|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 281, Issue 25, 17228-17237, June 23, 2006
A Truncated P2X7 Receptor Variant (P2X7-j) Endogenously Expressed in Cervical Cancer Cells Antagonizes the Full-length P2X7 Receptor through Hetero-oligomerization* 1 1![]() ![]() ¶||2
From the
Received for publication, March 29, 2006 , and in revised form, April 18, 2006.
A truncated naturally occurring variant of the human receptor P2X7 was identified in cancer cervical cells. The novel protein (P2X7-j), a polypeptide of 258 amino acids, lacks the entire intracellular carboxyl terminus, the second transmembrane domain, and the distal third of the extracellular loop of the full-length P2X7 receptor. The P2X7-j was expressed in the plasma membrane; it showed diminished ligand-binding and channel function capacities and failed to form pores and mediate apoptosis in response to treatment with the P2X7 receptor agonist benzoyl-ATP. The P2X7-j interacted with the full-length P2X7 in a manner suggesting heterooligomerization and blocked the P2X7-mediated actions. Interestingly, P2X7-j immunoreactivity and mRNA expression were similar in lysates of human cancer and normal cervical tissues, but fulllength P2X7 immunoreactivity and mRNA expression were higher in normal than in cancer tissues, and cancer tissues lacked 205-kDa P2X7 immunoreactivity suggesting lack of P2X7 homo(tri)-oligomerization. These results identify a novel P2X7 variant with apoptosis-inhibitory actions, and demonstrate a distinct regulatory property for a truncated variant to antagonize its full-length counterpart through hetero-oligomerization. This may represent a general paradigm for regulation of a protein function by its variant.
The receptor P2X7 belongs to the P2X subfamily of P2 nucleotide receptors (1, 2), which are membrane-bound, ligand-operated channels (3-5). ATP is the naturally occurring ligand for the P2X7 and activation of the receptor by brief exposure to extracellular ATP opens cation channels that allow Ca2+, Na+, and K+ influx (6). Longer exposure to ATP allows passage of cations with progressively larger diameters, up to 900 Da, through formation of pores (7). The mechanism of pore formation is unclear, and opinions vary between decreased filter selectivity of existing channels (8) to rearrangement of receptor molecules (9). P2X7 receptors function in a cell-specific manner and effects of receptor activation are determined by receptor expression (10), trafficking and plasma membrane localization (11-13), oligomerization (5), and post-activation internalization, recycling, and degradation (14). Expression of P2X7 can be regulated hormonally; in human cervical epithelial cells epinephrine down-regulates expression of the glycosylated form of the P2X7 and increases receptor degradation, and the effects can be potentiated by epidermal growth factor (15). Evidence for the physiological role of the P2X7 comes from studies of P2X7-deficient mice, indicating its role in inflammatory (16) and immune processes (17). Epithelial cells of the female lower reproductive tract express the P2X7 (18), and in human cervical epithelial cells ligand binding induces apoptosis by a mechanism that involves pore formation, augmented calcium influx, and calcium-dependent activation of the apoptotic mitochondrial pathway (19, 20). Because human cervical epithelial cells secrete ATP into the extracellular milieu at concentrations that suffice to induce P2X7 pores (19), it was proposed that growth of cervical cells in vivo is controlled by autocrine-paracrine P2X7-mediated apoptosis (14, 15, 19, 20). Cervical neoplasia is a common disease in women. Although most cases are detected and managed at an early stage of development, an estimated 13,000 women progress to invasive cancer and about 4000 women die annually of the disease in the United States (21). Until recently little was known about the role of the P2X7 system in human cancer cervical cells. ATP and the P2X7-specific agonist 2',3'-O-(4-benzoylbenzoyl)-adenosine 5'-triphosphate (BzATP)3 can induce apoptosis in both normal and cancer cervical cells. However, the effects are greater in normal than in cancer cells (19), suggesting that cancer cervical cells have evolved mechanisms that protect them from P2X7-mediated apoptosis. Understanding these phenomena is important because mechanisms that block apoptosis could provide growth advantage to cells and enhance the growth of cancers.
The present paper reports our discovery of a novel variant of the human P2X7 (P2X7-j) that lacks the entire intracellular carboxyl terminus, the second transmembrane domain, and the distal third of the extracellular loop of the P2X7. This variant was deficient in ligand binding, but interacted with the full-length P2X7 and blocked P2X7-mediated channel activity. Because pore formation depends on oligomerization of P2X7 molecules (22), the present results suggest that the P2X7-j variant hetero-oligomerizes with the full-length P2X7 to form nonfunctional P2X7 oligomers that do not mediate P2X7-dependent apoptosis. Because in cancer cervical cells the P2X7-j is co-expressed with the wild-type P2X7 (present results), it is hypothesized that co-expression of the P2X7-j could lead to defective apoptosis and enhance the growth of the cancer cervical cells.
Reagents, Cells, and Human TissuesAll chemicals, unless specified otherwise, were obtained from Sigma. The following types of cells were used (all from ATCC): human cervical epithelial cancer CaSki, HeLa, SiHa, and HT3 cells; MDCK (Madin-Darby canine kidney cells, strain II); and HEK293 (human embryonic kidney 293 cells). MDCK cells were cultured in minimal essential medium containing Earle's salts and supplemented with 5% fetal bovine serum, 100 units/ml penicillin, and 100 µg/ml streptomycin. Cell culture conditions for the other types of cells were described (19). Discarded human uterine cervical tissues from women undergoing hysterectomy for indications unrelated to the present study were obtained according to IRB protocols 12-03-50 and 03-90-300 from the Human Tissue Procurement Facility of University Hospitals of Cleveland and the Comprehensive Cancer Center Tissue Procurement Core Facility (CTPC), Case Western Reserve University, Cleveland, OH; and from the Cooperative Human Tissue Network (CHTN) (National Cancer Institute) through the Human Tissue Resource Network (HTRN), Department of Pathology at the Ohio State University, Columbus, OH. Upon removal, tissues were washed in cold saline, snap frozen in liquid N2, transferred in liquid N2, or shipped on dry ice to the laboratory and stored at -80 °C until assayed. The present experiments utilized a total of three histologically normal human uterine cervical tissues and three tissues designated histologically as squamous cell carcinomas of the cervix. The histological diagnoses were assigned by the Departments of Pathology at University Hospitals of Cleveland or at Ohio State University. All six tissues were from premenopausal women ages 44-49. For assays, cultured cells were lysed as described (14). Tissues (about 30 mg) were minced using mortar and pestle in liquid nitrogen, and lysed in ice-cold lysis buffer (phosphate-buffered saline plus 1% Triton X-100 and protease inhibitors (Halt Protease Inhibitor Mixture Kit, Pierce). Protein quantification was performed using the Bio-Rad Protein Assay (Bio-Rad). Samples were mixed with 2 x SDS sample buffer, boiled at 100 °C for 5 min, and stored at -80 °C. Molecular Biology Techniques and TransfectionsTotal RNA extracted from CaSki cells using the RNeasy Mini kit (Qiagen, Valencia, CA) was used for RT-PCR using the RT-PCR kit (Invitrogen Corp.) to amplify the human P2X7 gene (Ref. 23, GenBankTM accession number Y09561 [GenBank] ). Oligo(dT) primer was used for the RT reaction. A pair of P2X7 primers (BIOSOURCE, Camarillo, CA) of sense (TTTTTAAGCTTATGCCGGCCTGCTGCAGCTG) and antisense (TTTTTGCGGCCGCTCAGTAAGGACTCTTGAAGCC) were used for PCR amplification. The amplified P2X7 genes were subcloned into pcDNA5/FRT vector (Invitrogen) with HindIII and NotI sites. For inducible expression of P2X7 receptors in MDCK cells that lack endogenous expression of the receptors, P2X7 genes were subcloned into pcDNA4/TO vector (Invitrogen) with HindIII and NotI sites. A c-Myc tag was also attached to the NH2-terminal of the P2X7 genes with a new Myc-containing sense primer (TTTTAAGCTTATGGAACAAAAACTTATTTCTGAAGAAGATCTGCCGGCCTGCTGCAGCTGA) and the same antisense primer. For simultaneous heterologous expression of both the P2X7 and the P2X7-j in HEK293 cells, P2X7 and Myc-P2X7-j or Myc-P2X7 and P2X7-j DNAs were subcloned into pBud 4.1 plasmid (Invitrogen) with HindIII and NotI sites or XbaI and BglII sites, respectively. All genes were fully sequenced for both strands (Cleveland Genomics, Cleveland, OH). Transfections of P2X7 plasmid DNAs were performed using Gene-PORTER Transfection Reagent (GST Inc. San Diego, CA). For generation of stable MDCK cells, zeocin at 300 µg/ml was used. Stable clonal cells were maintained in minimal essential medium containing 5% tetracycline-free fetal bovine serum and 100 µg/ml zeocin. Inducibility of expression of P2X7 genes (Myc-P2X7 and Myc-P2X7-j) in the stable MDCK cells was confirmed by RT-PCR with sense primer (CTGTTCCTCTGACCGAGGTT) and antisense primer (TCCGTTTCTCAACATTGTTTTCC). The PCR products for the Myc-P2X7 and Myc-P2X7-j were 539 and 401 bp, respectively (Fig. 2). Expression of Myc-P2X7 and Myc-P2X7-j proteins in stable MDCK cells was induced by 100 ng/ml doxycycline. Stable HEK293 clonal cells were generated by transfection of P2X7 genes in pBud4.1 vector or pcDNA5/FRT vector in Flp-InTM-293 cells (Invitrogen) and selection in the presence of 300 µg/ml zeocin or 500 µg/ml hygromycin, respectively. Transfections of P2X7 genes in pcDNA5/FRT vector were carried out in the presence of pOG44 plasmid (Invitrogen) following the manufacturers instruction. The expression of P2X7 genes in both stable MDCK and stable HEK293 cells was confirmed by immunocytochemistry and Western blotting. The hygromycin-inducible HEK293 cells expressing the full-length P2X7 were kindly provided by Dr. George Dubyak, Case Western Reserve University. Stable HEK293 clones were maintained in the presence of 100 µg/ml zeocin, 500 µg/ml hygromycin, or both. Real time PCR assays utilized SYBR Green PCR master mixture machine with ABI 7500 Real-time PCR SDS software (Applied Biosystems, Foster City, CA) and experiments were carried out according to the manufacturer's instructions. Primers were as follows: full-length P2X7: forward, ATACAGTTTCCGTCGCCTTG; reverse, AACGGATCCCGAAGACTTTT. The truncated P2X7 variant P2X7-j: forward, TTTCAGATGTGGCAATTCAGATA, reverse, AAGTAGGAGAGGGTTGAGCC; glyceraldehyde-3-phosphate dehydrogenase: forward, CAATGACCCCTTCATTGACC; reverse, GACAAGCTTCCCGTTCTCAG. The reaction mixture was composed of 0.5 µl of primers (5 µM), 9 µl of diluted cDNA, and 10 µl of SYBR Green PCR master mixture. PCR conditions were 50 °C for 2 min, 95 °C for 10 min, 40 cycles of 15 s at 95 °C, and 60 °C for 1 min. Results were calculated using the comparative threshold cycle (Ct) method of relative quantitation (RQ).
Protein MethodsWestern blots were carried out on post-nuclear supernatant of cell lysates (14), and total proteins were quantified using the Bio-Rad Protein Assay (Bio-Rad). Samples were mixed with 2 x SDS sample buffer and boiled at 100 °C for 5 min. Fractionation of cultured cells was done using the Proteo-Extract Subcellular Proteome Extraction kit (EMD Biosciences, Inc., San Diego, CA) according to the manufacturer's instructions. Aliquots of cell lysates (normalized to 15 µg of protein) were separated in SDS-polyacrylamide 6-10% gels by gel electrophoresis (PAGE) and blotted by Western analysis. Receptor polypeptides were visualized using 1.5 µg/ml of primary antibodies. The rabbit polyclonal anti-P2X7 antibody (Alomone Labs, Jerusalem, Israel) recognizes the stretch of 12 amino acids (KKGWMDPSKGIQTGRC) from 136 to 152 of the mouse P2X7 receptor. Rabbit monoclonal anti-Myc antibody was from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-tubulin antibody (hybridoma supernatant, clone E7, generated with the antigen of Cell Number, Cell Cycle, Flow Cytometry, and Apoptosis AssaysCell number was evaluated using the CyQUANY cell proliferation assay kit (Molecular Probes, Eugene, OR) according to the manufacturer's instructions. For cell cycle analysis cells were synchronized by culturing in 10% fetal bovine serum, Dulbecco's modified Eagle's medium overnight and serum starvation in Dulbecco's modified Eagle's medium for 6 h. Cells were shifted to 10% fetal bovine serum, Dulbecco's modified Eagle's medium containing 1:500 defined keratinocyte growth factors from bovine pituitary extract (Invitrogen) for 18 h, and treated with 100 µM BzATP (or the vehicle) for 8 h. Harvested cells were washed with phosphate-buffered saline and fixed with 100% methanol at -20 °C overnight. Following treatment with 20 µg/ml RNase, the cells were stained with 50 µg/ml propidium iodide. Aliquots of 5 x 104 cells were analyzed for DNA content by flow cytometry using Beckman Epics XL-MCL.
Apoptosis was quantified using Roche Cell Death Detection ELISA Kit (Roche Applied Science) according to the manufacturer's instructions. Briefly, cells plated in 96-multiwell plates at 104 cells/well and maintained overnight in 10% serum-enriched medium were serumstarved for 6 h in the absence or presence of added BzATP. At the completion of incubation the medium was removed, spun, and the pellet stored. The cells together with the stored pellet were lysed with the provided lysis buffer, and the mixture was spun at 200 x g for 10 min at room temperature. An aliquot from the supernatant, containing the cytoplasmic fraction of oligonucleosomes was added to a streptavidincoated multiplate and mixed with pre-prepared reaction reagent containing the anti-histone-biotin and anti-DNA-POD antibodies. After a 2-h incubation on a shaker at room temperature the solution was collected and mixed with 2,2'-azino-bis(3-ethylbenziazolin-6-sulfonic acid) solution at room temperature for 15 min. Absorbance was measured at 405 nm against blank, and the degree of apoptosis was determined in reference to the control/standard provided in the kit. Dynamic Confocal Laser Scanning MicroscopyWe used a described method (24) with minor modifications. Briefly, cells were seeded at 2-3 x 105 on 35-mm glass bottom Petri dishes (MatTek Corp., Ashland, MA), and allowed to reach confluence. Cells were loaded with 5 µM Fluo-4/AM (Molecular Probes) in 0.1% bovine serum albumin, Ringer's solution for 20 min at 37 °C, rinsed twice with Ringer's solution, and incubated for additional 20 min at 37 °C. Cells were imaged with a Zeiss LSM 510 inverted real time confocal microscope equipped with a x20 water immersion objective at room temperature (Comprehensive Cancer Center Microscopy Facility of Case Western Reserve University). Images were collected at 488/505 nm (excitation/emission) before and after treatment with 100 µM BzATP, added to both the luminal and subluminal perfusates, at intervals of 10 to 15 s afterward. For ethidium bromide influx experiments, cells cultured on glass-bottomed dishes were loaded onto the microscope. Images (collected at 488/505 nm (excitation/emission)) were taken before, and at intervals of 30 s after adding 5 µM ethidium bromide to both the luminal and subluminal perfusates. Average fluorescence intensity was quantified from collated images using MetaVue software (Fryer Company Inc., Huntley, IL) by subtracting the basal intensity value. DensitometryDensitometry was done using a AGFA Arcus II scanner (AGFA, New York) and Un-Scan-It gel automated digital software (Silk Scientific, Orem, UT). Statistical AnalysisData are presented as mean ± S.D. and significance of differences among means was estimated by Student's t test. Trends were analyzed by analysis of variance.
Cloning and Expression of the Truncated P2X7 Variant P2X7-jA PCR product ( 1652 bp) of smaller size than the expected full-length P2X7 ( 1789 bp) was identified in RT-PCR experiments trying to amplify the full-length P2X7 gene (data not shown). DNA sequencing and gene analysis of the 1652-bp PCR product revealed an identical P2X7 gene that lacks the putative exon 8 except the A882, with a shift of coding frame to a new variant (Fig. 1A). As a result, the gene product becomes a truncated variant of only 258 amino acids (compared with 595 of the full-length P2X7) with 10 altered unique residues at the COOH-terminal (Fig. 1B). The predicted sequence of this variant lacks the entire carboxyl cytoplasmic domain, the second transmembrane domain, and the distal third of the extracellular domain of the full-length P2X7 (Fig. 1B, lower panel). We named this newly discovered variant as P2X7-j because previous studies identified splice variants isoforms designated P2X7-b-P2X7-h (Ref. 25, accession numbers AY847 (298-304)), and a truncated P2X7 variant 2 (149 residues) (Ref. 26, accession number NM177427). The sequence of our novel P2X7-j variant has been deposited in the GenBank (accession number DQ399293
[GenBank]
). Blast search of available gene data base showed that this variant has not been reported before.
To determine the translational product of the P2X7-j gene, the P2X7-j cDNA was subcloned into various expression vectors as described under "Materials and Methods," and was introduced into MDCK and HEK293 cells by transfection. MDCK cells, in contrast to the HEK293 cells form sheets of cells with typical epithelial characteristics. Stable lines of MDCK and HEK293 cells expressing the P2X7-j were successfully generated, and the expression of P2X7-j was confirmed at both the mRNA level by RT-PCR (Fig. 2A) and the protein level by Western blots (Fig. 2, A-E). Specific bands at 75 kDa for the full-length P2X7 proteins and 45-42 kDa for the P2X7-j proteins expressed in MDCK cells were visualized with both anti-Myc antibodies and anti-P2X7 antibodies (Fig. 2, B-D). Similar patterns of expression of the P2X7 and the P2X7-j proteins were also observed in HEK293 cells (Fig. 2, E and F). To determine whether the P2X7-j gene is also naturally translated into protein, CaSki cells expressing P2X7-j mRNA were examined by Western blot with anti-P2X7 antibody. Fig. 2G shows two main specific forms at 75 and 42 kDa that can be blocked by the P2X7 antigen. The 75-kDa form is most likely the full-length P2X7 (14, 15). The 42-kDa is likely the P2X7-j because the sizes of heterologously expressed P2X7-j in MDCK cells (Fig. 2, B-D) and HEK293 cells (Fig. 2, E and F) were also 42 kDa. The presence of the P2X7-j variant (45-42 kDa) was confirmed also in the human cancer cervical cell lines HT3, SiHa, and HeLa (Fig. 2H). Collectively, these data suggest that the P2X7-j is a naturally occurring P2X7 variant.
Cellular Localization of the P2X7-jIn MDCK cells and HEK293 cells, both the 75-kDa P2X7 and the 45-42-kDa forms were present predominantly in the plasma-membrane fraction. Small amounts of the 75-kDa P2X7 were detected also in the cytosol, nuclear, and cytoskeletal fractions (Fig. 3). Interestingly, a significant amount of the 45-42-kDa form was also detected in the nuclear fraction. These findings are supported by the results obtained using laser confocal microscopy (Fig. 3C), which also show that some of the P2X7-j localizes in nuclear/perinuclear regions of the HEK293 cells.
Deficient Induction of Apoptosis and Activation of Pore FormationIn cervical cells an important function of the full-length P2X7 is induction of apoptosis (19). To examine whether the P2X7-j preserves this action, the cell number, cell cycle, and direct apoptosis assays were performed using both MDCK and HEK293 cells. In MDCK cells, Inducible expression of P2X7 alone, but not P2X7-j alone resulted in a significant decrease in cell numbers ( Cell cycle assays in MDCK and HEK293 cells showed that expression of the full-length P2X7 induced a 2-4-fold increase of cells in the sub-G1 phase. Treatment with BzATP augmented the effect (Fig. 4B) in P2X7-expressing HEK293, suggesting increased apoptosis. In contrast, expression of the P2X7-j altered only little the percent of cells in the sub-G1 phase as compared with control cells (Fig. 4B). Direct apoptosis assays in MDCK and HEK293 cells showed that expression of the P2X7 increased apoptosis by about 2-fold, and treatment with BzATP augmented the effect (Fig. 4C). In contrast, expression of the P2X7-j resulted in no change in baseline or in BzATP-induced apoptosis (Fig. 4C). In HEK293 cells, co-expression of the P2X7-j blocked P2X7-mediated apoptosis (Fig. 4C). In cervical cells, P2X7-mediated apoptosis requires formation of pores (19, 20). The failure of P2X7-j-expressing cells to undergo apoptosis could be the result of the inability of the P2X7-j to effectively activate pore formation. As expected, in both MDCK and HEK293 cells stimulation of P2X7-j with BzATP induced only a negligible influx of ethidium bromide compared with effects in cells expressing the P2X7 (Fig. 5A), suggesting deficient pore formation. In HEK293 cells, co-expression of the P2X7-j inhibited by about 80% the P2X7-mediated influx of ethidium bromide in the presence of BzATP (Fig. 5A). Deficient BzATP-induced Acute Ca2+ InfluxAn early event of P2X7 receptor activation is the acute channel opening that precedes, and possibly mediates P2X7 pore formation (22). MDCK and HEK293 cells expressing P2X7 or P2X7-j were loaded with the Ca2+-sensitive dye Fluo-4 and examined using dynamic confocal laser scanning microscopy in the absence and presence of BzATP. In P2X7-expressing cells BzATP induced an acute transient increase in cytosolic calcium (Fig. 5B). The BzATP effects could be blocked by pre-treatment with 1.2 mM EGTA (to chelate extracellular calcium) (data not shown), indicating that the acute increase in cytosolic calcium is the result of calcium influx. In P2X7-j-expressing cells BzATP induced a significantly smaller increase in cytosolic Ca2+ (Fig. 5B). In P2X7-expressing HEK293 cells, co-expression of the P2X7-j inhibited the BzATP-induced increase in cytosolic Ca2+ to levels seen in cells expressing P2X7-j alone (Fig. 5B).
Collectively, the data in Figs. 4C, and 5, A and B, indicate that co-expression of the P2X7-j inhibits P2X7 receptor activation, pore formation, and apoptosis. Fig. 5C shows that in P2X7-expressing HEK293 cells co-expression of the P2X7-j had no significant effect on the expression of the full-length P2X7. Therefore the P2X7-j-mediated inhibition of P2X7 actions cannot be explained by down-regulation of P2X7 receptor expression. P2X7-j/P2X7 InteractionPrevious studies suggested that the membrane-bound full-length P2X7 functions as homo-oligomer, presumably a homotrimer (22). This speculation is supported by the experiment shown in Fig. 6A where differential co-immunoprecipitation and Western blot analysis in lysates of MDCK cells co-expressing Myc- and HA-tagged P2X7 resulted in co-immunoprecipitation of the Myc- and HA-tagged isoforms. Fig. 6B shows co-immunoprecipitation of Myc- and HA-tagged isoforms in lysates of HEK293 cells co-expressing Myc- and HA-tagged P2X7-j. Fig. 6C shows co-immunoprecipitation of Myc- and HA-tagged isoforms in lysates of HEK293 cells co-expressing Myc-tagged P2X7-j and HA-tagged P2X7. These data confirm the possible existence of homo- and hetero-oligomers in the forms of P2X7/P2X7, P2X7-j/P2X7-j, and P2X7-j/P2X7. The results in Fig. 7 further clarified these speculations by using 6-8% gels to better detect and separate high Mr forms. In HEK293 cells expressing the P2X7 or co-expressing the P2X7-j plus the P2X7 we confirmed that the wild-type P2X7 (usually referred to as 75 kDa) is expressed as a cluster of 85-(glycosylated) and 65-kDa (non-glycosylated) forms (Fig. 7) (15). In HEK293 cells expressing the P2X7 alone, in addition to the 85-65-kDa forms two other specific P2X7 immunore-activities could be detected, a major form of 220 kDa and a minor form of 115 kDa. In HEK293 cells expressing the P2X7-j alone, in addition to the 45-42-kDa forms at least two other specific P2X7 immunoreactivities were observed, a major form of 135 kDa and a minor form of 90 kDa (Fig. 7). In HEK293 cells co-expressing the P2X7 plus the P2X7-j, in addition to the 85-65-kDa (P2X7 monomers) and 45-42-kDa forms (P2X7-j monomers) four other forms were observed: a major form of 135 kDa; two intermediate forms of 160 and 220 kDa; and a minor form of 200 kDa (Fig. 7). Densitometry of the 135-, 160-, 220-, and 200-kDa bands revealed a relative ratio of 70/15/10/5, respectively.
Homologous Expression of the P2X7 and P2X7-j FormsP2X7-R immunoreactivity was examined in lysates of three human squamous cell carcinoma tissues of the cervix (Fig. 8A, lanes a-c), and results were compared with those of three histologically normal cervical tissues (Fig. 8A, lanes d-f). The 45-42-kDa forms (P2X7-j) were equally expressed in cancer and normal tissues, but the expression of the full-length 85-65-kDa forms (P2X7) was significantly greater in normal than in cancer tissues (Fig. 8A). Densitometry, relative to the constitutively expressed tubulin protein revealed a ratio of P2X7/tubulin in excess of about 8-32 in the normal versus the cancer tissues (Fig. 8B). Interestingly, 205-kDa P2X7-R immunoreactivity was found in lysates of the normal tissues, but it was lacking in lysates of the cancer tissues (Fig. 8A). Total RNA samples from the six tissues of Figs. 8A were also analyzed by real time PCR. The results revealed no significant differences in the mRNA ratios of P2X7-j and the constitutively expressed glyceraldehyde-3-phosphate dehydrogenase among cancer and normal tissues. In contrast, the ratios of P2X7/glyceraldehyde-3-phosphate dehydrogenase were 3-200-fold greater in normal than in cancer tissues (Fig. 8C).
The present data describe a novel truncated form of the P2X7 receptor, designated P2X7-j, which is expressed naturally in normal and cancer cervical cells in humans. The P2X7-j protein is composed of the proximal 248 amino acids of the wild-type P2X7 plus an altered stretch of 10 amino acids at its carboxyl terminal. It lacks the distal 337 amino acids of the P2X7, including the entire intracellular carboxyl terminus, the second transmembrane domain, and the distal third of the extracellular loop. When expressed heterologously, the P2X7-j was localized to the plasma membrane, and treatment with the P2X7-specific ligand BzATP evoked some channel activity but failed to induce pore formation and apoptosis. The P2X7-j interacted with the full-length P2X7, suggesting hetero-oligomerization between the P2X7-j and P2X7. Co-expression in host cells of the P2X7-j plus the full-length P2X7 blocked apoptosis and pore formation and inhibited acute Ca2+ influx in response to BzATP activation of the P2X7. These results suggest that co-expression of P2X7-j results in formation of nonfunctional P2X7-j/P2X7 hetero-oligomers that fail to promote apoptosis. Therefore, in cells expressing both P2X7 receptor forms, abundance of expression of the P2X7-j or paucity of expression of the full-length P2X7 receptor may cause resistance to apoptosis.
Previous studies reported polymorphism of the P2X7 and described a number of different mutations in reference to the original human P2X7 (GenBank accession number Y09561 [GenBank] ). Point mutations have been identified in lymphocytes and monocytes, causing either loss-of-function, e.g. Ala1513 > Cys (E496A) (27), Thr1729 > Ala (I568N) (28), Gly946 > Ala (R307Q) (29), Gly1068 > Ala (A348T) (30), Cys1096 > Gly (T357S) (30), and Ala1405 > Gly (Q460R) (30); or gain of function, e.g. Cys489 > Thr (H155Y) (30). A Thr1352 > Cys (P451L) change impairs cell death in murine thymocytes (31, 32). Polymorphisms in the promoter region of the P2X7 receptor have been reported (33), and one variant was associated with conferred protection against tuberculosis (34). Additional P2X7 gene variants were included in the Single Nucleotide Polymorphism Consortium data base, but their functional implications remain to be determined (30). Eight variants of the human P2X7 resulting from alternative splicing also were previously reported, designated by Cheewatrakoolpong et al. (25) as P2X7b-h (GenBank AY847 (298-304)), and by Georgiou et al. (26) as P2X7 variant 2 (GenBank NM177427). For consistency we propose to designate the P2X7 variant 2 as P2X7-i and the present novel variant as P2X7-j. Of the nine human P2X7 variants five (P2X7-b, P2X7-e, P2X7-g, P2X7-I, and P2X7-j) are truncated, lacking the carboxyl terminus of the wild-type P2X7 receptor, and have been shown (P2X7-b and P2X7-j) or presumed to be ineffective as far as pore formation and apoptosis induction. The presently described P2X7-j differs from the other truncated variants in structure and size. It is also the only P2X7 form to be ineffective when expressed alone, and more importantly, when co-expressed with the full-length P2X7 receptor. The present results show that it can interact and possibly oligomerize with the full-length receptor and thereby render it ineffective.
P2X7-j preserves the first four of the five putative N-glycosylation sites present in the full-length P2X7 (Asn-187, -202, -213, -241, and -284). The calculated molecular masses of P2X7 and P2X7-j are 69 and 36 kDa, respectively. N-Glycosylation would increase the size of the P2X7 to about 85 kDa, as was observed (Ref. 15, and present results). The predicted size of the P2X7-j (258 amino acids) is compatible with the de novo induced protein cluster of 45-42 kDa in HEK293 or MDCK cells transfected with the P2X7-j cDNA. In cells expressing the P2X7-j, treatment with BzATP evoked some acute transient calcium influx but no influx of ethidium bromide (i.e. no pore formation). The failure of the P2X7-j to form pores is probably due to lack of the intracellular carboxyl terminus. This is consistent with conclusions from mutagenesis studies (6, 8, 35), with the E496A mutation (27), and with the P2X7-b (
Plasma membrane localization of P2X7 receptors determines their functionality (22). Surface expression depends on receptor glycosylation, trafficking, and sorting to the plasma membrane, and on receptor redistribution as determined by internalization, degradation, and recycling (14). Activation of wild-type P2X7 induces GRK-3, In HEK293 and MDCK cells expressing the P2X7-j form, the P2X7-j localized also in nuclear/perinuclear regions. Nuclear/perinuclear localization of the wild-type P2X7 was previously described in epithelial (40, 41), neuronal (e.g. Ref. 42), and smooth muscle cells (43), but the biological significance of those findings is at present unclear. In the case of the P2X7-j a possible explanation is a defect in sorting the truncated protein to the plasma membrane, resulting in localization of the receptor in the cytoplasm at perinuclear domains. Support for this hypothesis comes from studies suggesting that domains within the carboxyl-terminal tail of P2X receptors (43, 44), including the P2X7 (6, 25, 45), direct trafficking to the plasma membrane and stabilize expression of the receptors. However, the present data in MDCK and HEK293 cells show that most of the truncated isoform localized in the plasma membrane despite lacking the entire intracellular carboxyl terminus of the full-length P2X7. Also, the highly preserved N-glycosylation sites in P2X7-j could facilitate transport and expression of the receptor in the plasma membrane (22). Another explanation is that the P2X7-j is sorted to the plasma membrane and upon activation undergoes endocytosis into clathrin-coated endosomes (46), similar to the wild-type P2X7 (14). However, in contrast to the P2X7, the truncated form is retained longer in submembranal domains and fails to undergo degradation. One of the consequences would be feedback inhibition of internalization and longer residence of the P2X7-j in the plasma membrane. The end result in cells expressing both isoforms would be competition with the wild-type P2X7 monomers for oligomerization. Support for this hypothesis comes from analysis of the presumed phosphorylation sites in the P2X7-j. The P2X7-j lacks 7 of 10 tyrosine and 12 of 15 serine phosphorylation sites, but it retains 6 of the 7 threonine phosphorylation sites. Activation of the full-length P2X7 induces a transient increase in receptor phosphorylation on tyrosine, serine, and threonine residues, which are associated with redistribution of the P2X7 (14). In CaSki cells, redistribution of the P2X7 was associated with phosphorylation on tyrosine and serine residues, whereas phosphorylation on threonine residues increased ATP requirements for tyrosine and serine phosphorylation, and could therefore control the effect (14). The lack of most tyrosine and serine residues, but only one of the seven threonine residues predicts attenuated ligand-induced phosphorylation of the P2X7-j on tyrosine and serine residues, with only minimal effect on threonine phosphorylation. The consequence of this effect would be attenuated internalization of the P2X7-j and prolonged residence in the plasma membrane.
P2X channels function as oligotrimers (9, 22, 47, 48). P2X1-P2X6 receptors can hetero-oligomerize, but the P2X7 receptor forms only homo-oligomers (49). Our data in HEK293 cells expressing the P2X7 support the speculation of formation of homotrimers, because in addition to the 85-65-kDa monomeric form a specific P2X7 immunoreactivity of 220-kDa form was detected, compatible with a P2X7 homotrimer ([P2X7]3). An additional minor and smaller 115-kDa form in those cells was either a partially degraded form or a denatured homodimer. A similar mechanism possibly involves the P2X7-j because in HEK293 cells expressing the P2X7-j, in addition to the 45-42-kDa monomeric forms, a 135-kDa form was also detected, compatible with a P2X7-j homotrimer ([P2X7-j]3). The 90-kDa form in those cells was possibly a denatured homodimer as well.
The novel and important finding in this paper was that co-expression of the P2X7-j in cells expressing the full-length P2X7 receptor blocked BzATP activation of the P2X7 receptor. The data in Figs. 6 and 7 may provide a mechanistic explanation. In HEK293 cells co-expressing the P2X7 plus the P2X7-j, four specific P2X7 immunoreactivities were detected in addition to the 85-65-kDa (P2X7 monomers) and the 45-42-kDa (P2X7-j monomers) forms. In order of expression levels those were the 135-, 160-, 220-, and 200-kDa bands. The 135-kDa form could possibly be the oligotrimer [P2X7-j]3; the 160-kDa form a [P2X7-j]2/[P2X7] heterotrimer; the 220-kDa the [P2X7]3; and the 200-kDa a [P2X7]2/[P2X7-j] heterotrimer. The relative expression of the bands, based on densitometry, suggests [P2X7-j]3 The above conclusion is also supported by the patterns of P2X7-R protein and mRNA expression in human cervix squamous cell carcinoma versus normal cervical tissues. Whereas the cancer and normal tissues showed similar expression of the truncated P2X7-j form, the expression of full-length P2X7 was significantly greater in normal than in cancer tissues. Furthermore, normal tissues expressed the 205-kDa P2X7-R immunoreactivity, which could represent the [P2X7]3 homotrimer; in contrast, cancer tissues lacked such an expression. These data therefore suggest a mechanistic explanation for the defective P2X7 receptor-related apoptosis in human cancer cervical cells (19). Accordingly, decreased P2X7 transcription and lesser expression of the P2X7 in cancer cells would favor formation of P2X7-j-dominated inactive [P2X7-j]-[P2X7] complexes. As such, determinations of the cellular content of the full-length P2X7, alone or relative to the P2X7-j could provide a novel marker of defective apoptosis and possibly cancer. The molecular mechanism by which single P2X7 molecules oligomerize is unclear. The present results support the speculation that ectodomains of the P2X receptor are essential to carry out the oligomerization (47). However, our data do not support the speculation that residues in or near the second membrane-spanning segment are critical for multimerization of P2X receptors (50) because the P2X7-j could interact with the full-length P2X7 despite lacking the second transmembrane stretch. The P2X7-j protein is a translational product of alternative splicing. Alternative splicing determines the binding properties, intracellular localization, enzymatic activity, protein stability, and post-translational modifications of a large number of proteins that descend from the relatively low number of human genes (51). Although expression of aberrant mRNA is usually controlled (52), inherited and acquired defects of pre-mRNA processing are increasingly recognized as causes of human disease including cancer (53, 54). We identified the P2X7-j mRNA in a number of different types of human cancer cells (data not shown). As discussed above hetero-oligomerization of the P2X7-j with the P2X7 could result in inactive receptor and may be an important mechanism for regulation of P2X7 effects wherein the non-functional form P2X7-j could compete with the full-length P2X7 receptor for oligomerization and block its function. Abrogated P2X7-mediated apoptosis could play a role in tumor neogenesis. Most proteins in mammals have splice variants, which greatly expand the proteome. Understanding the function of protein variants is critical to the advance of system biology and medicine. Unfortunately, the function and mode of action for most protein variants identified this far remain elusive. Our finding that a truncated variant antagonizes its full-length counterpart through hetero-oligomerization with the full-length form may represent a general paradigm for regulation of protein function by its variant.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) DQ399293 [GenBank] .
* The work was supported in part by American Heart Association Scientist Development Grant 0030019N and NHLBI National Institutes of Health Grants HL65492 (to Y.-H. F.) and HD29924 and AG15955 (to G. I. G.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Both authors contributed equally to this work. 2 To whom correspondence should be addressed: University MacDonald Women's Hospital, University Hospitals of Cleveland, 11100 Euclid Ave., Cleveland, OH 44106. Tel.: 216-844-5977; Fax: 216-983-0091; E-mail: gig{at}cwru.edu.
3 The abbreviations used are: BzATP, 2',3'-O-(4-benzoylbenzoyl)-adenosine 5'-triphosphate; MDCK, Madin-Darby canine kidney cells; HEK, human embryonic kidney; RT, reverse transcriptase; HA, hemagglutinin.
We acknowledge the technical support of Robin Zeng.
This article has been cited by other articles:
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||