Originally published In Press as doi:10.1074/jbc.M601645200 on May 10, 2006
J. Biol. Chem., Vol. 281, Issue 28, 19115-19123, July 14, 2006
This article has been withdrawn by the author
Identification of a Specific Domain Required for Dimerization of Activation-induced Cytidine Deaminase*
Jishu Wang,
Reiko Shinkura,
Masamichi Muramatsu,
Hitoshi Nagaoka,
Kazuo Kinoshita, and
Tasuku Honjo1
From the
Department of Immunology and Genomic Medicine, Graduate School of Medicine, Kyoto University, Yoshida, Sakyo-ku, Kyoto 606-8501, Japan
Received for publication, February 21, 2006
, and in revised form, April 6, 2006.
 |
ABSTRACT
|
|---|
Activation-induced cytidine deaminase (AID) is essential to all three genetic alterations required for generation of antigen-specific immunoglobulin: class switch recombination, somatic hypermutation, and gene conversion. Here we demonstrate that AID molecules form a homodimer autonomously in the absence of RNA, DNA, other cofactors, or post-translational modifications. Studies on serial deletion mutants revealed the minimum region between Thr27 and His56 responsible for dimerization. Analyses of point mutations within this region revealed that the residues between Gly47 and Gly54 are most important for the dimer formation. Functional analyses of these mutations indicate that all mutations impairing the dimer formation are inefficient for class switching, suggesting that dimer formation is required for class switching activity. Dimer formation and its requirement for the function of AID are features that AID shares with APOBEC-1, an RNA editing enzyme of apolipoprotein B100 mRNA.
 |
INTRODUCTION
|
|---|
Activation-induced cytidine deaminase (AID)2 is essential to class switch recombination (CSR) and somatic hypermutation (SHM) in human and mice (1, 2) and gene conversion in chickens (3, 4), the three genetic alterations that occur in mature B cells. Expression of AID is not only essential but also sufficient to the three events described above, although they are different in their mechanisms as well as reaction products (58). AID is thus the key molecule for generation of the antigen-specific immunoglobulin (Ig) with various isotypes. CSR takes place between two switch (S) regions located upstream of each constant region of the Ig heavy chain (CH) gene except for C
. CSR causes intrachromosomal deletion of the intervening DNA segment including C genes, resulting in replacement of the C regions and alteration of effector functions of Ig. SHM generates innumerable variations in the antigen-binding site of Ig by a high rate of mutagenesis focused on the Ig V region. In gene conversion, the V region is diversified by homologous recombination utilizing pseudo-V genes as template. AID has been shown to be involved in the DNA cleavage step of CSR and SHM, but its detailed molecular mechanism is elusive and intensively debated (912).
The AID protein contains 198 amino acid residues with several structural and functional domains. It is proven that the N terminus and C terminus of AID are responsible for SHM and CSR, respectively, because mutations in the N terminus of AID resulted in severe reduction of SHM, whereas CSR is intact (13, 14) and vice versa (15). Among the functionally characterized genes, the most homologous to AID is an RNA-editing enzyme, APOBEC-1, the catalytic subunit of the apolipoprotein (apo) B100 mRNA-editing enzyme (16, 17), which deaminates cytidine to uridine at 6666 of apoB100 mRNA, generating apoB48 mRNA by introducing the UAA stop codon in place of the CAA glutamine codon (18). Translation of apoB100 and apoB48 mRNAs produces the protein components of low density lipoprotein and chylomicron, respectively. Genetically the genes encoding AID and APOBEC-1 are located in a close proximity on the same chromosome of human and mouse (19, 20), implying that they are derived by a recent duplication event. Functionally both proteins possess a nuclear localization signal and a nuclear export signal at their N terminus and C terminus, respectively (21, 22), which endue them with shuttling between the nucleus and cytoplasm, a requisite of the RNA-editing enzymes. Similar three-dimensional structures of AID and APOBEC-1 were predicted based on the crystallographic analyses of yeast (Saccharomyces cerevisiae) cytosine deaminase D1 (CDD1) (23).
APOBEC-1 has been shown to function as a dimer (24, 25). The dimerization of APOBEC-1 creates an active structure that is essential for its RNA binding and deamination activity of apoB mRNA (25). Mutations abolishing dimerization of APOBEC-1 also destroy its RNA binding and editing activities (24), although the dimerization motif, the RNA-binding region, and the catalytic site do not completely overlap in APOBEC-1. Deletion of either 7 residues from the N terminus or 5 residues from the C terminus disrupts the dimer formation of APOBEC-1 (24), suggesting that both N terminus and C terminus might be vital for the dimerization of APOBEC-1. On the other hand, Teng et al. (25) reported that two C-terminal regions (from Leu196 to Leu210 and from Leu221 to Lys229) of APOBEC-1 are equally critical for dimerization.
AID is 31 residues shorter than APOBEC-1 with 9 and 24 residues missing in the N terminus and C terminus, respectively, that were reported to be critical for the dimerization in APOBEC-1 (24, 25). However, the C-terminal deletion mutants of AID, known as JP8B, P20, and JP41, still maintain the SHM activity (15). Moreover the regions of APOBEC-1 (Leu196Leu210 and Leu221Lys229) that were reported to be important for its dimerization (25) are not conserved in AID. Although AID has been shown to form a multimeric complex (15), the exact nature of the AID multimer is not known. Therefore, it is important to examine whether AID exists as a dimer and if so to identify the motif(s) responsible for its dimerization.
To answer these questions, we constructed AID and its mutants with different tags and co-expressed and immunoprecipitated them by different antibodies. These studies clearly showed that the dimer is the major species of AID multimer in cells, and its formation is dependent on the residues between Gly47 and Gly54. Furthermore we demonstrated that the AID mutations that affect dimerization also impair CSR activity, indicating that the dimer formation is required for AID function.
 |
MATERIALS AND METHODS
|
|---|
ConstructsDeletion and truncation mutants of AID were produced by PCR with wild-type AID cDNA as a template. Mouse AID was used except for the experiments in Fig. 3 in which truncation and deletion mutants of human (h) AID were used. For N-terminal truncation constructs of hAID, a Kozak sequence was added to the 5'-end by PCR to facilitate protein expression. The amplified fragments were digested with EcoRI and BamHI and inserted into pEGFP-N1 (Clontech) restricted with the same enzymes, generating vectors expressing mutant hAID fused with GFP at the C terminus. Alternatively the mutant hAID cDNAs were inserted into pCMV-Flag-ER (15) to generate mutant hAID fused with FLAG-ER at C terminus. The internal deletion mutant (hAIDdel2680) was generated by ligating PCR-amplified N- and C-terminal parts of AID with a GGSGG linker (5'-ggaggtagcggaggt-3'). Full-length AID with different tags at C termini were generated by PCR and were cloned into pcDNA5 (Invitrogen) to construct expression vectors. The AID-Myc and AID-Myc·His contained 33 and 21 extra residues, which were encoded by the sequences aatggagaacagaaattgatcagtgaggaagacctcaacggtgagcagaagttaatatccgaggaggatcttaatagttgtctagagggccctattcta (NGEQKLISEEDLNGEQKLISEEDLNSCLEGPIL) and aatggagaacagaaattgatcagtgaggaagacctcaacggtgagcagaagttaatatccgag (NGEQKLISEEDLNGEQKLISE), respectively. All constructs were confirmed by DNA sequencing. Mutants with amino acid replacements were generated by PCR.
Cell Culture and TransfectionThe 293T cells were maintained in Dulbecco's modified Eagle's medium (Sigma) containing 10% fetal calf serum, 2 mM L-glutamine, 100 units/ml penicillin, and 100 mg/ml streptomycin. Cells were transfected with plasmid DNA using liposomes (Lipofectamine 2000, Invitrogen) according to the manufacturer's instructions.
Immunoprecipitation and Western BlottingCells (293T) were lysed 60 h after transfection in an ice-cold lysis buffer (1% Nonidet P-40, 150 mM NaCl, 50 mM Tris-HCl, pH 7.5). Cell lysates were centrifuged at 12,000 x g at 4 °C. For immunoprecipitation, cell lysates with an equal amount of total proteins were incubated with antibodies (Sigma, anti-c-Myc-agarose and anti-FLAG M2 affinity gel). After washing with the lysis buffer, the co-precipitated proteins were fractionated on an SDS, 12% polyacrylamide gel and transferred to the nitrocellulose membrane. The membrane was probed with antibodies as indicated in Fig. 1 and visualized using the ECL reagents (Amersham Biosciences). Anti-AID antibodies were described previously (14, 15).
Purification of SUMO-AIDMouse AID cDNA was cloned into pSUMO vector (Life Sensors, Malvern, PA) to generate an in-frame fusion to the C terminus of SUMO, and the construct was transformed into BL21-CodonPlusTM (Stratagene). A 1-liter culture was induced with 0.1 mM isopropyl
-D-thiogalactoside and incubated for 24 h at 25 °C. The bacteria were lysed and sonicated in the lysis buffer (40 mM Tris, pH 8.0, 40 mM KCl, 50 mM NaCl, 10% glycerol, 1% CHAPS). The lysate was cleared by centrifugation at 100,000 x g for 1 h and followed by incubation with Ni2+-NTA beads (Qiagen) with 20 mM imidazole for 2 h at 4°C. The beads were washed three times with the lysis buffer containing 80 mM imidazole and 500 mM NaCl, and bound protein was eluted twice in 2.5 ml of elution buffer (40 mM KCl, 50 mM NaCl, 10% glycerol, 1% CHAPS, 500 mM NaCl, 500 mM imidazole) at 4 °C. Eluted proteins were concentrated and dialyzed in 45 mM Tris, pH 7.4, and the purity of SUMO-AID proteins was more than 90% by Coomassie Bluestained PAGE analysis.
MiceAID-deficient mice on a C57BL/6 background were maintained in our animal facility and were used at 23 months of age (1). All mouse protocols were approved by the Institute of Laboratory Animals, Faculty of Medicine, Kyoto University (Kyoto, Japan).
Bacterial Two-hybrid AssayMutant and wild-type AIDs were subcloned into pBT and pTRG vectors, respectively (BacterioMatch II two-hybrid system, Invitrogen). pBT- and pTRG-derived constructs were co-transformed into reporter competent cells following the instruction manual. Briefly 1 µg of pBT and 1 µg of pTRG construct transformed 100 µl of competent cells; after heat shock the 100 µl of competent cells were diluted into 5 ml of SOC culture medium (0.5% yeast extract, 2% tryptone, 10 mM NaCl, 2.5 mM KCL, 10 mM MgCl2, 20mM MgSO4, 20 mM glucose). After 2-h induction with isopropyl
-D-thiogalactoside, 5 µl of 5 ml were spread onto the non-selective Petri dish to calculate transformation efficiency. The rest of the cells were spun down and spread onto the selective Petri dish containing 5 mM 3-amino-1,2,4-triazole. The culture Petri dishes were incubated at 30 °C for 2.5 days, and colonies were counted.
In Vitro Assays for CSRFor retrovirus infection, cDNAs of mouse wild-type AID and mutants were inserted into pMSCV-IRES-GFP (14). The preparation and infection of retroviruses were described previously (1, 14, 15). For CSR, stimulated and infected AID-deficient spleen B cells positive for GFP were analyzed for surface IgG1 expression by flow cytometry 3 days after infection. Cells were stained with biotinylated antibody to IgG1 (anti-IgG1, Pharmingen) followed by incubation with allophycocyanin-labeled streptavidin. The same population of cells was analyzed by Western blot with anti-AID antibodies (14).
 |
RESULTS
|
|---|
Autologous Multimerization of AIDAlthough the size exclusion chromatography and glycerol gradient sedimentation revealed the presence of AID in a complex larger than 200 kDa,3 it is not clear whether AID itself forms multimers or many other cellular components are associated with AID. It has been reported that AID associates with nucleic acids in various cells (26, 27). We therefore first examined whether AID forms a stable multimeric complex in the absence of nucleic acids. For this purpose, we used FLAG- and Myc-tagged mouse AID and expressed them in 293T cells by transfection of an equal amount of two plasmids. An additional 33 irrelevant residues were fused to the Myc epitope to distinguish AID-FLAG and AID-Myc by their molecular sizes. Cell lysates were immunoprecipitated with anti-FLAG monoclonal antibody (mAb)-conjugated agarose (M2 beads) and then analyzed by Western blot with specific antibodies to AID. Both FLAG- and Myc-tagged AIDs were detected in the precipitates in approximately similar amounts in agreement with the previous report (15). The multimeric complex formed in vivo was resistant to the treatment with RNase, DNase, or EDTA before immunoprecipitation (Fig. 1A). Neither AID itself nor Myc-tagged AID can interact with M2 beads directly (data not shown). The heteromeric multimer formation of AID was confirmed by reciprocal experiments in which two recombinant AID proteins were immunoprecipitated with anti-Myc mAb and then detected by anti-AID antibodies (data not shown).

View larger version (46K):
[in this window]
[in a new window]
|
FIGURE 1. Autonomous multimerization of AID. A, immunoprecipitation. AID-Myc and AID-FLAG fusion proteins were co-expressed in 293T cells. Cell lysates were immunoprecipitated using the anti-FLAG mAb, and co-precipitated proteins were detected by Western blotting using anti-AID antibodies. Cell lysates were treated with 10 units of DNase I, 10 units of RNase A, 10 units of RNase H, 10 units of RNase inhibitor, or 25 mM EDTA as indicated at 37 °C for 30 min before the immunoprecipitation assay. AID-Myc and AID-FLAG are indicated by arrows on the right side. B, AID-Myc and AID-FLAG were expressed in 293T cells separately by transfection. Cell lysates were mixed together followed by immunoprecipitation using anti-FLAG mAb and detection using anti-AID antibodies after Western blotting. C, cell lysates were prepared and immunoprecipitated as in B except that the lysates were treated with 10 units of DNase I, 10 units of RNase A, 10 units of RNase H, or 10 units of RNase inhibitor as indicated at 37 °C for 30 min before immunoprecipitation. D, the scheme shown indicates the steps for formation of AID complexes in vitro. Multimers of AID-FLAG·His ( ) and AID-Myc·His ( ) were expressed in 293T cells and dissociated by 8 M urea treatment to generate monomer of each ( and ). The AID monomers with different tags were mixed, refolded ( ), and analyzed by immunoprecipitation using anti-Myc ( ), anti-FLAG ( ), or anti-Myc followed by anti-FLAG mAb ( ). Below the scheme were analyzed by Western blotting using anti-AID antibodies. E, AID-FLAG was expressed in 293T cells by transfection. Cell lysates were incubated with purified SUMO-AID expressed in E. coli. Interacting proteins were co-immunoprecipitated with anti-FLAG mAb, and precipitates were analyzed by anti-AID antibodies. IP, immunoprecipitate; WB, Western blot; Ab, antibody.
|
|

View larger version (40K):
[in this window]
[in a new window]
|
FIGURE 2. Oligomerization state of AID. A, schematic representation of the experimental procedure. Three types of differentially epitope-tagged AID molecules (AID-His, AID-GFP, and AID-HA·FLAG, shown as open, closed, and hatched, respectively) were co-expressed in 293T cells by co-transfection. Cell lysates were precipitated sequentially using Ni2+-NTA and anti-FLAG M2 beads. Precipitated AID fusion proteins at each step were monitored by Western blotting using anti-AID antibodies. Theoretical compositions of the AID complexes in dimers, trimers, and tetramers, from which the ratio of three types of AID can be calculated, are shown below. B, Western blot analysis of immunoprecipitated AID molecules. Cells (293T) were transfected with plasmids indicated at the top. Cell lysates were precipitated with Ni2+-NTA and/or anti-FLAG M2 beads as indicated at the bottom and analyzed as described above. AID-GFP, AID-HA·FLAG, and AID-His are indicated by arrows on the right. WB, Western blot; Ab, antibody.
|
|
When we combined separately expressed AID-Myc and AID-FLAG proteins, an almost equal amount of two AID monomers was precipitated by the anti-FLAG mAb indicating that the monomers in the AID multimeric complex can be exchanged (Fig. 1B). We then treated both cellular extracts with RNase or DNase before mixing and examined the heteromultimer formation in vitro. As shown in Fig. 1C, the treatment with neither RNase nor DNase inhibited the multimer formation of AID derived from different extracts. These results suggest that the AID multimer formation is independent of binding to nucleic acids.
To further confirm dispensability of cofactors such as oligonucleotides for the AID multimer formation, we carried out denaturation and renaturation of AID tagged with either FLAG-His or Myc-His, which was expressed separately in 293T cells. Cell lysates were denatured in 8 M urea after RNase A and DNase I treatments, and then the AID recombinant proteins were purified by the Ni2+ affinity resin (Fig. 1D). This treatment would remove all potentially remaining fragments of DNA or RNA from AID. Two denatured and purified recombinant AID proteins were mixed to form the multimeric complex while refolding by gradient dialysis. After 48-h dialysis, co-immunoprecipitation was performed separately or tandemly by the anti-FLAG and anti-Myc mAbs. Obviously dialysis could not refold all AID molecules. The unrefolded proteins lost the ability to associate with their partners because one-step precipitation with either the anti-FLAG or anti-Myc mAb caused a strong bias of two protein ratios in favor of that with the epitope of the mAb used (Fig. 1D, lanes 6 and 7). However, the multimer still formed in vitro by the refolded AID because approximately an equal ratio of two-epitope AID was obtained by tandem immunoprecipitation with anti-FLAG and anti-Myc mAbs (Fig. 1D, lane 8). Thus we concluded that DNA or RNA molecules are not required for AID multimer formation. In addition it is unlikely that AID multimerization depends on other non-covalently associated cofactors because 8 M urea denaturation should strip off such cofactors.
To examine whether specific modifications are required for multimerization of AID, the recombinant SUMO-AID purified from Escherichia coli was mixed with AID-FLAG produced in 293T cells, and the complex was immunoprecipitated with anti-FLAG mAb. As shown in Fig. 1E, E. coli SUMO-AID was co-immunoprecipitated with 293T-produced AID-FLAG. Because E. coli is unlikely to have post-translational modifications of AID similar to those in eukaryotic cells, AID multimerization appears to be independent of the post-translational modification.

View larger version (52K):
[in this window]
[in a new window]
|
FIGURE 3. Identification of the region responsible for AID dimerization. A, functional domains of AID are shown at the top. A schematic diagram of hAID with different truncations or internal deletions is shown. Results of immunoprecipitation assays are summarized on the right. R190X (X represents stop codon) data are taken from Ref. 14. Mutant hAID molecules were tagged with GFP at their C termini, whereas the wild-type mAID was tagged with FLAG at the C terminus. (N.D., not done). B, Co-immunoprecipitation assay. 293T cells were transfected with expression vectors for the wild-type mAID-FLAG and a GFP-tagged mutant hAID, with the wild-type hAID-GFP as a positive control. Cell lysates were immunoprecipitated with anti-FLAG M2 agarose, and co-precipitated proteins were detected by anti-GFP and anti-AID antibodies, except for the experiments using Glu26His56 (E25H56), Glu26Trp80 (E26 W80), His56Phe108 (H56 F108) in which anti-GFP and anti-FLAG mAb were used. For the interaction with the mutant itself, the constructs expressing the same hAID mutants tagged with GFP and FLAG-ER were co-transfected 293T cells, and cell lysates were immunoprecipitated with anti-FLAG M2 agarose, and co-precipitated proteins were detected by anti-GFP and anti-AID antibodies. (*, indicates the position of the missing band; **, indicates the anti-GFP and anti-FLAG mAb were used for Western blot.) NLS, nuclear localization signal; NES, nuclear export signal; IP, immunoprecipitate; WB, Western blot; wt, wild-type; Ab, antibody.
|
|
Homodimer Is the Major Species of the AID MultimerWe then used a sequential precipitation approach to determine the exact oligomeric state of AID. AID molecules fused with three different epitopes, FLAG, His, or GFP at the C terminus, were co-expressed in 293T cells using approximately equal amounts of plasmid DNA. The cell lysates were first precipitated by the Ni2+ affinity resin and then by anti-FLAG M2-agarose as depicted in Fig. 2A. Each precipitation step was monitored by Western blot using anti-AID antibodies. After the first precipitation, all three isoforms of AID should be detected if all types of AID can freely interact (Fig. 2A). However, the subsequent precipitation with anti-FLAG mAb would distinguish the dimer from the other oligomeric forms. Only His- and FLAG-tagged AID heterodimer would remain in the precipitates in case of the dimeric form, whereas additional AID-GFP should co-exist in case of the larger oligomers. Precipitation with Ni2+ affinity or anti-FLAG-agarose showed that GFP-, His-, and FLAG-tagged AID can interact with each other equally and randomly to form oligomeric complexes regardless of the tag difference (Fig. 2B). However, only AID-FLAG and AID-His were precipitated after the tandem treatment with the Ni2+ affinity resin and anti-FLAG-agarose, indicating that AID formed predominantly the dimer. AID-GFP in the sequential precipitates was quantitated by densitometry and shown to be less than 1% of AID-FLAG, indicating that the trimer, tetramer, or the other larger oligomeric states are unlikely because the trimer and tetramer formation should co-precipitate AID-GFP in the amount equivalent to 30 and 40% of AID-FLAG, respectively (Fig. 2A). The reciprocal procedure using first anti-FLAG M2-agarose and then Ni2+ affinity resin yielded the same result (data not shown), indicating that our immunoprecipitation scheme did not selectively enrich one form of the tagged AID. Thus we concluded that the dimeric state is the dominant structure of AID in mammalian cells.

View larger version (36K):
[in this window]
[in a new window]
|
FIGURE 4. Single mutation assay for mAID dimerization. A, the internal deletion mutant del26 80 and point mutants R50A, N51A, S38A, and D45A tagged by FLAG-GFP epitope were co-expressed with wild-type mAID in 293T cells, cell lysates were immunoprecipitated using the anti-FLAG M2-agarose, and co-precipitated proteins were detected by Western blotting using anti-AID antibodies. B, bacterial two-hybrid assay. The mAID mutants del26 80, R50A, N51A, S38A, and D45A were co-transformed with wild-type mAID into bacterial reporter strain. The survival rate reflects the interaction between the target and bait AID. IP, immunoprecipitate; WB, Western blot; wt, wild-type; Ab, antibody.
|
|
Specific Region Required for DimerizationTo define the regions that are required for dimerization, we constructed a series of C- and N-terminal deletion mutants of hAID with the GFP tag (Fig. 3A) and co-expressed them with wild-type mouse (m) AID-FLAG in 293T cells. Because hAID and mAID have only a 7-residue difference in 198 residues, this pair should represent homologous interactions; we confirmed this below. All C-terminal deletion mutants of hAID we generated were expressed in comparable amounts, although some of them had a slightly reduced expression compared with the wild type (Fig. 3B). All of them associated with wild-type mAID. However, a C-terminal deletion mutant H56X (where X represents stop codon) associated with the wild-type mAID much more weakly than the other truncation mutants including W80X (Fig. 3B). N-terminal deletion of 30 and 40 residues abolished the expression of hAID (data not shown), whereas deletion of 20 and 26 residues (
20 and
26, respectively) did not appear to affect stability of hAID drastically (Fig. 3B). Because
20 and
26 could form the dimer, the N- and C-terminal deletion experiments indicate that the region between residue 27 (Thr27) and residue 79 (Thr79) appears to be required for dimerization. When we measured interaction between the identical mutant with different tags, the results were similar to those of interaction of each mutant AID with wild-type mAID (Fig. 3A, Interaction with itself).
To confirm this we tested the truncation mutants Glu26 Trp80, Glu26His56, and His56Phe108 for their ability to form the dimer with mAID. Glu26Trp80 formed the dimer despite its low expression. Glu26His56 interacted with wild-type AID very weakly but significantly. His56Phe108 failed to form the dimer. However, truncation experiments cannot exclude the possibility that another alternative region also contributes to dimerization. To exclude this possibility, the residues between Glu26 and Trp80 or between Glu58 and Cys93 were deleted, and the remaining N- and C-terminal regions were ligated again by a GGSGG linker to make AIDdel2680 and AIDdel5893, respectively. AIDdel2680 mutant, although expressed at a level similar to Glu26Trp80, showed no interaction with the mAID or itself. By contrast AIDdel5893 interacted with mAID or itself weakly but significantly. These results taken together indicated that the region between Glu26 and His56 is necessary and sufficient for dimerization of AID.
We confirmed the ability of dimer formation of mAIDdel2680 with wild-type mAID (Fig. 4A). We then analyzed many mutants in the region between Glu26 and Leu60 for interaction between mutants and the wild-type AID by co-immunoprecipitation to find out the critical residue(s) for dimerization (Table 1). Each mutant and the wild-type AID were fused to FLAG and Myc epitope tags, respectively, and the mutants were further tagged with GFP to distinguish them from the wild-type molecule by size. Most mutants interacted with the wild-type AID with efficiencies comparable to that between two wild-type AID molecules except for R50A, N51A, K52A, and G54A, which showed a significant (to less than 70%) reduction of the interaction (Fig. 4A and Table 1). Other mutants such as AIDS38A and AIDD45A did not affect the ability to form dimer. We tried but failed to analyze the combined effect of mutations (R50A, N51A, K52A, and G54A) on dimerization because all triple or quadruple mutations severely inhibited their expression in either 293T or B cells.
View this table:
[in this window]
[in a new window]
|
TABLE 1 Effect on dimer formation by point mutations of mAID
Dimer formation was measured by immunoprecipitation as described in Fig. 4. CSR activity was measured in AID/ B cells as described in Fig. 5. Bold amino acids indicate conservation among all known AIDs. , not done.
|
|
We then used the bacterial two-hybrid system (28) to further evaluate the interaction between the wild type and mutant AID. The system, in which the interaction between the bait and the prey proteins is semiquantitatively displayed by co-transformation of the host bacterium containing the reporter gene cassette, has been successfully used to detect the dimerization of APOBEC-1, another RNA-editing enzyme (data not shown). Mutant and the wild-type AID were subcloned into the bait and the target plasmids, respectively. Pairs of the tested plasmids were co-transformed into the host bacterium, and the protein-protein interaction was quantified with that between two wild-type AID molecules as a positive control. The results showed that AIDdel2680 lost 85% of binding, whereas AIDR50A and AIDN51A lost 40 and 75% of binding to wild-type AID, respectively, compared with that of the wild-type AID (Fig. 4B). Other mutants such as AIDD45A showed almost equivalent binding with that of the wild-type AID, generally consistent with the co-immunoprecipitation assay. These results taken together indicated that the region between Gly47 and Gly54 appears to contain the important motif required for the dimerization of AID.
Functional Significance of DimerizationTo examine whether the dimer formation is required for AID function, we tested many mutants including truncation and base substitution by introducing them into AID-deficient spleen B cells. R50A and N51A mutants, which failed to dimerize efficiently with wild-type AID, lost around 90% of CSR activity compared with the wild-type AID (Fig. 5A), although their proteins were abundant (Fig. 5B). By contrast AIDS38A and AIDD45A mutants, which retained the dimerization capacity, showed more than 60% of CSR activity. AID mutants that had impaired ability to form dimer reduced or abolished the CSR activity (Table 1). Therefore, we conclude that the dimer formation is necessary but not sufficient for AID function.
 |
DISCUSSION
|
|---|
The present study has demonstrated that AID functions as a dimer. The formation of the dimer is autonomous and independent of modifications and cofactors including nucleic acids. It is therefore likely that AIDs once synthesized associate with each other to form a dimer, and then the dimer interacts with nuclear localization signal components at the N terminus and with putative substrate specificity cofactors for either CSR or SHM at respective domains. The AID complex binds and deaminates the substrate in the nucleus and then interacts at the C terminus with nuclear export signal components, which export the complex to the cytoplasm. The large AID complex of 200 kDa should represent the heteromeric complex including AID dimer. We confirmed the percentage of AID dimer in the nucleus as well as cytoplasm (data not shown).
Dimer formation and its requirement for the function of AID are characteristics that are shared by APOBEC-1 RNA-editing enzyme (24, 25). Other similarities include conservation of amino acid sequences, localization in close proximity on human and mouse chromosomes (19, 20), shuttling between the nucleus and cytoplasm (21, 22), requirement for substrate-specific cofactor (14, 15, 18), and binding to RNA and DNA (29, 30). Oligomer formation is a common feature in the cytidine deaminase family in various species: dimer (E. coli), tetramer (Bacillus subtilis and yeast), and hexamer (T4-bacteriophage 2'-deoxycytidine deaminase as well as human) were reported (3133). The dimeric structure of AID and APOBEC-1 was predicted based on the three-dimensional structure of yeast cytosine deaminase that can also edit apoB mRNA in yeast (34). The three-dimensional structure modeling based on yeast cytosine deaminase predicted that AID has a globular dimeric architecture similar to APOBEC-1 (23). The model structure of APOBEC-1 and AID was proposed to accommodate either single-stranded DNA or RNA but not double-stranded DNA (23). Although the modeling substrates for AID and APOBEC-1 were different, the amino acid residues proposed to interact with substrates appeared homologous (23).
Despite all these similarities, AID has a motif for dimerization different from that in APOBEC-1. The region between Gly47 and Gly54 is the only motif required for AID dimerization. This motif is located in a loop between a
-sheet (Arg37Leu44) and
-helix (Val57Trp68), which are predicted by computation (23). In APOBEC-1, the C-terminal region is important to dimerization (24, 25). The oligomeric architecture of APOBEC-1 is proposed not only to provide an active scaffold to recruit auxiliary factors but also to restrict the substrate specificities (23). If AID uses the same strategy for its specificity, it is not surprising that AID and APOBEC-1 have dimerization motifs at different domains, providing different surfaces to interact with distinct cofactors and substrates.

View larger version (62K):
[in this window]
[in a new window]
|
FIGURE 5. A, flow cytometry assessing CSR in AID-deficient spleen cells stimulated with interleukin-4 and lipopolysaccharide and infected with retroviruses expressing wild-type or mutant AID and GFP simultaneously via the internal ribosome entry site. CSR was measured by IgG1 cell surface expression, and infected cells are GFP+. Numbers indicate percentage of IgG1+GFP+ cells (top right) and IgG1GFP+ cells (bottom right). Data are representative of three individual experiments. B, cell extracts were prepared from retrovirus-infected cells (above lanes) for immunoblot analysis, and AID and GFP were detected with anti-AID and anti-GFP antibodies, respectively. Note that inactive mutant proteins were more abundant than wild-type AID. WB, Western blot; Ab, antibody.
|
|
Imai et al. (35) have reported that the heterozygous mutation of AID (AIDR190X/+) leads to the autosomal dominant hyper-IgM syndrome. These patients display a high serum IgM level associated with little serum IgG, IgA, and IgE, indicating a defect in CSR. In vitro experiments suggested that failure of AIDR190X to activate CSR should be ascribed to dissociation of specific auxiliary factors, which are supposed to bind to the C terminus of AID (15). The dominant negative phenotype of CSR resulting from heterozygous AIDR190X/+ could be explained by an inactive heterodimer formed by the wild-type and the CSR-defective AID mutant. Although we tried to show dominant negative effects using various loss-of-function mutants that can form the dimer, we were unable to confirm the dominant negative effects in CH12F3-2 or AID-deficient B cells. The failure could be due to the delicate balance of expression between mutants and wild-type AID. This is not surprising in view of the recent finding that AID function is regulated post-translationally as well as transcriptionally in B cells (36).
 |
FOOTNOTES
|
|---|
* This work was supported by Center of Excellence Grant 12CE2006 from the Ministry of Education, Science, Sports, and Culture of Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
1 To whom correspondence should be addressed. Tel.: 81-75-753-4371; Fax: 81-75-753-9485; E-mail: honjo{at}mfour.med.kyoto-u.ac.jp.
2 The abbreviations used are: AID, activation-induced cytidine deaminase; mAID, mouse AID; hAID, human AID; CSR, class switch recombination; SHM, somatic hypermutation; apo, apolipoprotein; SUMO, small ubiquitin-related modifier; 293T, human embryonic kidney 293 with large T antigen expression; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate; ER, estrogen receptor; GFP, green fluorescent protein; NTA, nitrilotriacetic acid; mAb, monoclonal antibody; IRES, internal ribosome entry site. 
3 J. Wang, R. Shinkura, M. Muramatsu, H. Nagaoka, K. Kinoshita, and T. Honjo, unpublished data. 
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. N. A. Begum and I. Okazaki, for discussion and suggestions. We also thank T. Toyoshima, A. Kawamura, and Y. Sasaki for technical assistance and T. Nishikawa and A. Kaneko for secretarial help.
 |
REFERENCES
|
|---|
- Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y., and Honjo, H. (2000) Cell 102, 553563[CrossRef][Medline]
[Order article via Infotrieve]
- Revy, P., Muto, T., Levy, Y., Geissmann, F., Plebani, A., Sanal, O., Catalan, N., Forveille, M., Dufourcq-Labelouse, R., Gennery, A., Tezcan, I., Ersoy, F., Kayserili, H., Ugazio, A. G., Brousse, N., Muramatsu, M., Notarangelo, L. D., Kinoshita, K., Honjo, T., Fischer, A., and Durandy, A. (2000) Cell 102, 565575[CrossRef][Medline]
[Order article via Infotrieve]
- Arakawa, H., Hauschild, J., and Buerstedde, J. M. (2002) Science 295, 13011306[Abstract/Free Full Text]
- Harris, R. S., Sale, J. E., Petersen-Mahrt, S. K., and Neuberger, M. S. (2002) Curr. Biol. 12, 435438[CrossRef][Medline]
[Order article via Infotrieve]
- Honjo, T., Muramatsu, M., and Fagarasan, S. (2004) Immunity 20, 659668[CrossRef][Medline]
[Order article via Infotrieve]
- Yoshikawa, K., Okazaki, I. M., Eto, T., Kinoshita, K., Muramatsu, M., Nagaoka, H., and Honjo, T. (2002) Science 296, 20332036[Abstract/Free Full Text]
- Okazaki, I. M., Kinoshita, K., Muramatsu, M., Yoshikawa, K., and Honjo, T. (2002) Nature 416, 340345[CrossRef][Medline]
[Order article via Infotrieve]
- Martin, A., Bardwell, P. D., Woo, C. J., Fan, M., Shulman, M. J., and Scharff, M. D. (2002) Nature 415, 802806[Medline]
[Order article via Infotrieve]
- Petersen-Mahrt, S. K., Harris, R. S., and Neuberger, M. S. (2002) Nature 418, 99103[Medline]
[Order article via Infotrieve]
- Durandy, A. (2003) Eur. J. Immunol. 33, 20697203[CrossRef][Medline]
[Order article via Infotrieve]
- Barreto, V. M., Ramiro, A. R., and Nussenzweig, M. C. (2005) Trends Immunol. 26, 9096[CrossRef][Medline]
[Order article via Infotrieve]
- Honjo, T., Nagaoka, H., Shinkura, R., and Muramatsu, M. (2005) Nat. Immunol. 6, 655661[CrossRef][Medline]
[Order article via Infotrieve]
- Barreto, V., Reina-San-Martin, B., Ramiro, A. R., McBride, K. M., and Nussenzweig, M. C. (2003) Mol. Cell 12, 501508[CrossRef][Medline]
[Order article via Infotrieve]
- Shinkura, R., Ito, S., Begum, N. A., Nagaoka, H., Muramatsu, M., Kinoshita, K., Sakakibara, Y., Hijikata, H., and Honjo, T. (2004) Nat. Immunol. 5, 707712[CrossRef][Medline]
[Order article via Infotrieve]
- Ta, V. T., Nagaoka, H., Catalan, N., Durandy, A., Fischer, A., Imai, K., Nonoyama, S., Tashiro, J., Ikegawa, M., Ito, S., Kinoshita, K., Muramatsu, M., and Honjo, T. (2003) Nat. Immunol. 4, 843848[CrossRef][Medline]
[Order article via Infotrieve]
- Teng, B., Burant, C. F., and Davidson, N. O. (1993) Science 260, 18161819[Abstract/Free Full Text]
- Navaratnam, N., Morrison, J. R., Bhattacharya, S., Patel, D., Funahashi, T., Giannoni, F., Teng, B. B., Davidson, N. O., and Scott, J. (1993) J. Biol. Chem. 268, 2070920712[Abstract/Free Full Text]
- Navaratnam, N., Bhattacharya, S., Fujino, T., Patel, D., Jarmus, A. L., and Scott, J. (1995) Cell 81, 187195[CrossRef][Medline]
[Order article via Infotrieve]
- Muto, T., Muramatsu, M., Taniwaki, M., Kinoshita, K., and Honjo, T. (2000) Genomics 68, 8588[CrossRef][Medline]
[Order article via Infotrieve]
- Conticello, S. G., Thomas, C. J., Petersen-Mahrt, S. K., and Neuberger, M. S. (2005) Mol. Biol. Evol. 22, 367377[Abstract/Free Full Text]
- Ito, S., Nagaoka, H., Shinkura, R., Begum, N., Muramatsu, M., Nakata, M., and Honjo, T. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 197519805[Abstract/Free Full Text]
- McBride, K. M., Barreto, V., Ramiro, A. R., Stavropoulos, P., and Nussenzweig, M. C. (2004) J. Exp. Med. 199, 12351244[Abstract/Free Full Text]
- Xie, K., Sowden, M. P., Dance, G. S., Torelli, A. T., Smith, H. C., and Wedekind, J. E. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 81148119[Abstract/Free Full Text]
- Navaratnam, N., Fujino, T., Bayliss, J., Jarmuz, A., How, A., Richardson, N., Somasekaram, A., Bhattacharya, S., Carter, C., and Scott, J. (1998) J. Mol. Biol. 275, 695714[CrossRef][Medline]
[Order article via Infotrieve]
- Teng, B. B., Ochsner, S., Zhang, Q., Soman, K. V., Lau, P. P., and Chan, L. (1999) J. Lipid Res. 40, 623635[Abstract/Free Full Text]
- Chaudhuri, J., Tian, M., Khuong, C., Chua, K., Pinaud, E., and Alt, F. W. (2003) Nature 422, 726730[CrossRef][Medline]
[Order article via Infotrieve]
- Nambu, Y., Sugai, M., Gonda, H., Lee, C. G., Katakai, T., Agata, Y., Yokota, Y., and Shimizu, A. (2003) Science 302, 21372140[Abstract/Free Full Text]
- Joung, J. K., Ramm, E. I., and Pabo, C. O. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 73827387[Abstract/Free Full Text]
- Bransteitter, R., Pham, P., Scharff, M. D., and Goodman, M. F. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 41024107[Abstract/Free Full Text]
- Dickerson, S. K., Market, E., Besmer, E., and Papavasiliou, F. N. (2003) J. Exp. Med. 197, 12911296[Abstract/Free Full Text]
- Carlow, D. C., Carter, C. W., Jr., Mejlhede, N., Neuhard, J., and Wolfenden, R. (1999) Biochemistry 38, 1225812265[CrossRef][Medline]
[Order article via Infotrieve]
- Almog, R., Maley, F., Maley, G. F., Maccoll, R., and Van Roey, P. (2004) Biochemistry 43, 13715137239[CrossRef][Medline]
[Order article via Infotrieve]
- Chung, S. J., Fromme, J. C., and Verdine, G. L. (2005) J. Med. Chem. 48, 658660[CrossRef][Medline]
[Order article via Infotrieve]
- Dance, G. S., Beemiller, P., Yang, Y., Mater, D. V., Mian, I. S., and Smith, H. C. (2001) Nucleic Acids Res. 29, 11721180
- Imai, K., Zhu, Y., Revy, P., Morio, T., Mizutani, S., Fischer, A., Nonoyama, S., and Durandy, A. (2005) Clin. Immunol. 115, 277285[CrossRef][Medline]
[Order article via Infotrieve]
- Muto, T., Okazaki, I. M., Yamada, S., Tanaka, Y., Kinoshita, K., Muramatsu, M., Nagaoka, H., and Honjo, T. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 27522757[Abstract/Free Full Text]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Chatterji, S. Unniraman, K. M. McBride, and D. G. Schatz
Role of Activation-Induced Deaminase Protein Kinase A Phosphorylation Sites in Ig Gene Conversion and Somatic Hypermutation
J. Immunol.,
October 15, 2007;
179(8):
5274 - 5280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Larijani, A. P. Petrov, O. Kolenchenko, M. Berru, S. N. Krylov, and A. Martin
AID Associates with Single-Stranded DNA with High Affinity and a Long Complex Half-Life in a Sequence-Independent Manner
Mol. Cell. Biol.,
January 1, 2007;
27(1):
20 - 30.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.