HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 281, Issue 25, 17276-17285, June 23, 2006

This Article Abstract Full Text (PDF) All Versions of this Article: 281/25/17276    most recent M512727200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Barber, C. Articles by Seifert, G. J. Search for Related Content PubMed PubMed Citation Articles by Barber, C. Articles by Seifert, G. J. Social Bookmarking                      What's this?

Distinct Properties of the Five UDP-D-glucose/UDP-D-galactose 4-Epimerase Isoforms of Arabidopsis thaliana^*

From the Department of Cell and Developmental Biology, John Innes Centre, Colney, Norwich NR4 7UH, United Kingdom

Received for publication, November 29, 2005 , and in revised form, April 27, 2006.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Plant genomes contain genetically encoded isoforms of most nucleotide sugar interconversion enzymes. Here we show that Arabidopsis thaliana has five genes encoding functional UDP-D-glucose/UDP-D-galactose 4-epimerase (named UGE1 to UGE5). All A. thaliana UDP-D-glucose 4-epimerase isoforms are dimeric in solution, maximally active in vitro at 30-40 °C, and show good activity between pH 7 and pH 9. In vitro, UGE1, -3, and -5 act independently of externally added NAD⁺, whereas cofactor addition stimulates the activity of UGE2 and is particularly important for UGE4 activity. UGE1 and UGE3 are most efficiently inhibited by UDP. The five isoforms display values between 23 and 128 s^- and values between 0.1 and 0.3 mM. This results in enzymatic efficiencies ranging between 97 and 890 mM^-1 s^-1 for UGE4 = UGE1 < UGE3 < UGE5 < UGE2. The values, derived from the Haldane relationship, were 0.76 mM for UGE1, 0.56 mM for UGE4, and between 0.13 and 0.23 mM for UGE2, -3, and -5. The expression of UGE isoforms is ubiquitous and displays developmental and cell type-dependent variations. UGE1 and -3 expression patterns globally resemble enzymes involved in carbohydrate catabolism, and UGE2, -4, and -5 expression is more related to carbohydrate biosynthesis. UGE1, -2, and -4 are present in the cytoplasm, whereasUGE4 is additionally enriched close to Golgi stacks. All UGE genes tested complement the UGE4^rhd1 phenotype, confer increased galactose tolerance in planta, and complement the galactose metabolization deficiency in the Saccharomyces cerevisiae gal10 mutant. We suggest that plant UGE isoforms function in different metabolic situations and that enzymatic properties, gene expression pattern, and subcellular localization contribute to the differentiation of isoform function.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The biosynthesis of plant carbohydrates requires specific glycosyl-transferases that act on activated sugars, typically uridine diphosphate, adenosine diphosphate, and guanosine diphosphate hexoses and pentoses. In addition to acting as biosynthetic substrates, nucleotide sugars are modified at their glycosyl moieties by nucleotide sugar interconversion enzymes to generate different sugars and are intermediates in the uptake of the free sugars released from the breakdown of nutritional or storage carbohydrates and other sources. The biochemistry and reaction mechanism of many nucleotide sugar interconversion pathways have been reviewed previously (1). cDNAs coding for nucleotide sugar interconverting enzymes have been cloned and recombinant proteins purified, leading the way to x-ray crystallography (2-5). The complete sequencing of entire genomes revealed a surprising over-representation of genes encoding putative isoforms of nucleotide sugar interconversion enzymes in plant genomes (6, 7), but the functional significance of this apparent genetic redundancy remains to be established.

One of the best characterized nucleotide sugar interconversion enzymes is UDP-glucose 4-epimerase (EC 5.1.3.2 [EC] ; UGE),⁴ which interconverts UDP-D-glucose (UDP-Glc) and UDP-D-galactose (UDP-Gal). The reaction mechanism of UGE is thought to occur via transfer of the 4'-OH hydrogen of the sugar to the nicotinamide ring of noncovalently bound NAD⁺, rotation of the resulting 4'-ketopyranose intermediate in the active site, and transfer of the hydride from the nicotinamide ring of NADH back to C-4 of the sugar (3). UGE is essential for de novo biosynthesis of UDP-Gal, a precursor for the biosynthesis of numerous different carbohydrates, glycolipids, and glycosides. On the other hand, UGE is also required for the catabolic uptake of galactose into the central metabolism, and therefore UGE deficiency exacerbates galactose toxicity in plants (8) and in yeast (9) and also leads to different forms of human galactosemia (10, 11).

The completely sequenced genome of the model plant Arabidopsis thaliana contains five genes predicted to encode UGE (6, 7); the fully sequenced rice genome contains four putative UGE-encoding genes, and cDNA clones putatively encoding three UGE isoforms were recently isolated from barley (12). Two studies previously addressed the genetic role of individual UGE isoforms in A. thaliana. UGE1 was transgenically overexpressed and suppressed (8). Despite an increase by up to 250% and a decrease to 10% compared with the wild type UGE activity, no alteration in carbohydrate composition was observed. However, tolerance to galactose was correlated to UGE1 expression in various transgenic lines. Loss of function mutations in UGE4 were found to induce dramatic morphological alterations in roots and correlated with a reduction of cell wall bound galactose without affecting the level of galactolipids (13). Because all UGE isoforms are expressed in roots, the specific effect of UGE4 loss of function was surprising and prompted the speculation that individual isoforms might be physically associated with specific galactosyltransferases facilitating substrate channeling, a speculation that was also presented in the context of the noncatalytic loops in the structure of Trypanosoma brucei UGE (4). In potato tubers, overexpression of two different UGE isoforms increased cell wall galactose content. This indicates that UGE activity is rate-limiting for the biosynthesis of some cell wall polymers (14). Interestingly, overexpression of one potato UGE isoform increased galactose tolerance, whereas overexpression of the other isoform did not. These observations suggest that UGE isoforms might perform specific roles in planta. Besides metabolic channeling, further explanations for the observed discrepancy between bulk UGE activity and UDP-Gal flux might be found in the differential sensitivities to control mechanisms such as redox control, feedback inhibition, or allosteric regulation (reviewed in Ref. 7). Moreover, the possibility has been discussed of "one-way enzymes," where the K_m value for one substrate differs substantially from the K_m value for the other substrate, despite an equilibrium constant (K_eq) close to unity (15). To investigate qualitative and quantitative biochemical differences between plant UGE isoforms, we systematically compared the enzymatic properties of all five UGE isoforms of A. thaliana. Systems properties of UGE isoforms were investigated in public expression data bases and by subcellular localization studies. Our data suggest that all UGE paralogs are catalytically active in both directions but appear to have adapted to different metabolic roles in vivo.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cloning and Recombinant Expression of UGEs in Escherichia coli— UGE4 bacterial expression was described previously (13). Using A. thaliana wild type (Col-0) seedling total cDNA as template, the coding sequences of UGE1-3 and -5 were amplified using the following oligonucleotides (from 5' to 3'): U1/Nde-F, CATATGGGTTCTTCTGTGGAGCAG; U1/Bgl-R, AGATCTCAAAGCTTATTCTGGTAACC; U2/Vsp-F, ATTAATATGGCGAAGAGTGTTTTGG; U2/Bgl-R, AGATCTTATGAAGAGGAGCCATTGGAGG; U3/Nde-F, CATATGGGTTCTTCTGTGGAACAG; U3/Bgl-R, AGATCTCAAGGCTTCTTCTGGAAACC; U5/Vsp-F, ATTAATATGGCTAGAAACGTTCTAGTAAG; and U5/Bgl-R, AGATCTTAATGAGAGTTGTCTTCAGAA, respectively.

PCR products were cloned into pGEM-T (Promega), and individual clones were sequenced. Correct open reading frames of UGE1 and UGE3 were released using NdeI and BglII; UGE2 and UGE5 were released using VspI and BglII and ligated into NdeI- and BglII-digested, gel-purified pET15b (Novagen). Because UGE2 and UGE5 cDNA sequences contain internal NdeI sites, VspI was used for cloning into pET15. This procedure introduces 1 asparagine residue between the UGE peptide and the 20-amino acid-long amino-terminal hexahistidine peptide. Recombinant UGE proteins were expressed and affinity-purified as described previously for UGE4 (13). UGE preparations containing 50% glycerol were frozen on dry ice and kept at -80 °C. After purification, staining with Sypro Ruby Protein Gel Stain (Molecular Probes, Invitrogen) revealed a certain degree of unspecific proteins bound to the Hisbind (Novagen) affinity matrix. The content of recombinant UGE1-5 was 50, 70, 60, 82, and 71%, respectively. To keep the manipulation of the proteins as low as possible, no further purification step was attempted. Specific enzyme concentration was determined by co-electrophoresis of 5-35 ng of protein assay standard II lyophilized bovine serum albumin (BSA, Bio-Rad catalog number 500-0007), scanning the gel on a PROXPRESS proteomic imaging system (PerkinElmer Life Sciences) using 480/30 nm excitation and 630/30 nm emission filters, and quantification of specific bands by Labworks software (UVP, Inc.).

Cloning and Recombinant Expression of UGEs in Yeast—The cDNA inserts were cleaved from the pGEM-T plasmids using NdeI (UGE1, -3, and -4) or AseI/VspI (UGE2 and -5) and BglII and then gel-purified. The fragments were cloned into the NdeI and BamHI restriction sites of the cleaved and de-phosphorylated yeast two-hybrid plasmids pGBKT7 and pGADT7 (Clontech). For functional complementation of the UGE-deficient yeast mutant, the bait plasmids pGBKT7 and pGBKT7-UGE1 to-5 were transformed into the gal10 strain by small scale transformation, and transformants were selected on SD/-Trp-selective medium. For the complementation assay, transformed mutant cells were grown at 30 °C on SD/-Trp-selective medium and galactose solid medium (1% yeast extract (Duchefa), 2% Bacto-peptone (BD Biosciences), 0.8% galactose (Sigma), 2% Micro agar (Duchefa); w/v). All UGE isoforms were tested for interaction both with themselves and with each other by yeast two-hybrid assays. Each UGE bait (GBKT7-UGE1-5) was co-transformed with UGE prey (pGADT7-UGE1-5) into the AH109 reporter strain (Clontech), and double transformants were selected on SD/-Leu/-Trp medium. For yeast two-hybrid interaction assays, double transformants were grown on SD/-His/-Trp/-Leu for selection of activation of the HIS reporter gene and on SD/-Ade/-His/-Trp/-Leu for selection of activation of the HIS and the ADE reporter genes.

UDP-Gal 4-Epimerase Assay—UGE was assayed as described previously (8). The standard epimerase reaction was performed in 50 mM Tris/HCl, pH 7.4, containing 0.1 mM NAD⁺ and 125 µg·ml^-1 acetylated BSA (Sigma catalog number B 2518) at 25 °C, unless stated otherwise. To start kinetic measurements, 175 µl of UDP-Gal (Calbiochem catalog number 670111) solution was added to 25 µl of pre-warmed enzyme solution, and the reaction was stopped after 10 min by adding 25 µl of 1.2 M HCl. After 5 min at 100 °C and cooling, 25 µl of 1.2 M NaOH was added. Glucose was quantified in a coupled reaction by adding 100 µlof a solution containing 5 µg·ml^-1 horseradish peroxidase (Sigma catalog number P 8250, 179 units·mg^-1), 100 µg·ml^-1 glucose oxidase (Sigma catalog number 49180, 198 units·mg^-1), and 300 µg·ml^-1 o-dianisidine dihydrochloride (Sigma catalog number D-3252) in 100 mM sodium phosphate buffer, pH 7.0, for 30 min at room temperature, against a glucose standard series in a buffer identical to the epimerase buffer. The reactions were stopped by adding 300 µlof6 M HCl, and the absorbance was detected at 540 nM. The linearity of the epimerase reaction was tested between 5 and 30 min and by varying enzyme concentrations. Maximal reaction rate and K_m values were determined by varying UDP-Gal concentration between 0.05 and 2.5 mM using best fit to single site saturation kinetics in the pharmacology menu of Sigmaplot 8.0 software. To determine K_eq, UDP-Glc was converted by re-adding fresh enzyme until there was no further change in the UDP-Glc:UDP-Gal ratio.

UDP-Glc 4-Epimerase Assay—The velocity of conversion of UDP-Glc to UDP-Gal was determined at 5 mM UDP-Glc (Sigma catalog number U 4625) in a 50-µl volume of 50 mM Tris/HCl, pH 7.4, containing 0.1 mM NAD⁺and 125 µg·ml^-1 acetylated BSA (Sigma catalog number B 2518) at 25 °C. The epimerase reaction was stopped after 10 min with 25 µl of 0.3 M HCl, hydrolyzed at 100 °C for 5 min, and neutralized using a mole equivalent of NaOH. Galactose was quantified in a coupled reaction by adding 50 µl of a solution containing 0.2 units·ml^-1 horseradish peroxidase, 4 units·ml^-1 galactose oxidase, and 0.1 mM Amplex Red (all from Molecular Probes, catalog number A22179), in a 150 mM Tris/HCl, pH 7.2, 3 mM CaCl₂ buffer against a galactose standard in a buffer identical to the epimerase buffer. Because detection of fluorescence produced unsatisfactorily high variability, the absorbance of the oxidized Amplex Red was detected at 560 nm in 96-well microtiter plates (Costar 9017) using a Spectramax 340pc plate reader. The absorbance differential between 200 and 300 s of reaction time typically gave the best linearity of the reaction. Amplex Red was handled to ensure minimal light exposure. To ensure linearity of the epimerase reaction, a range of enzyme concentrations was tested. To ensure substrate saturation, 5-9 mM UDP-Glc was used. The direct determination of K_m UDP-Glc at low substrate concentrations did not yield reproducible data because of low signal to noise ratio.

Therefore, the value was derived from the Haldane relationship shown in Equation 1 (15),

(Eq. 1)

using K_eq of 0.33 and the kinetic constants corresponding to the highest rate of UDP-Gal conversion.

Overexpression of UGEs in A. thaliana—UGE2, -3, and -4 were amplified using the following oligonucleotides: UGE2/STA/Xba, TCTAGATGGCGAAGAGTGTTTTGG; UGE2/STO/Eco, GAATTCTTATGAAGAGGAGCCATTG; UGE3/STA/Xba, TCTAGATGGGTTCTTCTGTGGAAC; UGE3/STO/Bam, GGATCCTCAAGGCTTCTTCTGGAAAC; R1/STA/Xba, TCTAGATGGTTGGGAATATTCTGGTGACCGGTGGT; and R1/STO/EcoRI, GAATTCTTATGTTGAGTTTGGTGAAGAACCGT. Plasmid preparations of bacterial artificial chromosome (BAC) genomic clones were used as PCR templates (UGE2, T32A16; UGE3, F16M19; and UGE4, F15H21). The bacterial galE gene (GenBank^TM accession number X06226 [GenBank] ; base 1-1071) was amplified using the following oligonucleotides: GALE/STA/Xba, TCTAGATGAGAGTTCTGGTTACCGGTGGT; GALE/STO/Eco, GAATTCTTAATCGGGATATCCCTGTGGATG; and an E. coli DH5 colony as the template. PCR products were cloned into pGEM-T (Promega) and sequenced. After release of the inserts by restriction digest, the fragments were cloned into pGREENII containing a cauliflower mosaic virus 35S promoter terminator cassette and Basta resistance (16). A. thaliana UGE4^rhd1-1 mutant plants were transformed using vacuum infiltration with Agrobacterium strain GV3101 containing overexpression constructs (17). The transgenic line ES7-2overexpressing UGE1 cDNA (8) was kindly provided by P. Dörmann.

Translational UGE Fluorescent Protein Fusions—To generate carboxyl-terminal translational fusions between UGE genes and enhanced fluorescent protein (ECFP), the genomic sequences of UGE1, UGE2, and UGE4, including 5'-upstream regions of 1.5, 1.7, and 1.5 kb, respectively, were amplified from BAC DNA using the following primers: SphU1-5'-F, TTACGAGCATGCCGCGGCGACTGCAGAAATAGTTGTAAGATACTAAG; XmaU1-3'-R, TGATACCCGGGGTGAAAGCTTATTCTGGTAACCCCATGGATTATT; SphU2-F, TTACGAGCATGCTCTAGATGGCCTCAGTTAATTCAGGCGAAAG; XmaU2-R, TGATACCCGGGGTGATGAAGAGGAGCCATTGGAGGAGGAATTGTA; SphR1-F, TTACGAGCATGCCGCGGACAAAACTTCGTTGTATCTATTTAGG; and XmaR1-R, TGATACCCGGGGTGATGTTGAGTTTGGTGAAGAACCGTAAC. The products were cloned into pGEM-T (Promega) and sequenced. Using the SphI and XmaI restriction sites, correct inserts were cloned into pECFP (Clontech). Terminator regions were amplified and sequenced after pGEM-T subcloning using the following oligonucleotides: NotU1-3'-F, TGCGGCCGCATTTACTTCTTTTGTTTGGAGTTACC; ApaU1-3'-R, TGGGCCCATAAATGGATATTGTAAGGCTAATC; NotU2-3'-F, TGCGGCCGCTTCTCCTTTTTTAATTTTTATTTTGCC; ApaU2-3'-R, TGGGCCCTTCGGTGATTTGTTATTGTGGAC; NotIR1-3'-F, ACTATGTAAGTGCGGCCGCTAACGAAGCTAATGTATCCAACACTCC; and ApaIR1-3'-R, ATAGAATTGTTGGGCCCGCAAAATATTTTTTCGGCAAAACCGT. The terminator regions were added after the ECFP stop codon using NotI and ApaI digestion of the corresponding UGE:CFP recombinant clones. The resulting fusion constructs were cloned into pGREEN0229 (16) and transformed into uge4 mutant and wild type plants as described above. To generate an amino-terminal GFP fusion of UGE4, the DNA of enhanced green fluorescent protein (Clontech) was generated using the following oligonucleotide primers: CY-GFP-F, ATGGTGAGCAAGGGCGAGGAGCTGTTCACC; CY-GFP-AscI, CCGCGGCGCGCCCTTGTACAGCTCGTCCATGCC. The UGE4 promoter was amplified using the following oligonucleotide primers: R1/5'XHO-F, AAACTCGAGTCACACACTTGTCAACAAACCCGGTTAG; R1/5'CY-GFP-R, CTCGCCCTTGCTCACCATCGAAGCTCGAAGAGGCGATGAAGAAAGAGAG. The enhanced green fluorescent protein sequence and the UGE4 promoter sequence were fused by mixing the purified PCR products and amplification using the oligonucleotides R1/5'XHO-F and CY-GFP-AscI. The resulting product was cloned into pGEM-T and sequenced. The UGE4 gene including the terminator region was amplified using the following oligonucleotide primers: R1/STA/AscI, AAGGGCGCGCCGATGGTTGGGAATATTCTGGTGACCGGTGGT; Not-R1/3', AAAAGGAAAAGCGGCCGCATTTTTATATAAATGAAATGAGAATGTGGATG, and were cloned into pGEM-T and sequenced. The UGE4 sequence was excised using AscI and NotI and cloned into the RHD1 promoter:GFP fusion containing clone. The resulting fusion was cloned into pGREEN0229 (16) and transformed into uge4 mutants as described above.

UGE4-specific Antibodies—UGE4-specific antiserum was raised commercially (BioGenes, Berlin) by immunization of rabbits with a peptide corresponding to the 16 carboxyl-terminal amino acid residues of UGE4 conjugated to keyhole limpet hemocyanin. Specific antibodies were subsequently affinity-purified using immobilized peptide. The rhd1-4 mutant, that contains a premature stop codon before the carboxyl-terminal half of UGE4 (13), served as control in various assays. In microscopic applications, the antiserum 3605g produced an unspecific signal in cell walls but bound specifically to intracellular UGE4.

Immunogold Transmission Electron Microscopy—Roots of 4-day-old seedlings were excised and were vacuum-infiltrated for 5 min with MES (20 mM). The samples were high pressure frozen, freeze-substituted in acetone containing 0.5% uranyl acetate, and embedded in LR white resin as described previously (18). Ultrathin sections of 90 nM were taken using a Leica UC6 ultramicrotome (Leica, Milton Keynes, UK) and picked up on pyroxylin- and carbon-coated gold grids. For immunogold labeling, grids were incubated on drops of 50 mM glycine/PBS for 15 min followed by drops of pre-prepared Aurion blocking buffer (5% BSA, 0.1% cold water fish skin gelatin, 5-10% normal goat serum, 15 mM NaN₃/PBS, pH 7.4) (Aurion, Netherlands) for 30 min and then equilibrated in 0.1% BSA-C/PBS (Aurion, Netherlands). Grids were incubated with the primary antibody diluted in equilibration buffer overnight at 4 °C, washed five times in equilibration buffer, and incubated for 3 h with the secondary antibody conjugated to 10 nM gold (BioCell, Agar Scientific Ltd., Essex, UK) diluted 1:50 in equilibration buffer. After four washes in equilibration buffer, 20-min washes three times in PBS and 30-min washes two times in water, the grids were contrast-stained with uranyl acetate and lead citrate before observation in a Jeol 1200 EX transmission electron microscope at 80 kV. Photographic images were taken using Kodak electron image film.

Meta-analysis of Publicly Available Expression Data—Data on organ-specific expression were obtained from the GENEVESTIGATOR data base (19) using the Gene Atlas tool. Expression signals for each UGE gene were normalized. Cell type-specific gene expression data in root tips were published previously (20), and spatial representations were queried online. The degree of co-expression between individual genes was queried in the comprehensive systems biology data base (CSB.DB) (21) or by an alternative approach using pre-processing of raw data and discretization of signal changes between time points (22). This method preserves the entire set of genes queried, and its results match well with other algorithms. Experimental details and the full result of this analysis are available online in the Arabidopsis Systems Interaction data base.

View larger version (61K): [in this window] [in a new window]   FIGURE 1. Yeast two-hybrid interaction assay at low (-His) and high (-His/-Ade) stringency. All combinations of UGE isoforms grew on SD/-His/-Trp/-Leu medium (-His) but did not grow on SD/-Ade/-His/-Trp/-Leu medium (-His/-Ade). This shows that all isoforms are able to interact both with themselves and each other in yeast although not very strongly. Combinations of bait (vertically) and prey (horizontally) plasmids are shown. Lanes 1-5, UGE1-5 in bait plasmid or prey plasmid; lane E, empty bait or prey plasmid; lane -, negative control, human lamin C in bait plasmid; lane +, four times positive control, pGBKT7-53 and pGADT7-T.

Dynamic Light Scattering—The hydrodynamic radius of freshly purified His-tagged UGE protein (80-800 µg/ml) filtered through a 0.1-µm Ultrafree-MC centrifugal filter unit (Millipore) was measured with a DynaPro99 Dynamic Light Scattering instrument (Protein Solutions) at 20 °C. Results were analyzed using the instrument control software Dynamics (Protein Solutions). The molecular weight was calculated from the hydrodynamic radius using the default volume shape hydration model.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
UGE Isoforms Are Dimeric and Can Interact Homo- and Hetero-typically—All five A. thaliana UGE genes are predicted to code for polypeptides of 40 kDa (Table 1). Dynamic light scattering of all five UGEs indicates molecular masses between 64 and 103 kDa suggesting dimeric quaternary structure (Table 1). In agreement with that interpretation, all UGEs elute as single peaks corresponding to 73-93-kDa proteins in gel filtration experiments (Table 1). Yeast two-hybrid assays detect self-interaction of UGE proteins and reveal interaction between different UGE isoforms (Fig. 1). In this system the affinities of both homotypic and heterotypic interactions are relatively weak, leading to activation of the HIS but not of the ADE reporter genes.

View larger version (22K): [in this window] [in a new window]   FIGURE 2. Influence of general reaction conditions on the activity of A. thaliana UGE isoforms. A, influence of temperature (percentage of activity at optimal temperature). B, influence of buffer and pH (percentage of activity at optimal pH). MES buffer, pH 5-7, Tris/HCl buffer, pH 6.5-9.5. C, activity of UGEs at 40, 160, and 400 mM relative to salt-free control. For all panels: UGE1, ; UGE2, ; UGE3, ; UGE4, ; UGE5,.

Effect of Metabolites on UGE Activity—The activities of UGE1, -3, and -5 are not affected by the presence or absence of 0.1 mM NAD⁺. In contrast, UGE4 activity is increased almost 10-fold, and UGE2 activity is stimulated 1.7-fold by 0.1 mM NAD⁺(Table 2). Inclusion of 10 µM NADH in general has little effect; however, UGE4 is slightly inhibited. NADPH has a very weak inhibitory effect on all five isoforms. The most marked effect of various nucleotides on UGE activity was observed with UDP, which reduced UGE1 and UGE3 to 29-35% of control activity. All isoforms are more strongly inhibited by UDP than by the other nucleotides tested. Interestingly, UGE4 was the one isoform that was inhibited least by all nucleotides tested. Likewise, UGE4 was least inhibited by UDP-sugars, whereas the remaining isoforms were inhibited by UDP-D-glucuronic acid (78-94% of control), UDP-D-xylose (74-83%), UDP-L-arabinose (55-67%), and UDP-D-N-acetylglucosamine (77-90%).

We further investigated the effect of various combinations of NAD and NADH on UGE2 and UGE4 activity (Table 3). UGE2 is inhibited to 56% of control activity by a combination of 100 µM NADH and 10 µM⁺. UGE4 is maximally inhibited by the same combination (10% of controls) but is also inhibited by all other NAD⁺/NADH combinations.

View this table: [in this window] [in a new window]   TABLE 4 Conversion of UDP-Gal by UGE isoforms Different enzyme concentrations give slight variations in activity. The Michaelis constants (±S.D.) and catalytic efficiencies () were determined in Sigmaplot using best fit. The highest values (boldface) were used for the estimations of (see Table V).

View this table: [in this window] [in a new window]   TABLE 5 Conversion of UDP-Glc by UGE isoforms The approximate value is estimated from reaction velocities at saturating substrate concentrations (5-9 mM). The values are indirectly determined from the Haldane relationship, the highest value, its associated value, and Keq = 0.33.

View larger version (18K): [in this window] [in a new window]   FIGURE 3. Response of UGE2 and UGE4 to varying levels of NAD+. A, UGE2 activity (µmol·mg-1·min-1) means of three replicates and best fit curve of a two-site saturation model Ks1 = 0.13 nM, Ks2 = 2.3 µM; r2 = 0.72. B, UGE4 means of three replicates, and best fit curve of a one-site saturation model Ks = 3.6 µM; r2 = 0.97.

View larger version (79K): [in this window] [in a new window]   FIGURE 4. Expression of UGE genes. A, relative expression levels of UGE genes in various organs at different developmental stages. SE, seed; SD, seedling; CO, cotyledon; HY, hypocotyl; RA, radicle; RS, rosette; JL, juvenile leaf; AL, adult leaf; SL, senescent leaf; IF, inflorescence; FL, flower; RT, root; LR, lateral root; EZ, elongation zone. B, relative expression levels of UGE genes in various cell types at different developmental stages in root tips are represented by red color saturation. DIV, stage 1, division zone; ELO, stage 2, elongation zone; DIF, stage 3, differentiation and mature zone; LRC, lateral root cap; ST, stele; CO, cortex; EN, endodermis; AB, epidermis, atrichoblasts, tissues in black; columella, trichoblast, and pericycle are not included in the analysis (20).

View larger version (15K): [in this window] [in a new window]   FIGURE 5. Co-expression of UGE isoforms with a selection of metabolically related enzymes. A, network visualization. Spearman Rho rank correlation values (>0.1 in black, < -0.1 in red) in the abiotic stress roots matrix in CSB.DB were used to create a network visualization (manually redrawn for quality of presentation). B, metabolic pathway representation. Enzymes acting in carbohydrate biosynthesis and breakdown are in red and blue, respectively.

View larger version (117K): [in this window] [in a new window]   FIGURE 6. Localization of UGE1, -2, and 4 fluorescent protein fusions in roots. A, UGE1:CFP in root cap. B, UGE2:CFP in root cap. C and D, UGE1:CFP in root epidermis. E, UGE4:GFP in the root epidermis. UGE1 and UGE2 fusions are localized diffusely in the cytoplasm. UGE4:GFP is localized diffusely and is also enriched in granular intracellular structures. Scale bars = 20 µM.

UGE Isoforms Act in Both Directions in Vivo—To test the action of various UGE isoforms in planta, we expressed UGE1, -2, -3, and -4 as well as GalE from E. coli in the uge4 mutant under the control of the constitutive cauliflower mosaic virus 35S promoter. The loss of function of UGE4 results in dramatically swollen root epidermal cells (Fig. 8A, uge4), probably a result of defective cell wall matrix carbohydrate biosynthesis (13, 27). This phenotype is rescued by transformation of uge4 with a wild type UGE4 gene (13), as well as with all overexpressed UGE isoforms from A. thaliana and E. coli (Fig. 4A, 35S:UGE uge4). Mutants in UGE4 display a deficiency in fuco-galactosylated xyloglucan and arabinogalactan type II as highlighted by immunocytochemistry using the monoclonal antibodies CCRC-M1 and CCRC-M7, respectively (13). Like the morphological defects of uge4, the chemical cell wall defects are suppressed by overexpressing UGE1 (Fig. 8, B and C).

To test if the various UGE isoforms can act as UDP-D-galactose 4-epimerases in vivo, we made use of the observation that increased UGE activity enhances galactose tolerance (8). Transfer of 4-day-old untransformed wild type and uge4 mutant seedlings to media containing 40 mM D-galactose as the sole carbon source leads to the inhibition of lateral root outgrowth (Fig. 9A) and to necrosis in the primary root tip (Fig. 8B). Plants overexpressing UGE1, UGE2, UGE3, UGE4, or GalE do not show inhibition of lateral root outgrowth (Fig. 8A) and root necrosis (Fig. 8B) upon transfer to 40 mM D-galactose. All A. thaliana UGE coding sequences complement the inability of gal10 S. cerevisiae mutants to grow on a medium containing D-galactose as their sole carbon source, thus demonstrating their UDP-D-galactose 4-epimerase activity in vivo (Fig. 9C).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Dimeric Structure of Arabidopsis UGE Isoforms—X-ray crystallography and other studies suggest that UGEs are dimeric (3, 4, 28), although active monomers and tetramers were observed under certain experimental conditions (29-31). Gel chromatography of Vicia faba extract revealed a major UGE activity peak eluting around 78 kDa and two minor UGE peaks of 39 and 159 kDa suggesting an equilibrium of monomer, dimer, and tetramer favoring the dimeric form (32). Using a similar separation matrix to analyze recombinant purified UGEs, we have observed a single dimer peak in each case. This discrepancy could be due to technical reasons. Alternatively, in the previous study, post-translational modifications of the protein or binding to other protein species could have influenced the apparent molecular weight. Here we show that UGE isoforms interact homo- and heterotypically in yeast. Although it is possible that this is an artificial interaction, not occurring under normal expression conditions, the similar strength of homo- and heterotypic two-hybrid interactions is intriguing, as the combinatorial formation of heteromers in planta might dramatically increase the spectrum of potential enzyme properties.

View larger version (121K): [in this window] [in a new window]   FIGURE 7. Immunolocalization of UGE4 in the root epidermis. A, wild type roots; B, uge4 null mutant control. Gold particles (arrowhead) peripherally decorate Golgi stacks (G) and are localized diffusely in the cytoplasm (asterisk). No gold particles are found in the cytoplasm of the negative control. Scale bar = 0.5 µM.

View larger version (60K): [in this window] [in a new window]   FIGURE 8. UDP-galactose 4-epimerase activity in vivo. A, suppression of the root epidermal swelling in uge4 mutants by overexpressed UGEs. B, overexpressed UGE1 suppresses cell type-specific carbohydrate defects in uge4 mutants. Fuco-galactosylated xyloglucan and arabinogalactan type II epitopes are recognized in every cell type of wild type Col-0 roots by the monoclonal antibodies CCRC-M1 and CCRC-M7, respectively. The uge4 mutant lacks CCRC-M1 label in most cell layers and CCRC-M7 label in the epidermal layer. Overexpression of UGE1 restores ubiquitous labeling with both CCRC-M1 and CCRC-M7 in the uge4 mutant background.

Inhibition by Metabolites—Among various metabolites, we find that UDP and UDP-L-arabinose most efficiently inhibit individual UGE isoforms. Interestingly, UGE1 and UGE3 are more strongly inhibited by UDP than any of the other isoforms. When three of the six putative isoforms of GAE were characterized in three different laboratories (40-42), it was found that 2 mM UDP inhibits GAE4 (also known as AtGlcAE1) (40) but not GAE1 (41). It is unclear if inhibition by UDP plays a significant role in controlling enzyme activity in vivo. There is insufficient information on the intracellular levels of these metabolites in A. thaliana. However, in potato tubers the cytosolic concentration of UDP-Glc and UDP were determined previously at 747 and 52 µM, respectively (43). This means that under normal intracellular conditions, the inhibition of UGE1 and UGE3 by UDP might be rather limited. Similarly, the intracellular levels of UDP-D-xylose and UDP-L-arabinose are unknown, and it can only be hypothesized that the inhibitory effect of these metabolites on several nucleotide sugar interconversion enzymes might provide metabolic feedback regulation of nucleotide sugar biosynthesis in vivo.

View larger version (114K): [in this window] [in a new window]   FIGURE 9. UDP-galactose 4-epimerase activity in vivo. A, overexpressed UGEs suppress the toxic effect of 40 mM D-galactose on lateral root formation. Wild type Col-0 does not produce lateral roots on 40 mM D-galactose (group at top left), whereas 35S:UGE-transformed plants form normal root systems (other groups). B, root tips of Col-0 wild type become necrotically discolored after transfer to 40 mM D-galactose-containing medium (left). Overexpression of UGE2 suppresses root tip necrosis (right). C, all five UGE isoforms complement galactose auxotrophy of S. cerevisiae gal10 mutant. To select transformants the strain contains the Trp auxotrophy marker (upper row). Expression of plant and bacterial UGE restores growth on galactose as the sole carbon source (bottom row).

Biological Significance of Diverse UGE Isoforms—One possible explanation of the apparent biochemical redundancy of UGE and other nucleotide sugar interconversion enzymes in plants is the abundance and complexity of plant carbohydrates, in particular their developmental heterogeneity. The differential expression of kinetically diverse isoforms of nucleotide sugar metabolic enzymes might reflect the ability of each cell to fine-tune the activity of glycosyltransferases in response to external stresses. Co-expression and co-localization of sequentially acting enzymes might be necessary to achieve full control strength. Kinetically diverse isoforms might be better adapted to different physiological intracellular environments in different cell types and organs, especially in organisms devoid of systemic homeostasis.

	FOOTNOTES

 
^* C. B. performed enzyme kinetic experiments, J. R. performed biophysical studies and yeast experiments, A. R. contributed to data mining and K. F. performed immunogold labeling and electron microscopy. G. J. S. conceived of and supervised the project in the K. R. laboratory, and wrote the manuscript. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ Supported by the John Innes Foundation and recipient of additional funding from the United Kingdom Scholarship for International Research Students and the Janggen-Pöhn Foundation.

² Recipient of a John Innes Centre MSc scholarship.

³ To whom correspondence should be addressed: Dept. of Cell and Developmental Biology, John Innes Centre, Colney, Norwich NR4 7UH, United Kingdom. Tel.: 44-1603-450460; E-mail: georg.seifert{at}bbsrc.ac.uk.

⁴ The abbreviations used are: UGE, UDP-D-glucose/UDP-D-galactose 4-epimerase; BSA, bovine serum albumin; CSB.DB, comprehensive systems biology database; ECFP, enhanced cyan fluorescent protein; GAE, UDP-D-glucuronic acid 4-epimerase; PBS, phosphate buffered saline solution; SD, synthetic defined; MES, 4-morpholinoethanesulfonic acid.

⁵ J. Rösti, unpublished data.

	ACKNOWLEDGMENTS

 
We gratefully acknowledge the technical assistance of Richard Hughes with gel filtration, Clare Stevenson with dynamic light scattering, and Brian Wells with histology. Barry Martin and Maite Vicre performed high pressure freeze fixation in the laboratory of Chris Hawes. We thank Stephen Bornemann and Gary Sawers for stimulating comments and critical reading of the manuscript. Bacterial artificial chromosome clones were provided by the Arabidopsis Biological Resource Centre. Peter Dörmann kindly provided the gal10 yeast strain and the UGE1 overexpressing A. thaliana line ES7-2. Roger Hellens provided pGREENII-cauliflower mosaic virus 35S and Ken Shirasu the yeast two-hybrid vectors.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Feingold, D. S. (1982) in Encyclopedia of Plant Physiology (Loewus, F. A., and Tanner, W., eds) pp. 3-76, Springer-Verlag, Berlin
2. Mulichak, A. M., Bonin, C. P., Reiter, W. D., and Garavito, R. M. (2002) Biochemistry 41, 15578-15589[CrossRef][Medline] [Order article via Infotrieve]
3. Holden, H. M., Rayment, I., and Thoden, J. B. (2003) J. Biol. Chem. 278, 43885-43888[Free Full Text]
4. Shaw, M. P., Bond, C. S., Roper, J. R., Gourley, D. G., Ferguson, M. A., and Hunter, W. N. (2003) Mol. Biochem. Parasitol. 126, 173-180[CrossRef][Medline] [Order article via Infotrieve]
5. Ishiyama, N., Creuzenet, C., Lam, J. S., and Berghuis, A. M. (2004) J. Biol. Chem. 279, 22635-22642[Abstract/Free Full Text]
6. Reiter, W. D., and Vanzin, G. F. (2001) Plant Mol. Biol. 47, 95-113[CrossRef][Medline] [Order article via Infotrieve]
7. Seifert, G. J. (2004) Curr. Opin. Plant Biol. 7, 277-284[CrossRef][Medline] [Order article via Infotrieve]
8. Dörmann, P., and Benning, C. (1998) Plant J. 13, 641-652[CrossRef][Medline] [Order article via Infotrieve]
9. Ross, K. L., Davis, C. N., and Fridovich-Keil, J. L. (2004) Mol. Genet. Metab. 83, 103-116[CrossRef][Medline] [Order article via Infotrieve]
10. Thoden, J. B., Wohlers, T. M., Fridovich-Keil, J. L., and Holden, H. M. (2001) J. Biol. Chem. 276, 20617-20623[Abstract/Free Full Text]
11. Novelli, G., and Reichardt, J. K. (2000) Mol. Genet. Metab. 71, 62-65[CrossRef][Medline] [Order article via Infotrieve]
12. Zhang, Q., Hrmova, M., Shirley, N. J., Lahnstein, J., and Fincher, G. B. (2006) Biochem. J. 394, 115-124[CrossRef][Medline] [Order article via Infotrieve]
13. Seifert, G. J., Barber, C., Wells, B., Dolan, L., and Roberts, K. (2002) Curr. Biol. 12, 1840-1845[CrossRef][Medline] [Order article via Infotrieve]
14. Oomen, R. J. F. J., Bang, D.-T., Tzitzikas, E. N., Bakx, E. J., Schols, H. S., Visser, R. G. F., and Vincken, J.-P. (2004) Plant Sci. 166, 1097-1104
15. Cornish-Bowden, A. (2004) Fundamentals of Enzyme Kinetics, 3rd Ed., pp. 23-70, Portland Press Ltd., London
16. Hellens, R. P., Edwards, E. A., Leyland, N. R., Bean, S., and Mullineaux, P. M. (2000) Plant Mol. Biol. 42, 819-832[CrossRef][Medline] [Order article via Infotrieve]
17. Clough, S. J., and Bent, A. F. (1998) Plant J. 16, 735-743[CrossRef][Medline] [Order article via Infotrieve]
18. Jolliffe, N. A., Brown, J. C., Neumann, U., Vicre, M., Bachi, A., Hawes, C., Ceriotti, A., Roberts, L. M., and Frigerio, L. (2004) Plant J. 39, 821-833[CrossRef][Medline] [Order article via Infotrieve]
19. Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L., and Gruissem, W. (2004) Plant Physiol. 136, 2621-2632[Abstract/Free Full Text]
20. Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lambert, G. M., Galbraith, D. W., and Benfey, P. N. (2003) Science 302, 1956-1960[Abstract/Free Full Text]
21. Steinhauser, D., Usadel, B., Luedemann, A., Thimm, O., and Kopka, J. (2004) Bioinformatics (Oxf.) 20, 3647-3651[Abstract/Free Full Text]
22. Rawat, A. (2005) Analysis of Time Series Microarray Data. M.Sc. thesis, School of Computing Sciences, University of East Anglia, Norwich
23. Seifert, G. J., Barber, C., Wells, B., and Roberts, K. (2004) Plant Cell 16, 723-730[Abstract/Free Full Text]
24. Madson, M., Dunand, C., Li, X., Verma, R., Vanzin, G. F., Caplan, J., Shoue, D. A., Carpita, N. C., and Reiter, W. D. (2003) Plant Cell 15, 1662-1670[Abstract/Free Full Text]
25. Li, X., Cordero, I., Caplan, J., Molhoj, M., and Reiter, W. D. (2004) Plant Physiol. 134, 940-950[Abstract/Free Full Text]
26. Blazquez, M. A., Santos, E., Flores, C. L., Martinez-Zapater, J. M., Salinas, J., and Gancedo, C. (1998) Plant J. 13, 685-689[CrossRef][Medline] [Order article via Infotrieve]
27. Andeme-Onzighi, C., Sivaguru, M., Judy-March, J., Baskin, T. I., and Driouich, A. (2002) Planta 215, 949-958[CrossRef][Medline] [Order article via Infotrieve]
28. Thoden, J. B., and Holden, H. M. (2005) J. Biol. Chem. 280, 21900-21907[Abstract/Free Full Text]
29. Brahma, A., and Bhattacharyya, D. (2004) FEBS Lett. 577, 27-34[CrossRef][Medline] [Order article via Infotrieve]
30. Nayar, S., and Bhattacharyya, D. (1997) FEBS Lett. 409, 449-451[CrossRef][Medline] [Order article via Infotrieve]
31. Darrow, R. A., and Rodstrom, R. (1966) Proc. Natl. Acad. Sci. U. S. A. 55, 205-212[Free Full Text]
32. Dey, P. M. (1984) Phytochemistry 23, 729-732[CrossRef]
33. Druzhinina, T. N., Novikova, M. A., and Shibaev, V. N. (1969) Biochimie (Paris) 34, 108-114
34. Dalessandro, G., and Northcote, D. H. (1977) Biochem. J. 162, 267-279[Medline] [Order article via Infotrieve]
35. Dalessandro, G., and Northcote, D. H. (1977) Biochem. J. 162, 281-288[Medline] [Order article via Infotrieve]
36. Prosselkov, P. V., Gross, W., Igamberdiev, A. U., and Schnarrenberger, C. (1996) Physiol. Plant. 98, 753-758
37. Dormann, P., and Benning, C. (1996) Arch. Biochem. Biophys. 327, 27-34[CrossRef][Medline] [Order article via Infotrieve]
38. Fan, D. F., and Feingold, D. S. (1968) Plant Physiol. 44, 599-604
39. van Dongen, J. T., Schurr, U., Pfister, M., and Geigenberger, P. (2003) Plant Physiol. 131, 1529-1543[Abstract/Free Full Text]
40. Gu, X., and Bar-Peled, M. (2004) Plant Physiol. 136, 4256-4264[Abstract/Free Full Text]
41. Molhoj, M., Verma, R., and Reiter, W. D. (2004) Plant Physiol. 135, 1221-1230[Abstract/Free Full Text]
42. Usadel, B., Schluter, U., Molhoj, M., Gipmans, M., Verma, R., Kossmann, J., Reiter, W. D., and Pauly, M. (2004) FEBS Lett. 569, 327-331[CrossRef][Medline] [Order article via Infotrieve]
43. Farre, E. M., Tiessen, A., Roessner, U., Geigenberger, P., Trethewey, R. N., and Willmitzer, L. (2001) Plant Physiol. 127, 685-700[Abstract/Free Full Text]
44. Winkel, B. S. (2004) Annu. Rev. Plant. Biol. 55, 85-107[CrossRef][Medline] [Order article via Infotrieve]
45. Albrecht, G., and Mustroph, A. (2003) Planta 217, 252-260[Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				F. Moyrand, I. Lafontaine, T. Fontaine, and G. Janbon UGE1 and UGE2 Regulate the UDP-Glucose/UDP-Galactose Equilibrium in Cryptococcus neoformans Eukaryot. Cell, December 1, 2008; 7(12): 2069 - 2077. [Abstract] [Full Text] [PDF]

				J. Rosti, C. J. Barton, S. Albrecht, P. Dupree, M. Pauly, K. Findlay, K. Roberts, and G. J. Seifert UDP-Glucose 4-Epimerase Isoforms UGE2 and UGE4 Cooperate in Providing UDP-Galactose for Cell Wall Biosynthesis and Growth of Arabidopsis thaliana PLANT CELL, May 1, 2007; 19(5): 1565 - 1579. [Abstract] [Full Text] [PDF]

				T. Oka, T. Nemoto, and Y. Jigami Functional Analysis of Arabidopsis thaliana RHM2/MUM4, a Multidomain Protein Involved in UDP-D-glucose to UDP-L-rhamnose Conversion J. Biol. Chem., February 23, 2007; 282(8): 5389 - 5403. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 281/25/17276    most recent M512727200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Barber, C. Articles by Seifert, G. J. Search for Related Content PubMed PubMed Citation Articles by Barber, C. Articles by Seifert, G. J. Social Bookmarking                      What's this?