAD glycohydrolase; automodification decreases that activity by over 90%, whereas ADP-ribosyltransferase activity approximately doubles. Thus, automodification converts ART5 from an NAD glycohydrolase to an ADP-ribosyltransferase. HNP-1, by inhibiting automodification, prevents ART5 from exhibiting transferase activity. Because HNP-1 is released by neutrophils at sites of inflammation and because HNP-1 represents greater than 5% of neutrophil protein and more than 30–50% of azurophilic granule content (5), its local concentration following neutrophil degranulation may be sufficient to inhibit ART5 and ART1 activities. ART1 transferase is apparently inhibited directly, whereas with inhibition of automodification ART5 remains a NAD glycohydrolase.

View larger version (34K): [in this window] [in a new window]   FIGURE 3. a and b, effect of HNP-1 on the ADP-ribosyltransferase and NAD glycohydrolase activities of ART5. FLAG purified mART5 (0.55 nmol/h ADP-ribosyltransferase activity) was incubated with 0.1 mM [adenine-U-14C]NAD (0.05 µCi) in 50 mM potassium phosphate, pH 7.5, in 150 µl for 1 h at 30°C, with or without 20 mM agmatine at the indicated concentrations of HNP-1. a, ADP-ribosylagmatine formation was determined by separation on AG1-A2 columns as described under "Materials and Methods." b, ADP-ribose formation was determined by strong anion exchange HPLC separation of reaction products, as described under "Materials and Methods." Data are the mean ± S.D. of three (ADP-ribose formed) or average of two (ADP-ribosylagmatine formation) experiments. c, effect of HNP-1 on the auto-ADP-ribosylation of ART5. Purified FLAG-mART5 (5.5 nmol/h) was auto-ADP-ribosylated by incubation at 30 °C for 1 h in 50 mM potassium phosphate, pH 7.5, 10 µM [adenylate-32P]NAD (1 µCi/assay), 0.1 mM ADP-ribose followed by 5 mM unlabeled NAD overnight with the indicated concentrations of HNP-1. Proteins were trichloroacetic acid-precipitated, separated by SDS-PAGE, and transferred to nitrocellulose for autoradiography (c-1) and Western blotting (c-2). Nitrocellulose was reacted with anti-FLAG M2 monoclonal antibody diluted to 0.1 µg/ml in 0.05% phosphate-buffered saline, 0.2% Tween 20, I-Block (Tropix) overnight and reactivity was detected by chemiluminescence. Data are representative of two experiments. d, effect of reduction on the ADP-ribosylation of HNP-1 by ART1, ART5, and CTA. mART1 (4 nmol/h), purified FLAG-ART5 (4 nmol/h), or CTA (4 nmol/h) were incubated with HNP-1 (1 nmol) with or without 20 mM dithiothreitol as described in the legend to Fig. 2c. After trichloroacetic acid precipitation, the proteins were separated in 16% Tricine gels and stained with Coomassie Blue. Dried gel was exposed to x-ray film (BioMax, Kodak). Data are representative of two experiments.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
ADP-ribosylation of HNP-1 is ART specific. HNP-1 is a substrate for ART1, a transferase known to be expressed by airway epithelial cells; it was not ADP-ribosylated by ART3, -4, and -5, cholera toxin, and P. aeruginosa exoenzyme S, two bacterial NAD:arginine ADP-ribosyltransferases. ART2 is an enzyme not found in humans. The mouse isoform, NAD:arginine ADP-ribosyltransferase, was able to modify HNP-1, but at a fraction of that observed with ART1; the rat isoform, an NAD glycohydrolase, was not active. Modification of HNP-1 occurred with both the solubilized ART1 released from cells with PI-PLC and ART1 attached through its GPI anchor to the surface of differentiated C2C12 myotubes. Moreover, we showed that at high concentrations of HNP-1, likely to be present in sites of inflammation, the transferase activity of ART1 was inhibited and the formation of modified HNP-1 reduced. ART3 and -4, which are also present in lung epithelium, did not modify defensins; neither recombinant protein has detectable NAD: arginine ADP-ribosyltransferase activity under ART1 assay conditions; specific transferase activities of ART3 and ART4 might be demonstrated with other substrates.

In contrast, ART5, which is predicted to be secreted, had been shown to modify arginine in proteins, and that activity was enhanced by auto-ADP-ribosylation. As we show here, auto-ADP-ribosylation and generation of the transferase form of ART5, were suppressed by HNP-1. Even under conditions that promote ART5 transferase activity (e.g. high NAD concentrations), however, HNP-1 was not significantly modified. In this regard, another ADP-ribosyltransferase that modifies arginine residues, the bacterial product, cholera toxin, did not modify HNP-1, suggesting that the arginine-specific ADP-ribosyltransferases in vitro are substrate specific.

Amino acid target specificity of ART1 was observed in its preferential modification of arginine 14 in mono-ADP-ribosyl-HNP-1 and with a secondary site on arginine 24 in di-modified HNP-1. Both forms were isolated from airways of patients with diseases associated with inflammation, including pulmonary fibrosis and asthma as well as smokers (Tables 1 and 2). Thus, the modification appears to occur in vivo, where ART1 has been found on epithelial cells lining the airway and could be in position to use defensin as a substrate. The two other arginine residues in HNP-1 were not significantly modified in vitro. The extent of modification was constrained by the structure of the defensin, because reduction of disulfide bonds enhanced both the rate and number of modifications. Given the fact that HNP-1 is lysine-rich, we were concerned that the modification could be nonenzymatic, resulting from the covalent association of free ADP-ribose, generated through the NAD glycohydrolase activity of ART1, with the -amino groups of lysine. However, in studies where ADP-ribose was incubated with HNP-1, non-enzymatic covalent modification was not observed. These studies point to an arginine-specific enzymatic modification of HNP-1 by ART-1, not by other ARTs. Based on our observations, the ADP-ribosylation reactions appear to be specific for ART family members, for different substrates, and the ADP-ribose donor.

Epithelial cells that line the airway have a critical role in the innate immune response. They respond to pathogens by changing surface receptors, releasing cytokines, and altering regulation of key genes (29, 30). They not only provide a mucosal barrier but also produce antimicrobial peptides and recruit phagocytic cells (29). High concentrations of neutrophil defensins accumulate in airways of patients as part of the inflammatory response and may interact with airway epithelium (31, 32). -Defensins exhibit lectin-like behavior and may bind to glycoproteins on epithelial cell surfaces (33). Such an interaction might facilitate the association of ART1 and its substrate. How these cells regulate ADP-ribosylation and modification of defensin activities may affect the inflammatory response in the airway.

It is well known that defensins have a variety of activities including chemoattractant and antimicrobial actions at low concentrations to induction of interleukin-8 release and cytotoxicity at high concentrations. They may contribute to both epithelial cell damage and proliferation. Cell lysis may be a source of extracellular NAD as a substrate for the ADP-ribosyltransferases expressed on the epithelial surface. Of importance, ADP-ribosylation of HNP-1 alters its functional properties, which could have a regulatory role. As reported here, HNP-1 may affect transferase activity and thus regulate its own modification.

	FOOTNOTES

 
^* This work was supported by the Intramural Research Program, National Institutes of Health, NHLBI. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ Both authors contributed equally to this work.

² Present address: Don Gnocchi Foundation, Rome, Italy.

³ Present address: Dept. of Medical Biochemistry, Medical University of Vienna, 1030 Vienna, Austria.

⁴ To whom correspondence should be addressed. Tel.: 301-496-1597; Fax: 301-496-2363; E-mail: mossj{at}nhlbi.nih.gov.

⁵ The abbreviations used are: HNP, human neutrophil peptide; rART1, recombinant rabbit ADP-ribosyltransferase-1; mART1, recombinant mouse ADP-ribosyltransferase-1; hART1, human ADP-ribosyltransferase-1; HBD, human -defensin; ARTs, ADP-ribosyl-transferases; CTA, cholera toxin A subunit; NMU, rat mammary adenocarcinoma; NADase, NAD glycohydrolase; MALDI, matrix-assisted laser desorption ionization; MS, mass spectrometry; PI-PLC, phosphatidylinositol-specific phospholipase C; BALF, bronchoalveolar lavage fluid; GPI, glycosylphosphatidylinositol; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine; RP-HPLC, reverse phase-high performance liquid chromatography.

	ACKNOWLEDGMENTS

 
We thank Dr. Stewart Levine for providing BALF from asthma patients and Ruth Litzenberger for the cystic fibrosis sputum samples. We thank Dr. Joseph Barbieri for the generous gift of exoenzyme S and Factor Activating Exoenzyme S and Dr. Rita Bortell for ART2b. We thank Dr. Martha Vaughan and Dr. Vincent C. Manganiello for useful discussions and critical review of the manuscript. We also thank the LAM Foundation and the Tuberous Sclerosis Alliance for patient referrals.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Aarbiou, J., Ertmann, M., van Wetering, S., van Noort, P., Rook, D., Rabe, K. F., Litvinov, S. V., van Krieken, J. H., de Boer, W. I., and Hiemstra, P. S. (2002) J. Leukocyte Biol. 72, 167–174[Abstract/Free Full Text]
2. van Wetering, S., Sterk, P. J., Rabe, K. F., and Hiemstra, P. S. (1999) J. Allergy Clin. Immunol. 104, 1131–1138[CrossRef][Medline] [Order article via Infotrieve]
3. Rice, W. G., Ganz, T., Kinkade, J. M., Jr., Selsted, M. E., Lehrer, R. I., and Parmley, R. T. (1987) Blood 70, 757–765[Abstract/Free Full Text]
4. Ordonez, C. L., Shaughnessy, T. E., Matthay, M. A., and Fahy, J. V. (2000) Am. J. Respir. Crit. Care Med. 161, 1185–1190[Abstract/Free Full Text]
5. Spencer, L. T., Paone, G., Krein, P. M., Rouhani, F. N., Rivera-Nieves, J., and Brantly, M. L. (2004) Am. J. Physiol. 286, L514–L520[Abstract/Free Full Text]
6. Ganz, T. (2003) Nat. Rev. Immunol. 3, 710–720[CrossRef][Medline] [Order article via Infotrieve]
7. Chang, T. L., Vargas, J. J., Delportillo, A., and Klotman, M. E. (2005) J. Clin. Investig. 115, 765–773[CrossRef][Medline] [Order article via Infotrieve]
8. Bastian, A., and Schafer, H. (2001) Regul. Pept. 101, 157–161[CrossRef][Medline] [Order article via Infotrieve]
9. Kim, C., Gajendran, N., Mittrucker, H. W., Weiwad, M., Song, Y. H., Hurwitz, R., Wilmanns, M., Fischer, G., and Kaufmann, S. H. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 4830–4835[Abstract/Free Full Text]
10. Moss, J., Balducci, E., Cavanaugh, E., Kim, H. J., Konczalik, P., Lesma, E. A., Okazaki, I. J., Park, M., Shoemaker, M., Stevens, L. A., and Zolkiewska, A. (1999) Mol. Cell. Biochem. 193, 109–113[CrossRef][Medline] [Order article via Infotrieve]
11. Tsai, S. C., Noda, M., Adamik, R., Moss, J., and Vaughan, M. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 5139–5142[Abstract/Free Full Text]
12. Glowacki, G., Braren, R., Firner, K., Nissen, M., Kuhl, M., Reche, P., Bazan, F., Cetkovic-Cvrlje, M., Leiter, E., Haag, F., and Koch-Nolte, F. (2002) Protein Sci. 11, 1657–1670[CrossRef][Medline] [Order article via Infotrieve]
13. Yadollahi-Farsani, M., Kefalas, P., Saxty, B. A., and MacDermot, J. (1999) Eur. J. Biochem. 262, 342–348[Medline] [Order article via Infotrieve]
14. Okazaki, I. J., Kim, H. J., and Moss, J. (1996) J. Biol. Chem. 271, 22052–22057[Abstract/Free Full Text]
15. Paone, G., Wada, A., Stevens, L. A., Matin, A., Hirayama, T., Levine, R. L., and Moss, J. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 8231–8235[Abstract/Free Full Text]
16. Balducci, E., Horiba, K., Usuki, J., Park, M., Ferrans, V. J., and Moss, J. (1999) Am. J. Respir. Cell Mol. Biol. 21, 337–346[Abstract/Free Full Text]
17. Kefalas, P., Saxty, B., Yadollahi-Farsani, M., and MacDermot, J. (1999) Eur. J. Biochem. 259, 866–871[Medline] [Order article via Infotrieve]
18. Weng, B., Thompson, W. C., Kim, H. J., Levine, R. L., and Moss, J. (1999) J. Biol. Chem. 274, 31797–31803[Abstract/Free Full Text]
19. Kanaitsuka, T., Bortell, R., Stevens, L. A., Moss, J., Sardinha, D., Rajan, T. V., Zipris, D., Mordes, J. P., Greiner, D. L., and Rossini, A. A. (1997) J. Immunol. 159, 2741–2749[Abstract]
20. Koch-Nolte, F., Haag, F., Braren, R., Kuhl, M., Hoovers, J., Balasubramanian, S., Bazan, F., and Thiele, H. G. (1997) Genomics 39, 370–376[CrossRef][Medline] [Order article via Infotrieve]
21. Noda, M., Tsai, S. C., Adamik, R., Moss, J., and Vaughan, M. (1990) Biochim. Biophys. Acta 1034, 195–199[Medline] [Order article via Infotrieve]
22. Stevens, L. A., Bourgeois, C., Bortell, R., and Moss, J. (2003) J. Biol. Chem. 278, 19591–19596[Abstract/Free Full Text]
23. Soong, L. B., Ganz, T., Ellison, A., and Caughey, G. H. (1997) Inflamm. Res. 46, 98–102[CrossRef][Medline] [Order article via Infotrieve]
24. Smith, J. J., Travis, S. M., Greenberg, E. P., and Welsh, M. J. (1996) Cell 85, 229–236[CrossRef][Medline] [Order article via Infotrieve]
25. Zolkiewska, A., Thompson, W. C., and Moss, J. (1998) Exp. Cell Res. 240, 86–94[Medline] [Order article via Infotrieve]
26. Zolkiewska, A., and Moss, J. (1993) J. Biol. Chem. 268, 25273–25276[Abstract/Free Full Text]
27. Cervantes-Laurean, D., Minter, D. E., Jacobson, E. L., and Jacobson, M. K. (1993) Biochemistry 32, 1528–1534[CrossRef][Medline] [Order article via Infotrieve]
28. Singh, P. K., Jia, H. P., Wiles, K., Hesselberth, J., Liu, L., Conway, B. A., Greenberg, E. P., Valore, E. V., Welsh, M. J., Ganz, T., Tack, B. F., and McCray, P. B., Jr. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 14961–14966[Abstract/Free Full Text]
29. Diamond, G., Legarda, D., and Ryan, L. K. (2000) Immunol. Rev. 173, 27–38[CrossRef][Medline] [Order article via Infotrieve]
30. van Wetering, S., Mannesse-Lazeroms, S. P., Van Sterkenburg, M. A., Daha, M. R., Dijkman, J. H., and Hiemstra, P. S. (1997) Am. J. Physiol. 272, L888–L896[Abstract/Free Full Text]
31. Hiemstra, P. S. (2001) Pediatr. Respir. Rev. 2, 306–310
32. Bals, R. (2000) Respir. Res. 1, 141–150[CrossRef][Medline] [Order article via Infotrieve]
33. Wang, W., Owen, S. M., Rudolph, D. L., Cole, A. M., Hong, T., Waring, A. J., Lal, R. B., and Lehrer, R. I. (2004) J. Immunol. 173, 515–520[Abstract/Free Full Text]
34. Moss, J., Manganiello, V. C., and Vaughan, M. (1976) Proc. Natl. Acad. Sci. U. S. A. 73, 4424–4427[Abstract/Free Full Text]
35. Harwig, S. S., Ganz, T., and Lehrer, R. I. (1994) Methods Enzymol. 236, 160–172[Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				T. Nakano, Y. Matsushima-Hibiya, M. Yamamoto, S. Enomoto, Y. Matsumoto, Y. Totsuka, M. Watanabe, T. Sugimura, and K. Wakabayashi Purification and molecular cloning of a DNA ADP-ribosylating protein, CARP-1, from the edible clam Meretrix lamarckii PNAS, September 12, 2006; 103(37): 13652 - 13657. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 281/25/17054    most recent M603042200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Paone, G. Articles by Moss, J. Search for Related Content PubMed PubMed Citation Articles by Paone, G. Articles by Moss, J. Social Bookmarking                      What's this?