Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M602748200 on May 10, 2006

J. Biol. Chem., Vol. 281, Issue 29, 20383-20392, July 21, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/29/20383    most recent
M602748200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Camoretti-Mercado, B.
Right arrow Articles by Solway, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Camoretti-Mercado, B.
Right arrow Articles by Solway, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Inhibition of Transforming Growth Factor beta-enhanced Serum Response Factor-dependent Transcription by SMAD7*

Blanca Camoretti-Mercado{ddagger}1, Darren J. Fernandes{ddagger}, Samantha Dewundara{ddagger}, Jason Churchill{ddagger}, Lan Ma{ddagger}, Paul C. Kogut{ddagger}, John F. McConville{ddagger}, Michael S. Parmacek§, and Julian Solway{ddagger}

From the {ddagger}Department of Medicine, University of Chicago, Chicago, Illinois 60637 and the §Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104

Received for publication, March 23, 2006


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Transforming growth factor (TGF)-beta is present in large amounts in the airways of patients with asthma and with other diseases of the lung. We show here that TGFbeta treatment increased transcriptional activation of SM22{alpha}, a smooth muscle-specific promoter, in airway smooth muscle cells, and we demonstrate that this effect stems in part from TGFbeta-induced enhancement of serum response factor (SRF) DNA binding and transcription promoting activity. Overexpression of Smad7 inhibited TGFbeta-induced stimulation of SRF-dependent promoter function, and chromatin immunoprecipitation as well as co-immunoprecipitation assays established that endogenous or recombinant SRF interacts with Smad7 within the nucleus. The SRF binding domain of Smad7 mapped to the C-terminal half of the Smad7 molecule. TGFbeta treatment weakened Smad7 association with SRF, and conversely the Smad7-SRF interaction was increased by inhibition of the TGFbeta pathway through overexpression of a dominant negative mutant of TGFbeta receptor I or of Smad3 phosphorylation-deficient mutant. Our findings thus reveal that SRF-Smad7 interactions in part mediate TGFbeta regulation of gene transcription in airway smooth muscle. This offers potential targets for interventions in treating lung inflammation and asthma.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
TGFbeta2 is overexpressed in the airways of asthmatics, where it is thought to play a key role in the airway remodeling characteristic of their disease, by regulating an array of cellular functions (1) that includes gene expression, cell proliferation, differentiation (2), apoptosis (3), and migration (4) and remodeling of the extracellular matrix (5). To accomplish these diverse effects, TGFbeta binds to two unique cell surface receptors, designated TGFbeta type I (TbetaRI) and type II (TbetaRII), which are present in almost every cell type and are directly involved in signal transduction through their serine/threonine kinase activities (6). Binding of TGFbeta to TbetaRII induces phosphorylation and activation of TbetaRI, which in turn phosphorylates Smad proteins, the major transducers of TGFbeta signals (7). Once phosphorylated at their C terminus (the MH2 domain), these receptor-activated Smads or "R-Smads" (Smad2 and Smad3) associate with the common mediator Smad4 ("Co-Smad"); R-Smad-Co-Smad complexes then translocate into the nucleus, where they bind to regulatory regions of target genes (at the Smad-binding element (SBE)) and interact with other transcription factors, co-activators, and co-repressors to regulate expression of TGFbeta-responsive genes.

In several cell types, the inhibitory Smads, Smad6 and Smad7 ("I-Smad"), negatively regulate TGFbeta signaling (8). After TGFbeta stimulation, Smad7 translocates to the plasma membrane where it binds to TbetaRI and inhibits further signaling. Two mechanisms of suppression of TGFbeta signaling involving Smad7 are presently known, and both occur outside the nucleus. (i) Smad7 is able to interfere with the association between the R-Smads and activated receptors (9, 10). (ii) A complex containing Smad7 and the E3 ubiquitin ligase Smurf1 or Smurf2 translocates to the plasma membrane and induces ubiquitination and consequent degradation of TGFbeta receptors (10).

Several genes with expression restricted to the smooth muscle (SM) lineages have been identified (11), and many of them are responsive to TGFbeta (12). In vascular smooth muscle cells, TGFbeta induces expression of {alpha}-sm-actin, an abundant SM protein whose transcriptional regulation is under at least partial control of a TGFbeta control element (TCE) located within the promoter region (13). A similar TCE, to which Kruppel-like transcription factors bind (14), is required for in vivo expression of SM22{alpha}, one of the earliest and most widely expressed smooth muscle cell markers identified (11). Recently, TGFbeta was reported to up-regulate SM22{alpha} expression in fibroblasts through binding of Smad3 to two Smad-binding motifs located within the first exon (15, 16). Furthermore, signaling through Smad2 and Smad3 plays an important role in the development of SM cells from totipotent embryonic stem cells (17). Analysis of the regulatory regions of SM-specific genes reveals that the vast majority of them (including SM22{alpha}) contain CArG sequences, the binding site for the MADS-box transcription factor serum response factor (SRF) (18). Besides its essential role driving SM- and non-SM muscle-specific gene expression, SRF is also critical for regulation of cell proliferation and differentiation (19). The transcription promoting activity of SRF is modulated by its subcellular localization (20-22) and through its association with a variety of other transcription factors, activators, and co-repressors (mostly via its MADS domain). Indeed, the competition for binding of various cofactors (e.g. myocardin versus Elk-1) to a common docking site on SRF may underlie the molecular mechanism of SM plasticity, its ability to switch between differentiated and proliferative phenotypes in response to extracellular cues (23).

Beyond its influence at the TCE, TGFbeta can also promote smooth muscle-specific gene transcription through effects on SRF. First, immunoprecipitation studies show that Smad3 can form complexes with SRF within the nucleus, and such complexes formed on the SM22{alpha} promoter (where Smad3 also binds to an SBE in the first exon) appear to enhance SM22{alpha} transcription (15). Second, artificial overexpression of inhibitory Smads 6 and 7 partially blocks SRF-VP16-mediated activation of the SM22{alpha} promoter (15), through an undetermined mechanism. Third, TGFbeta can stimulate the accumulation of the SRF protein (24). Together, these findings point to SRF as an important mediator of TGFbeta effects on smooth muscle-specific gene transcription.

Given the importance of TGFbeta in asthmatic airway remodeling, and in airway smooth muscle hypertrophy in particular (25), we have further explored how TGFbeta modulates SRF-dependent gene transcription, by testing the hypothesis that inhibitory Smad7 associates with SRF, thereby reducing its transcription-promoting activity. Our experiments demonstrate for the first time that this association does indeed occur in both myogenic and nonmyogenic cells and that TGFbeta stimulation reduces this interaction, thereby restoring the transcription-promoting potential of SRF.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—Canine tracheal smooth muscle cells (CTSMC) were grown in 24-well uncoated plastic dishes. Cells were maintained in Dulbecco's modified Eagle's medium (DMEM)/F-12 (1:1) plus 10% fetal bovine serum, 0.1 mM nonessential amino acids, 50 units/ml penicillin, and 50 µg/ml streptomycin. All reagents were from Invitrogen. COS and HEK293 cells were obtained from ATCC (Manassas, VA).

Plasmids—We used several SRF-dependent reporter plasmids in our studies. In pSM22luc, luciferase expression is driven by bp -445 to +41 of the mouse SM22{alpha} gene (26). SME plasmids containing CArG sequence mutations that prevent SRF binding to the 5'-CArG box, the 3'-CArG box, or both sites were described previously (27). The artificial p5xCArGluc (Stratagene, La Jolla, CA) contains five identical sites (CCTAATATGG) separated by 4 bases and a minimal TATA box. pSRE.Lluc (gift from Dr. N. Dulin, University of Chicago) contains two identical CArG sites (CCATATTAGG) separated by 23 bases. pSM-MHCluc contains 3.3 kb of 5'-flanking DNA upstream of the human SM-myosin heavy chain gene (28) driving luciferase expression. pMSVluc contains a strong viral promoter that is constitutively active and has been described previously (29). pSBEx2tkluc, which contains the thymidine kinase promoter plus two copies of the GTCT sequence (Smad/ski-binding site) which confer responsiveness to activated Smad pathway, was provided by Dr. E. Medrano, Baylor College of Medicine. pGREluc is an artificial promoter that harbors a glucocorticoid-responsive element and TATA box (Clontech). In pMSVbetagal, the murine sarcoma virus promoter drives beta-galactosidase. pCMV5 and the expression plasmids pCMVSmad7-HA and pSmad3(3A)FLAG, which contain serine to alanine mutations in the Smad3 phosphorylation sites, were gifts from Dr. L. Attisano (University of Toronto). Plasmids encoding FLAG tag fused to amino acid residues 2-259 of human Smad7 (FN-FLAG-Smad7) or 206-426 (FC-Smad7-FLAG) were provided by Dr. C-H. Heldin (Uppsala University, Sweden). FLAG-TbetaRI-DN plasmid, which expresses a kinase domain mutant of TbetaRI, was a gift from Dr. P. ten Dijke (The Netherlands Cancer Institute). EGFP-SRF fusion proteins were generated by cloning cDNAs encoding full-length or corresponding mutants SRF into pEGFP-C1 (Clontech) that encodes enhanced green fluorescent protein. In plasmid EGFP-mNLS-EGFP, amino acids 95 and 96 within the nuclear localization signal 95RRGLKR100 were mutated to EE. In plasmid pEGFP-mDM-SRF amino acid residues 183VLLLV187 within the dimerization domain were replaced with AAAAA.

Transfection—To measure the activity of SRE.L, 5xCArG, GRE, and SBE promoters, passage 2 CTSMC of 70-80% confluence in 24-well plates was transiently transfected the day after plating with 0.1 µg of promoter luciferase reporter plasmid, 0.1 µg of pMSVbetagal, and 25 ng of expression plasmid DNA mixed with 1.5 µl of Plus Reagent (Invitrogen). Liposomes were formed by adding 2 µg of Lipofectamine (Invitrogen). After 4 h of transfection, the liposome suspension was removed, and cells were fed with DMEM/F-12 plus 10% fetal bovine serum for 5 h. After that, cells were serum-deprived overnight in DMEM/F-12 supplemented with 0.1% bovine serum albumin (Sigma) plus antibiotics. The following day, cells were treated with or without TGFbeta1 (150 pM, R&D Systems, Minneapolis, MN) for 8 h in serum-free medium and then harvested. In some cases, canine airway myocytes were long term serum-deprived (4-7 days) and, where indicated, transfected as described previously (20) prior to TGFbeta treatment. For transfection using SM22{alpha} and SME promoter constructs, cells were seeded in 6-well plates and co-transfected the following day with 1.8 µg of indicated luciferase reporter, 600 ng of MSVbetagal plasmid, and 100 ng of empty or Smad7 expression vector with 12 µg of Lipofectamine. After 6 h, the medium was changed to DMEM/F-12 plus insulin, transferring selenium mixture as described previously (20) with or without 150 pM TGFbeta. Cells were harvested 48 h after transfection. In all cases, cells were lysed with M-PER detergent (Pierce) and frozen once, and luciferase activity was measured using a commercially available kit (Promega, Madison, WI). beta-Galactosidase assays were performed as internal control to correct for differences in transfection efficiency. Promoter function was determined as normalized luciferase activity over beta-galactosidase activity; TGFbeta effect was expressed as a ratio of normalized luciferase activity in TGFbeta-treated cells relative to control untreated cells. Results are expressed as average ± S.D. from at least three independent experiments, each performed in triplicate wells, and were analyzed by analysis of variance and Student's t test. A p value of 0.05 or less was considered to be significant.

Electrophoretic Mobility Shift Assay (EMSA)—EMSA analyses were performed as described (20). Probes were end-labeled oligonucleotides corresponding to either the 5'-CArG of SM22{alpha} promoter (CTGCCCATAAAAGGTTTTTC, SRF-binding site underlined), the SM22{alpha}-TCE (TGGAGTGAGTGGGGCGGCCCGG, TGFbeta-responsive site underlined), or a PAI-1 probe (TCGAGAGCCAGACAAGGAGCCAGACAAGGAGCCAGACAC, TGFbeta-responsive sites underlined). Between 5 and 20 µg of nuclear protein was used per reaction, in a total volume of 15 µl. For supershift studies, 1 µl (1-2 µg) of antibody was added after the 15-min incubation period, and the reactions were incubated for an additional 20 min.

Chromatin Immunoprecipitation (ChIP) Assay—Eight million HEK293 cells were treated with and without TGFbeta for 24 h and cross-linked with formaldehyde. Total lysates were prepared, sonicated, and divided into five tubes for ChIP experiments, using a commercially available kit (Upstate, Charlottesville, VA). One percent lysate was saved to isolate control input DNA. The manufacturer's protocol was followed with two modifications. To reduce nonspecific background, after sonicated lysates were precleaned with salmon sperm DNA/protein G-agarose and incubated with antibody, protein A bound-agarose beads that were previously blocked with 1% bovine serum albumin were added. In addition, immunoprecipitated chromatin was washed twice (with half of the recommended volume each time) with high salt buffer. One µg of total antibody was used per ChIP reaction. Anti-SRF (G-20) and anti-Smad7 (N-19 and H-79 used in equal amounts) antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA); anti-RNA polymerase II antibody and normal IgG were from the ChIP kit (Upstate). Two percent of purified DNA (1 µl), including saved input control DNA, was used as template for 32 cycles in PCR. Primers pairs employed to amplify the human SM22{alpha} promoter that harbors the CArG and TCE were as follows: forward, TCCATCTCCAAAGCATGCAG, and reverse, CCCTCCCTGCTAGAGGAAGC, which map to bp -224 and +18, respectively. For ChIP-positive control reaction, primers that amplify the human GAPDH promoter provided by the Upstate kit were used.


Figure 1
View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 1.
An SRF-dependent mechanism mediates TGFbeta1 enhancement of the SM22{alpha} promoter activity. A, TGFbeta stimulates SM22{alpha} promoter function in a dose-dependent manner. Long term serum-deprived CTSMC were incubated with the indicated amounts of TGFbeta1(black bars) or left untreated (white bar). TGFbeta1 effect was determined as normalized promoter activity relative to untreated cells. B, TGF isoforms beta-1, beta-2, and beta-3 but not TGF{alpha} increased SM22{alpha} promoter function. Subconfluent serum-fed CTSMC were transfected with wild type SM22{alpha} promoter and treated with 100 pM of indicated TGF isoform (black bars) or left untreated (white bar). The effect of TGF isoforms on promoter SM22{alpha} activity was determined as in A. C, SRF-binding sites are necessary for stimulation of SM22{alpha} promoter activity by TFG-beta1. CTSMC were transfected with wild type (white bars) or the indicated SM22{alpha} constructs harboring point mutations in either the 5'-(SME1, gray bars) or the 3'-CArG sites (SME4, hatched bars) or both (dmSME, black bars). Cells were treated with 300 pM TGFbeta1(right bars) or left untreated (left bars). Mutation of CArG sequences that abolish SRF binding reduced but did not ablate TGFbeta induction of SM22{alpha} promoter activity (p < 0.01 between none and TGFbeta-treated cells, except for SME4 (p = 0.06)).

 
Knockdown of Smad7 by siRNA Interference—HEK293 cells were seeded in 24-well plates with antibiotic-free media the day before transfection and used at 80-90% confluence the next day. Four wells were transiently transfected with a mixture that contains 100 ng of pSM22luc, 100 ng of pMSVbgal, 1.5 µl of Plus Reagent, and 1 µl of Lipofectamine in Opti-MEM medium along with siRNA duplex targeting either Smad7 (purchased from Santa Cruz Biotechnology) or Foxm1 (as control, a gift from Dr. V. Kalinichenko, University of Chicago). siRNAs were mixed with RNAiFect reagent (Qiagen, Valencia, CA) in a 1:6 ratio. In two experiments, a nonsilencing RNA duplex from Qiagen was used as an additional control. After 6 h, cells were fed with complete medium and harvested 54 h later. Luciferase and beta-galactosidase activities were measured in three replicate wells, and total RNA was isolated from the fourth replicate well. The average of normalized luciferase activity in siRNA Samd7-transfected cells was expressed relative to that obtained in control siRNA-transfected cells. Smad7 expression was analyzed by reverse transcription-PCR using cDNA prepared from 1 µg of total RNA and a set of commercially available Smad7 primers from Santa Cruz Biotechnology. A 521-bp amplicon was seen following the manufacturer's instructions. Expression of Smad7 protein in the same lysates used for luciferase and beta-galactosidase measures was analyzed by Western blot using the anti-Smad7 antibody N-19 from Santa Cruz Biotechnology, and was visualized by ECL from Pierce. siRNA experiments were performed four times with similar results.


Figure 2
View larger version (47K):
[in this window]
[in a new window]
 
FIGURE 2.
TGFbeta increases SRF-DNA binding capacity. A, NE from long term serum-deprived CTSM cells exposed to 150 pM TGFbeta1 for the indicated times were incubated with a probe containing the SM22{alpha}-5'-CArG site. TGFbeta1 administration elevated SRF DNA binding activity (arrow) with increasing exposure times. B, crosslinked chromatin-containing lysates were prepared from untreated (-) or TGFbeta-treated (+) HEK293 cells. ChIP was performed with anti-SRF, anti-Smad7, or anti-RNA polymerase II (RNAP) antibodies as indicated, along with no added antibody as negative control (none). Chromatin that undergoes no IP serves as positive control (input). Amplification of SM22{alpha} promoter sequences that contain the CArG plus TCE sites (top) or of GAPDH promoter sequences (bottom) was performed by PCR from purified DNA immunoprecipitated from chromatin. Binding of SRF to the SM22{alpha} promoter increased in cells treated with TGFbeta (compare intensities of lane 1 versus lane 2). IP with anti-Smad7 antibodies was able to retrieve DNA containing the SRF-binding site (lane 7), although a fainter signal was obtained from TGFbeta-treated cells (lane 8). Similar levels of binding to the GAPDH promoter, a gene reported to be SRF-independent, were achieved in chromatin treated with anti-RNAP II (lanes 13 and 14) but not with anti-SRF antibody (lanes 17 and 18). Negligible background signals were observed when no antibody (lanes 3, 4, 11, and 12) or DNA (lanes 9 and 19) was added. C, total cell lysates were prepared from control CTSMC or cells treated with 150 pM TGFbeta for 24 h. The membrane was probed first with anti-SRF antibody and then reprobed with anti-beta actin antibody. D, NE were prepared from serum-fed CTSMC exposed to 150 pM TGFbeta for 24 h and incubated with either the SM22{alpha}-5'CArG or the PAI-I probe that contains a highly TGFbeta-responsive element. E, formation of DNA-protein complexes on the SM22{alpha}-TCE. NE were prepared after exposure of serum-fed CTSMC to 100 pM TGFbeta for the indicated times. Probe contains the TCE from the SM22{alpha} promoter. TGFbeta induced appearance of two TCE binding activities (arrows) in a time-dependent fashion.

 
Co-immunoprecipitation (IP) Assays—Unless indicated otherwise, CTSMC, COS, or HEK293 cells were transiently co-transfected with Smad7-HA and Myc-SRF expression vectors or their respective empty vector controls along with other members of the TGFbeta signaling pathway as indicated, in the presence of Lipofectamine as described above. In studies on regulation of SRF-Smad7 association, cells were treated with TGFbeta (4 ng/ml), IL-6 (50 ng/ml), or IL-13 (50 ng/ml) after transfection, as indicated. Nuclear and cytosolic extracts were prepared in the presence of protease inhibitors 24 h later using a Pierce kit. Equal amounts of protein from each sample (40-200 µgin 100-µl final volume) were preincubated first with normal IgG-conjugated agarose beads (Santa Cruz Biotechnology) for 30 min on ice with occasional gentle mixing. Supernatants were recovered after centrifugation (30 s at 500 x g) and incubated, unless indicated otherwise, with anti-Myc antibody-conjugated beads (Santa Cruz Biotechnology) for 3 h at 4°C in an orbital platform. Beads were precipitated as above, washed twice, and boiled in SDS loading buffer. Interacting proteins bound to the beads were resolved on SDS-PAGE, transferred to nitrocellulose, and probed with polyclonal anti-HA antibody unless indicated otherwise. Signal was detected by ECL (Pierce). For experiments using Smad7 mutants, membranes were incubated with anti-FLAG M2 antibody (Sigma). When SRF mutants were employed, extracts were incubated with anti-green fluorescent protein antibody-conjugated beads (Santa Cruz Biotechnology).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
TGFbeta1 Stimulates Transcriptional Activation of Smooth Muscle-specific Genes in Myocytes from the Airway through an SRF-dependent Pathway—We first tested whether TGFbeta affects promoter function of SM-specific genes in myocytes from the airway. Fig. 1A shows that TGFbeta treatment enhanced transcription from the SM22{alpha} promoter after transient transfection into long term serum-deprived myocytes by 3-9-fold in a dose-dependent manner. Comparable stimulation was observed for the human smooth muscle myosin heavy chain promoter, but not with the viral murine sarcoma virus long terminal repeat promoter under the same conditions (data not shown). This indicates that TGFbeta action on SM-specific promoters was selective. Transcriptional activation of SM22{alpha} promoter was also inducible by TGFbeta in subconfluent serum-fed cells, although to a lesser extent, and all three TGFbeta isoforms (but not TGF{alpha}) increased SM22{alpha} promoter activity to a similar degree (Fig. 1B).


Figure 3
View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 3.
TGFbeta increases SRF-dependent transcriptional activity. CTSMC were co-transfected with two different SRF-dependent luciferase reporter plasmids 5xCArG (A) and SRE.L (B) plus empty CMV (left) or Smad7 (right) expression vectors. TGFbeta (100 pM) was added to selected wells (black bars), and controls were left untreated (white bars). Activity of both promoters increased more than 2-fold with TGFbeta treatment relative to untreated cells, and overexpression of Smad7 diminished basal as well as TGFbeta-induced promoter function (#, p < 0.03; *, p < 0.01). C, cells were transfected with the artificial Smad-sensitive pSBEx2.tk promoter as above. TGFbeta stimulation enhanced more than 3-fold SBE promoter function (black bars) compared with control (white bars). This increase was abolished by expression of Smad7. *, p < 0.02. D, cells were co-transfected with GRE.luc, a glucocorticoid-dependent but SRF- and Smad-insensitive promoter plasmid plus empty CMV or Smad7 expression vectors as above. No significant changes in promoter function were observed with TGFbeta stimulation (black bars) either with or without Smad7 overexpression relative to control (white bars).

 
To delineate the sequence(s) responsible for TGFbeta responsiveness, we investigated the potential role of the CArG elements present in the SM22{alpha} promoter by inactivating them through site-directed mutagenesis. Point mutations that abolished SRF binding at either the 5'-CArG site at -275 bp or the 3' CArG site at -150 bp reduced basal SM22{alpha} promoter activity (Fig. 1C, left bars) and also decreased the TGFbeta-dependent enhancing effect (Fig. 1C, right bars). Moreover, mutation of both SRF-binding sites inhibited even further the TGFbeta-induced augmentation of SM22{alpha} promoter function. Interestingly, the TGFbeta effect was not completely abolished, supporting the notion that an SRF-independent mechanism also operate in airway myocytes.

TGFbeta Increases SRF-DNA Binding Activity—The mutagenesis studies described above prompted us to investigate whether TGFbeta influenced SRF DNA binding activity. To test this, we performed EMSA using nuclear extracts prepared from subconfluent airway smooth muscle cell cultures and a probe containing the SM22{alpha}-5'-CArG site (Fig. 2A). Compared with untreated controls, TGFbeta exposure increased the intensity of the DNA-protein complex in a time-dependent manner, up to 3 h of treatment. By competition and supershift analyses with anti-SRF antibody (not shown here but see Fig. 5D), we confirmed the presence of SRF within this complex.

We performed ChIP experiments to examine whether there is elevation of binding of endogenous SRF to the CArG sites within the SM22{alpha} promoter upon TGFbeta stimulation in vivo. Fig. 2B shows that anti-SRF antibody was able to immunoprecipitate cross-linked chromatin that contains DNA sequences harboring the CArG site from the SM22{alpha} promoter (lane 1). A stronger binding was observed from cells stimulated with TGFbeta (Fig. 2B, lane 2). These results indicate that SRF occupies the CArG site within the chromatin, and SRF binding to DNA is increased upon TGFbeta stimulation. Furthermore, Fig. 2B also demonstrates that anti-Smad7 antibody was capable of retrieving chromatin harboring SM22{alpha} promoter sequences that possess SRF-binding sites (lane 7). If cells were treated with TGFbeta, the efficiency of recovering CArG sites-containing DNA was less evident (Fig. 2B, lane 8). As controls, TGFbeta induced no change in the signal for GAPDH promoter sequences that are precipitated using anti-RNA polymerase II antibody (Fig. 2B, lanes 13 and 14). Retrieval of sequences from the SM22{alpha} (Fig. 2B, lanes 3 and 4) or GAPDH (lanes 11 and 12) promoters were negligible in chromatin treated with no antibody. No GAPDH promoter sequences could be amplified from chromatin precipitated using anti-SRF antibody (Fig. 2B, lanes 17 and 18). Altogether, our data indicate that Smad7 associates in vivo with SRF over the CArG element of the SM22{alpha} promoter, and TGFbeta stimulates SRF-DNA binding activity to the SM22{alpha} promoter.

Hautmann et al. (24) reported that increased SRF-DNA binding capacity was associated with augmented SRF content in TGFbeta-treated vascular myocytes, but no such increase in SRF abundance was present in aorta endothelial cells. Western analysis of total cell lysates demonstrated that enhanced SRF-DNA binding activity in our system occurs with only minimal increase in SRF abundance (Fig. 2C). Fig. 2D shows that the level of stimulation of SRF SM22{alpha}-5'CArG complex formation by TGFbeta administration was comparable with that observed by using a probe from the plasminogen activator inhibitor (PAI)-1 promoter, which is highly inducible by TGFbeta and contains Smad3/Smad4-binding sites. Finally, we demonstrated DNA-protein interactions using nuclear extracts from airway smooth muscle cells incubated with a probe containing the TCE from the SM22{alpha} promoter region (Fig. 2E). This sequence, which spans bp -132 to -111, is devoid of CArG sites. Formation of TCE binding activities from serum-fed airway smooth muscle cells was evident as early as 15 min of TGFbeta treatment.

Smad7 Is a Negative Regulator of SRF-dependent Transcription Activity—Previous studies have shown that Smad sites within the first exon of SM22{alpha} gene mediate TGFbeta responsiveness of SM22{alpha} and have identified a putative TCE in the 5'-flanking region. Thus, to establish whether TGFbeta induces smooth muscle gene transcription through activation of SRF transcription-promoting function independently of these sites, we performed transient transfection studies using two promoter reporter constructs solely responsive to SRF. In p5xCArGluc, five tandem copies of the CArG site and a TATA box drive expression of luciferase reporter; in pSRE.Lluc, the Ets-binding site in the c-fos promoter serum-response element is inactivated leaving only the SRF-binding sequences intact. Because TGFbeta action is mediated by Smad members in many cell types, we further hypothesized that overexpression of the inhibitor Smad7 would decrease SRF-dependent transcriptional activity induced by TGFbeta in airway myocytes. Fig. 3, A and B, shows that TGFbeta increased transcription from 5xCArG and SRE.L promoters by 2-fold, relative to untreated control cells. Moreover, overexpression of Smad7 markedly reduced transcription from these promoters, in the presence of TGFbeta and even in non-TGFbeta-treated cells. The latter finding probably reflects autocrine secretion of TGFbeta by our airway myocytes, as addition of anti-TGFbeta antibodies to culture medium also reduces transcription from the SM22{alpha} promoter in non-TGFbeta-treated cells.3 We found parallel results for transcription from pSBEx2.tk.luc, which harbors a promoter sensitive to Smad activation. Relative to untreated cells, TGFbeta increased reporter transcription more than 3-fold (Fig. 3C, left bars), and co-expression of Smad7 reduced this enhancement to basal levels (Fig. 3C, black bars). Smad7 also diminished basal SBE promoter function in the absence of added TGFbeta, again suggesting the presence of a TGFbeta autocrine pathway. As a negative control, TGFbeta treatment did not increase transcription from a glucocorticoid-sensitive (GRE) promoter, which contains neither Smad sites nor CArG boxes (Fig. 3D, left bars). Likewise, overexpression of Smad7 did not decrease GRE promoter function in treated or nontreated cells. Altogether, these results indicate that Smad7 specifically inhibits TGFbeta-stimulated activation of SRF-dependent transcription in airway myocytes.


Figure 4
View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 4.
Down-regulation of Smad7 enhances SRF-dependent gene expression. HEK293 cells were co-transfected with pSM22luc along with Smad7 (S7) or control (Ct) siRNA duplexes. A, luciferase activity measured in triplicate wells in two experiments (I and II) is shown. Compared with control-treated cells, knockdown of Smad7 expression correlates with more than a 2-fold increase in promoter function. Same results were observed in two additional experiments. Total RNA from a fourth identically transfected well was isolated, reverse-transcribed, and used as template to amplify Smad7 (top) or GAPDH (bottom) transcripts. Similar levels of GAPDH expression are shown. Left, DNA standards. B, knockdown of Smad7 is shown.

 
Silencing of Smad7 Stimulates SRF-dependent Promoter Function—To test the participation of endogenous Smad7 in regulating SRF-dependent promoter transcription, we performed promoter reporter assays in transiently transfected cells in which endogenous Smad7 was depleted via siRNA interference. Fig. 4 shows that knockdown of endogenous Smad7 in transiently transfected HEK293 cells is sufficient to more than double the promoter function of the SM22{alpha} promoter compared with cells treated with control siRNA. Thus, although overexpression of Smad7 is capable of inhibiting basal function of SRF-dependent promoters (Fig. 3, A and B and Fig. 7), blockade of Smad7 expression, conversely, results in exaggerated SRF-dependent transcriptional activity.

SRF Interacts with Smad7—The ChIP studies described above strongly indicate that the inhibitory effect of Smad7 on SRF-dependent transcription stems from an association of Smad7 with SRF. To confirm this observation, we performed co-immunoprecipitation assays using nuclear (NE) and cytosolic (CE) extracts from COS or HEK293 cells that were co-transfected with plasmids encoding myc-SRF or Myc alone along with Smad7-HA expression plasmids or empty vector. Fig. 5A shows that Smad7 was pulled down from NE only when SRF was co-expressed (lane 8), indicating that SRF interacts with Smad7 within the nucleus. We were also able to demonstrate interaction of Smad7-HA or 6xmyc-Smad7 with EGFP-SRF or GST-SRF in COS, CTSM, and HEK293 cells as well. Interestingly, association of Smad7 to SRF in the cytosolic fraction was undetectable in all three cell types (see Fig. 6D, and data not shown). To corroborate this interaction between the endogenous molecules as well, we prepared NE and CE from nontransfected HEK293 and COS cells and immunoprecipitated Smad7 with a polyclonal anti-Smad7 antibody in the presence of conjugated IgA/IgG-agarose beads. Pulled down proteins were size-fractionated by PAGE, blotted onto nitrocellulose membrane, and probed with anti-SRF antibody. Fig. 5B shows that endogenous Smad7 associates with endogenous SRF inside the nuclei of both cells but not in the cytosol of HEK293 cells (note that in this preparation, SRF expression in COS cells was exclusively nuclear (lane 6 versus lane 8)). These results rule out the possibility that interaction of Smad7 and SRF occurs only with overexpressed and chimeric recombinant proteins.


Figure 5
View larger version (60K):
[in this window]
[in a new window]
 
FIGURE 5.
Smad7 interacts with SRF. A, COS cells were transiently transfected with either Myc (lanes 1-4) or Myc-SRF (lanes 5-8) expression vectors, and each with Smad7-HA (lanes 3, 4, 7, and 8) or CMV empty vector (lanes 1, 2, 5, and 6). NEs were prepared after 24 h, and equal amounts of protein were incubated with beads conjugated with anti-Myc antibody. Proteins bound to beads were resolved on SDS-PAGE, probed with anti-HA antibody. Arrow shows the expected position for Smad7. I, input; P, pulldown. B, NE and CE were prepared from HEK293 or COS cells. Endogenous Smad7 was immunoprecipitated with anti-Smad7 antibody and IgG/IgA-conjugated beads. Bound endogenous SRF was detected by anti-SRF Western blot. Interaction of Smad7 to SRF occurs in the nuclei of both cells (lanes 1 and 5) but not in the cytosol (lanes 3 and 7). In this experiment, SRF expression in COS cells is mostly nuclear. I, input; P, pulldown. C, NE and CE were prepared from HEK293 cells co-transfected with expression vectors encoding Myc-SRF plus either FN-Smad7-FLAG or FC-Smad7-FLAG, as indicated. IPs were performed with anti-Myc antibody beads. Blot was probe with anti-FLAG antibody. SRF was able to pull down FC-Smad7 (lower horizontal arrow) but not FN-Smad7 (upper oblique arrow), indicating that the Smad7 C terminus is involved in binding to SRF. Association of SRF with FC-Smad7 was observed only in the nuclear fraction. Asterisk indicates nonspecific bands. D, EMSA was performed with NE prepared from cells treated with TGFbeta1(lanes 2-5) or left untreated (lane 1) and SM22{alpha} 5'-CArG probe. Arrows indicate bands that contain SRF, as demonstrated by supershift of these bands with an anti-SRF antibody (lane 2). Anti-Smad7 antibody raised against the C terminus (lane 4) but not the N terminus (lane 3) of Smad7 interferes with SRF-DNA binding. E, SRF association with Smad7 in the nucleus requires the NLS and dimerization domain (DM) of SRF. NE were prepared from HEK293 cells that overexpress 6xmyc-Smad7 plus the indicated EGFP-SRF mutants (see text). SRF fusion proteins were pulled down with anti-GFP green fluorescent protein antibody-conjugated beads. Interacting Smad7 was detected by Western blot using anti-Myc antibody. Mutations within NLS or the dimerization domain (DM) interfere with SRF-Smad7 association. I, input; P, pulldown.

 
Smad members participate in protein-protein interactions via their MH2 domain localized within the C terminus of the molecule. To determine the domain of Smad7 that associates with SRF, we performed pulldown assays with extracts from cells co-transfected with myc-SRF and FN-Smad7-FLAG or FC-Smad7-FLAG, in which the first 259 residues or amino acids 206-426 of Smad7, respectively, are fused to the FLAG tag. Fig. 5C shows that in HEK293 cells, SRF interacts with the C-terminal portion of Smad7 in the nucleus (lane 4), but binding is negligible in the cytoplasm (lane 8). On the other hand, virtually no FN-Smad7-FLAG could be pulled down by SRF in the nucleus (Fig. 5C, lane 2) under identical conditions. This indicates that structural features that enable Smad7 to associate with SRF reside in the second half of the Smad7 molecule. Moreover, the Smad7-SRF interaction appears to be maintained even when SRF is bound to DNA, which is consistent with our ChIP results. Indeed, Fig. 5D shows that complexes formed by airway smooth muscle nuclear proteins on the 3'-CArG-SM22{alpha} probe contains SRF (as anti-SRF antibody supershifts the bands; lane 2) and Smad7 (as anti-C Smad7 antibody prevents complex formation).

SRF contains a functional nuclear localization signal (NLS) within its N terminus, and the MADS domain of SRF participates in a variety of functional protein-protein interactions. We tested whether these two features were involved in the ability of SRF to associate with Smad7. Co-immunoprecipitation assay shown in Fig. 5E demonstrates that the EGFP-SRF fusion protein harboring mutations within either the nuclear localization signal (mNLS-SRF) or the dimerization domain (mDM-SRF) exhibited a decreased ability to associate with Smad7 compared with wild type SRF.


Figure 6
View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 6.
The TGFbeta signaling pathway modulates SRF-Smad7 interaction. A, COS cells were co-transfected with Myc-SRF and Smad7-HA expression vectors. After transfection, cells were fed with serumcontaining medium for 18 h and the next day treated with TGFbeta or left untreated for 3 h. Nuclear extracts were prepared and IP performed after extracts were preincubated with normal IgG-coupled beads, using anti-Myc antibody-bound beads. Western blot was done with anti-HA antibody to detect Smad7. P, pellet; S, supernatant after IgG preincubation. TGFbeta stimulation decreased the interaction of Smad7 with SRF. B, COS cells were co-transfected with Myc-SRF and Smad7-HA expression plasmids plus either a vector encoding the phosphorylation-deficient Smad3(3A) mutant (lanes 1 and 2), wild type Smad3 (lanes 3 and 4), or empty vector CMV5 (lanes 5 and 6). IP and Western analysis were performed with NE pretreated with normal IgG beads, as above. Overexpression of signaling-defective Smad3 mutant increased Smad7 binding to SRF (lane 2 versus 6). C, IP was performed with COS cells NE co-transfected with Myc-SRF and Smad7-HA vectors along with the empty (lanes 1-3) or kinase-defective TbetaRI (TbetaRI-DN, lanes 4-6) expression plasmids. Smad7 bound to SRF was detected by using anti-Myc antibody-conjugated beads followed by anti-HA Western of inputs (I), pulldown (P), and supernatants (S), as described above. The results demonstrated that blockade of TGFbeta signaling by overexpression of a dominant negative TbetaRI mutant augmented Smad7 interaction to SRF (lanes 2 versus 5). D, NE and CE were prepared from HEK293 cells co-transfected with Myc-SRF and Smad7-HA. After transfection, cells were treated with IL-6 (50 ng/ml) or IL-13 (50 ng/ml) as indicated, for 18 h. IP was performed with anti-Myc antibody beads. Bound Smad7 was detected by anti-HA Western blot. Binding of Smad7 to SRF in the nuclei is weakened in the presence of these cytokines, compared with untreated cells (lanes 2 and 3 versus 6). Interestingly, SRF and Smad7 became competent to associate in the cytosol of IL-treated cells (lanes 8 and 10 versus 12).

 
Modulation of Smad7-SRF Association by TGFbeta—Because Smad7 has a pivotal role in controlling TGFbeta actions, and TGFbeta itself regulates Smad7 function, we hypothesized that SRF-Smad7 interaction might be modulated by activation of the TGFbeta cascade. To test this possibility, we performed pulldown assays using NE from cells treated with and without TGFbeta. Fig. 6A shows that TGFbeta-stimulated cells exhibited a weaker SRF-Smad7 interaction than untreated cells. Conversely, when TGFbeta action was interrupted by interfering with the propagation of the signal via expression of a defective Smad3 mutant (Fig. 6B) or at the receptor level by co-expression of a dominant negative TbetaRI mutant (TbetaRI-DN) deficient in its kinase activity (Fig. 6C), a stronger interaction of Smad7 and SRF was elicited.

These results prompted us to investigate whether other interventions also modulated Smad7-SRF association. Fig. 6D shows that interleukin (IL)-13 or IL-6 treatment weakened the binding of Smad7 to SRF in the nuclei of HEK293 cells. Surprisingly and in contrast to TGFbeta stimulation, SRF and Smad7 became capable of associating in the cytosol of these IL-treated cells. This indicates that additional pathways activated (or inhibited) by these inflammatory cytokines independently of TGFbeta influenced Smad7-SRF interaction.

Smad7 Inhibits SM22{alpha} Promoter Function—Finally, we tested the effect of TGFbeta treatment and Smad7 expression in the context of the native SM22{alpha} promoter, which harbors the SRF-binding sites, the TCE and the SBE. Fig. 7 shows that TGFbeta up-regulates SM22{alpha} promoter function, and expression of Smad7 is capable of decreasing both basal as well as enhanced SM22{alpha} promoter activity mediated by TGFbeta in transiently transfected airway SM cells. Therefore, Smad7 also interferes with activation of SM-specific genes. Taken together, these studies indicate that in smooth muscle as well as in non-smooth muscle cells, the positive action of TGFbeta on SRF function is regulated by association with Smad7, and thus modulation of the cross-talk between SRF and Smad7 may occur in cells under (patho)physiological conditions. This could have important biological consequences given the paramount relevance of TGFbeta signaling and SRF-sensitive pathways in many aspects of cell homeostasis.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we demonstrate that modulation of SRF-Smad7 interactions in part mediates TGFbeta-stimulated transcription of smooth muscle-specific genes in airway myocytes. We found that TGFbeta stimulates transcriptional activity of SM-specific promoters through an SRF-dependent pathway and that overexpression of Smad7 reduces TGFbeta-induced stimulation of purely SRF-dependent promoters. We demonstrated that SRF associates with Smad7 in cell nuclei and that this association is reduced by TGFbeta treatment. Thus, we propose a novel mechanism by which TGFbeta influences SRF-dependent transcription. 1) Smad7 interacts with SRF, thereby reducing its transcription promoting activity. 2) TGFbeta treatment reduces SRF-Smad7 interaction, thereby restoring transcription promoting activity of SRF.

Fig. 8 illustrates possible ways by which Smad7 could inhibit SRF-dependent transcriptional activity. First, as is the case in other cell types such as lung epithelial cells (8), Smad7 may translocate into the cytoplasm upon binding of TGFbeta to TbetaRII and prevent phosphorylation of R-Smads, propagation of TGFbeta signaling, and subsequent stimulation of SRF-dependent genes. Second, Smad7 may interfere with formation of transcriptionally competent active R-Smad-SRF complexes. In this regard, Qiu et al. (15) demonstrated that SRF could bind Smad3 in fibroblasts. In a third scenario elucidated here, Smad7 in the nucleus interacts with SRF, thereby reducing SRF function. The latter notion is consistent with previously known features of Smad7 as follows: (i) Smad7 localizes within the nucleus of some cells in the absence of TGFbeta (30); (ii) Smad7 possesses a repressing function in transcription assays, even independently of TGFbeta (Ref. 31 and our observations); (iii) Smad7 can interact with co-activators and transcription factors in the nucleus (32); and (iv) physiologically relevant regulation of Smad7 export from the nucleus has been reported (33). To our knowledge, we are the first to demonstrate an association of Smad7 with SRF within the nucleus and to postulate that Smad7 may perturb the capability of SRF to enhance transcriptional functions. Based on our IP results, we believe that this inhibitory activity does not likely involve gross changes in the subcellular localization of Smad7 or SRF.


Figure 7
View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 7.
Smad7 down-regulates SM22{alpha} promoter function. Airway SM cells were co-transfected with pSM22luc along with either empty (left) or Smad7 (right) expression vectors and stimulated with TGFbeta (white bars) or left untreated (black bars). Smad7 inhibits basal (black bars) and TGFbeta-induced (open bars) SM22{alpha} promoter activity. *, p < 0.05.

 


Figure 8
View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 8.
Inhibitory action of Smad7 on TGFbeta1-induced stimulation of SRF-dependent transcriptional activity. Three ways of inhibition are illustrated. In 1, after TGFbeta stimulation, Smad 7 translocates into the cytosol, binds to TbetaRI, and prevents TbetaRI-directed phosphorylation and activation of the positive mediators, R-Smads. In 2, Smad 7 interferes with R-Smad-SRF complex formation and/or activity. In 3, as described in this study, Smad7 interacts with SRF within the nucleus interfering with SRF promoting function of SRF-dependent genes (horizontal line). Initiation transcription site is indicated by the small vertical line.

 
Hautmann et al. (24) reported that a marked augmentation in SRF-DNA binding in aortic SM cells correlated with substantially higher levels of SRF expression in TGFbeta-treated cells compared with control cells. Interestingly, we observed in airway smooth muscle that the SRF binding to SM22{alpha}-CArG sites increased after TGFbeta treatment, but this occurred with only minor increase in SRF abundance. Whether this difference from the study of Hautmann et al. (24) stems from distinct experimental conditions or diverse properties of airway and vascular myocytes is not yet known.

Our results reveal that the C terminus of Smad7 is necessary for binding to SRF, which is consistent with previous reports that established that this region is involved in Smad7-protein interactions, including binding to TbetaRI. As expected, import of SRF to the nucleus was important for SRF association with Smad7; in addition, the MADS domain of SRF was required for nuclear SRF-Smad7 interaction.

Recent studies reveal a prominent role of TGFbeta- and SRF-dependent pathways in lung homeostasis. Smad7 adds to the list of proteins that regulate SRF function. That Smad7 associates with and inhibits SRF and that this functionally significant association is modulated by the external cell milieu may have important biological consequences. TGFbeta is abundant in asthmatic airways, in which airway smooth muscle hypertrophy is also a prominent feature. Expression of TGFbeta is also up-regulated in patients with chronic obstructive pulmonary disease (34) or with lymphangioleiomyomatosis, a disease of abnormal proliferation of smooth muscle cells within the lung (35). In our studies we demonstrated that TGFbeta, IL-13, and IL-6 were able to disrupt SRF-Smad7 interaction, which may lead to alleviation of the inhibitory effect of Smad7 on SRF function. It is reasonable to speculate that overactivation of SRF by persistent TGFbeta stimulation might contribute to smooth muscle hypertrophy in inflammatory lung diseases.


    FOOTNOTES
 
* This work was supported by grants from the Blowitz-Ridgeway Foundation, the American Lung Association (to B. C.-M.), the American Thoracic Society (to B. C.-M.), and the LAM Foundation (to B. C.-M.), by NHLBI Grant SCOR HL 56399 from the National Institutes of Health (to J. S. and B. C.-M.), and by Asthma and Allergic Diseases Research Center Grant AI 056352 (to J. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: University of Chicago, 5841 S. Maryland Ave., MC6026, Chicago, IL 60637. Tel.: 773-702-5448; Fax: 773-702-4736; E-mail: bcamoret{at}medicine.bsd.uchicago.edu.

2 The abbreviations used are: TGFbeta, transforming growth factor beta; SRF, serum response factor; SBE, Smad-binding element; TCE, TGFbeta control element; NLS, nuclear localization signal; DMEM, Dulbecco's modified Eagle's medium; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; siRNA, short interfering RNA; ChIP, chromatin immunoprecipitation; NE, nuclear extracts; CE, cytosolic extracts; SM, smooth muscle; CTSMC, canine tracheal smooth muscle cells; PAI, plasminogen activator inhibitor; HA, hemagglutinin; EMSA, electrophoretic mobility shift assay; CMV, cytomegalovirus; IP, co-immunoprecipitation; IL, interleukin. Back

3 B. Camoretti-Mercado and J. Solway, unpublished observations. Back


    ACKNOWLEDGMENTS
 
We thank Drs. L. Attisano, N. Dulin, V. Kalinichenko, E. Medrano, C.-H. Heldin, and P. ten Dijke for the gifts of reagents and Drs. A. Halayko, S. Forsythe, and H.-W. Liu for assistance in the initial phase of this study.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Piek, E., Heldin, C.-H., and ten Dijke, P. (1999) FASEB J. 13, 2105-2124[Abstract/Free Full Text]
  2. Moustakas, A., Pardali, K., Gaal, A., and Heldin, C.-H. (2002) Immunology Lett. 82, 85-91[CrossRef][Medline] [Order article via Infotrieve]
  3. Schuster, N., and Krieglstein, K. (2002) Cell Tissue Res. 307, 1-14[CrossRef][Medline] [Order article via Infotrieve]
  4. Holgate, S. (2000) Clin. Exp. Allergy 30, 37-41
  5. Bartram, U., and Speer, C. P. (2004) Chest 125, 754-765[Abstract/Free Full Text]
  6. Franzen, P., ten Dijke, P., Ichijo, H., Yamashita, H., Schulz, P., Heldin, C. H., and Miyazono, K. (1993) Cell 75, 681-692[CrossRef][Medline] [Order article via Infotrieve]
  7. Massague, J. (2000) Nat. Rev. Mol. Cell Biol. 1, 169-178[CrossRef][Medline] [Order article via Infotrieve]
  8. Itoh, S., Landstrom, M., Hermansson, A., Itoh, F., Heldin, C.-H., Heldin, N.-E., and ten Dijke, P. (1998) J. Biol. Chem. 273, 29195-29201[Abstract/Free Full Text]
  9. Hanyu, A., Ishidou, Y., Ebisawa, T., Shimanuki, T., Imamura, T., and Miyazono, K. (2001) J. Cell Biol. 155, 1017-1028[Abstract/Free Full Text]
  10. Kavsak, P., Rasmussen, R. K., Causing, C. G., Bonni, S., Zhu, H., Thomsen, G. H., and Wrana, J. L. (2000) Mol. Cell 6, 1365-1375[CrossRef][Medline] [Order article via Infotrieve]
  11. Solway, J., Forsythe, S. M., Halayko, A. J., Vieira, J. E., Hershenson, M. B., and Camoretti-Mercado, B. (1998) Am. J. Respir. Crit. Care Med. 158, S100-S108[Abstract/Free Full Text]
  12. Parmacek, M. (2001) Curr. Top. Dev. Biol. 51, 69-89[Medline] [Order article via Infotrieve]
  13. Hautmann, M. B., Madsen, C. S., and Owens, G. K. (1997) J. Biol. Chem. 272, 10948-10956[Abstract/Free Full Text]
  14. Adam, P. J., Christopher, R., Hautmann, M. B., and Owens, G. K. (2000) J. Biol. Chem. 275, 37798-37806[Abstract/Free Full Text]
  15. Qiu, P., Feng, X.-H., and Li, L. (2003) J. Mol. Cell. Cardiol. 35, 1407-1420[CrossRef][Medline] [Order article via Infotrieve]
  16. Chen, S., Kulik, M., and Lechleider, R. J. (2003) Nucleic Acids Res. 31, 1302-1310[Abstract/Free Full Text]
  17. Sinha, S., Hoofnagle, M. H., Kingston, P. A., McCanna, M. E., and Owens, G. K. (2004) Am. J. Physiol. 287, C1560-C1568
  18. Miano, J. M. (2003) J. Mol. Cell. Cardiol. 35, 577-593[CrossRef][Medline] [Order article via Infotrieve]
  19. Camoretti-Mercado, B., Dulin, N., and Solway, J. (2003) Respir. Physiol. Neurobiol. 137, 223-235[CrossRef][Medline] [Order article via Infotrieve]
  20. Camoretti-Mercado, B., Liu, H.-W., Halayko, A. J., Forsythe, S. M., Kyle, J. W., Li, B., Fu, Y., McConville, J., Kogut, P., Vieira, J. E., Patel, N. M., Hershenson, M. B., Fuchs, E., Sinha, S., Miano, J. M., Parmacek, M. S., Burkhardt, J. K., and Solway, J. (2000) J. Biol. Chem. 275, 30387-30393[Abstract/Free Full Text]
  21. Liu, H. W., Halayko, A. J., Fernandes, D. J., Harmon, G. S., McCauley, J. A., Kocieniewski, P., McConville, J., Fu, Y., Forsythe, S. M., Kogut, P., Bellam, S., Dowell, M., Churchill, J., Lesso, H., Kassiri, K., Mitchell, R. W., Hershenson, M. B., Camoretti-Mercado, B., and Solway, J. (2003) Am. J. Respir. Cell Mol. Biol. 29, 39-47[Abstract/Free Full Text]
  22. Ding, W., Gao, S., and Scott, R. (2001) J. Cell Sci. 114, 1011-1018[Abstract]
  23. Wang, Z., Wang, D.-Z., Hockemeyer, D., McAnally, J., Nordheim, A., and Olson, E. N. (2004) 428, 185-189
  24. Hautmann, M. B., Adam, P. J., and Owens, G. K. (1999) Arterioscler. Thromb. Vasc. Biol. 19, 2049-2058[Abstract/Free Full Text]
  25. Halayko, A. J., Kartha, S., Stelmack, G. L., McConville, J., Tam, J., Camoretti-Mercado, B., Forsythe, S. M., Hershenson, M. B., and Solway, J. (2004) Am. J. Respir. Cell Mol. Biol. 31, 266-275[Abstract/Free Full Text]
  26. Solway, J., Seltzer, J., Samaha, F. F., Kim, S., Alger, L. E., Niu, Q., Morrisey, E. E., Ip, H. S., and Parmacek, M. S. (1995) J. Biol. Chem. 270, 13460-13469[Abstract/Free Full Text]
  27. Kim, S., Ip, H., Lu, M., Clendenin, C., and Parmacek, M. (1997) Mol. Cell. Biol. 17, 2266-2278[Abstract]
  28. Forsythe, S. M., Kogut, P. C., McConville, J. F., Fu, Y., McCauley, J. A., Halayko, A. J., Liu, H. W., Kao, A., Fernandes, D. J., Bellam, S., Fuchs, E., Sinha, S., Bell, G. I., Camoretti-Mercado, B., and Solway, J. (2002) Am. J. Respir. Cell Mol. Biol. 26, 298-305[Abstract/Free Full Text]
  29. Camoretti-Mercado, B., Forsythe, S. M., LeBeau, M. M., Espinosa, I., Rafael, Vieira, J. E., Halayko, A. J., Willadsen, S., Kurtz, B., and Ober, C. (1998) Genomics 49, 452-457[CrossRef][Medline] [Order article via Infotrieve]
  30. Bai, S., and Cao, X. (2002) J. Biol. Chem. 277, 4176-4182[Abstract/Free Full Text]
  31. Pulaski, L., Landstrom, M., Heldin, C.-H., and Souchelnytskyi, S. (2001) J. Biol. Chem. 276, 14344-14349[Abstract/Free Full Text]
  32. Gronroos, E., Hellman, U., Heldin, C.-H., and Ericsson, J. (2002) Mol. Cell 10, 483-493[CrossRef][Medline] [Order article via Infotrieve]
  33. Reguly, T., and Wrana, J. L. (2003) Trends Cell Biol. 13, 216-220[CrossRef][Medline] [Order article via Infotrieve]
  34. Silverman, E. K., Mosley, J. D., Palmer, L. J., Barth, M., Senter, J. M., Brown, A., Drazen, J. M., Kwiatkowski, D. J., Chapman, H. A., Campbell, E. J., Province, M. A., Rao, D. C., Reilly, J. J., Ginns, L. C., Speizer, F. E., and Weiss, S. T. (2002) Hum. Mol. Genet. 11, 623-632[Abstract/Free Full Text]
  35. Evans, S. E., Colby, T. V., Ryu, J. H., and Limper, A. H. (2004) Chest 125, 1063-1070[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
H. Deng, G. A. Dokshin, J. Lei, A. M. Goldsmith, K. N. Bitar, D. C. Fingar, M. B. Hershenson, and J. K. Bentley
Inhibition of Glycogen Synthase Kinase-3{beta} Is Sufficient for Airway Smooth Muscle Hypertrophy
J. Biol. Chem., April 11, 2008; 283(15): 10198 - 10207.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. Hu, M. Milstein, J. M. Bliss, M. Thai, G. Malhotra, L. C. Huynh, and J. Colicelli
Integration of Transforming Growth Factor {beta} and RAS Signaling Silences a RAB5 Guanine Nucleotide Exchange Factor and Enhances Growth Factor-Directed Cell Migration
Mol. Cell. Biol., March 1, 2008; 28(5): 1573 - 1583.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kennard, H. Liu, and B. Lilly
Transforming Growth Factor- (TGF- 1) Down-regulates Notch3 in Fibroblasts to Promote Smooth Muscle Gene Expression
J. Biol. Chem., January 18, 2008; 283(3): 1324 - 1333.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
A. J. Halayko, T. Tran, and R. Gosens
Phenotype and Functional Plasticity of Airway Smooth Muscle: Role of Caveolae and Caveolins
Proceedings of the ATS, January 1, 2008; 5(1): 80 - 88.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
P. G. Woodruff
Gene Expression in Asthmatic Airway Smooth Muscle
Proceedings of the ATS, January 1, 2008; 5(1): 113 - 118.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Xie, M. B. Sukkar, R. Issa, N. M. Khorasani, and K. F. Chung
Mechanisms of induction of airway smooth muscle hyperplasia by transforming growth factor-beta
Am J Physiol Lung Cell Mol Physiol, July 1, 2007; 293(1): L245 - L253.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
J. Chai, M. Norng, A. S Tarnawski, and J. Chow
A critical role of serum response factor in myofibroblast differentiation during experimental oesophageal ulcer healing in rats
Gut, May 1, 2007; 56(5): 621 - 630.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
H. D. Kollias, R. L. S. Perry, T. Miyake, A. Aziz, and J. C. McDermott
Smad7 promotes and enhances skeletal muscle differentiation.
Mol. Cell. Biol., August 1, 2006; 26(16): 6248 - 6260.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/29/20383    most recent
M602748200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Camoretti-Mercado, B.
Right arrow Articles by Solway, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Camoretti-Mercado, B.
Right arrow Articles by Solway, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement