| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 281, Issue 3, 1389-1393, January 20, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RI, Is Revealed by SSL7 Binding at the C2/C3 Interface of IgA*
1
From the
Helen Macpherson Smith Trust Inflammatory Disease Laboratory, The Austin Research Institute, Austin Health, Heidelberg, Victoria 3084, Australia and The School of Medical Sciences, University of Auckland, Private Bag 92019, Auckland 1020, New Zealand
Received for publication, August 24, 2005 , and in revised form, November 14, 2005.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
RI, thereby inhibiting IgA-mediated immunity. Recently we found Staphylococcus aureus also interferes with IgA-mediated effector functions as the putative virulence factor SSL7 also binds IgA and blocks binding to FcRI. Herein we report that SSL7 and FcRI bind many of the same key residues in the Fc region of human IgA. Residues Leu-257 and Leu-258 in domain C2 and residues 440–443 PLAF in C3 of IgA lie at the C2/C3 interface and make major contributions to the binding of both the leukocyte receptor FcRI and SSL7. It is remarkable this S. aureus IgA binding factor and unrelated factors from streptococci are functionally convergent, all targeting a number of the same residues in the IgA Fc, which comprise the binding site for the leukocyte IgA receptor, FcRI. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-grasp domain. We have recently defined two binding activities of the SSL7 protein demonstrating that SSL7 binds simultaneously to human complement factor C5 and IgA (8). The binding of IgA by SSL7 inhibited IgA binding to the leukocyte IgA receptor FcRI (CD89) thus providing a potential mechanism for evasion of IgA-mediated cellular immunity, via the blockade of IgA-mediated leukocyte effector functions such as phagocytosis and respiratory burst (9–11). General similarities with staphylococcal protein A are clear which, although an unrelated protein, is also capable of multiple interactions targeting the host immune response, including binding TNFR1 (12), C1qR (13), and IgG via VH3 Fabs (14) and the Fc at the C
2/C3 interface region (15). This study investigated the site of human IgA binding to SSL7. SSL7 was found to bind to the C2/C3 interface of IgA Fc and require residues essential for the interaction of FcRI with IgA. Thus the SSL7 and FcRI binding sites are likely to be the same or at least closely overlapping. Furthermore the interaction of SSL7 was independent of the IgA Asn-263 linked carbohydrate, which extends close to the C2/C3 interface (16). |
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Transferrin Receptor (TfR)-IgA Fc Construct—The expression of the transferrin receptor-IgA Fc fusion protein was based on the approach of Stabila et al. (17). In brief, DNA encoding the N terminus and transmembrane region of the human TfR2 was amplified from cDNA prepared from K562 cells (ATCC, Manassas, VA) using a cDNA synthesis kit (Pharmacia, Melbourne, Australia) and RNAzol (Invitrogen). PCR used the primers oBW207 CCCGAATTCGCCACCATGATGGATCAAGCTAGATCAGC and oBW208 CCCGGGCCCCTCAGTTTTTGGTTCTACCCC and the thermostable proofreading polymerase Pwo (Roche Diagnostics), and this PCR product was digested with EcoRI and ApaI (New England Biolabs, Beverly, MA). A fragment encoding the IgA1 Fc was obtained by NotI and ApaI digest of pBAR233. The baculovirus expression vector pBAR233 was a derivative of pFastBac (Invitrogen) containing a FcRIIa leader sequence, a hexahistidine tag sequence, and a human IgA1-Fc sequence derived by PCR amplification from cDNA prepared from the IgA+ cell line Dakiki (18) using the primers oBW189 GGGCCCTCAACTCCACCTACCC and oBW190 CTAGTAGCAGGTGCCGTCCACC. The sequence of this IgA1 Fc cDNA fragment differs from reference sequences (accession: NG_001019
[GenBank]
, six single nucleotide polymorphisms, BC092449
[GenBank]
, seven single nucleotide polymorphisms) resulting in two amino acid differences, L271M and R392H (standard IgA1 Bur numbering), consistent with the Dakiki IgA1 being a putative allelic variant. The EcoRI/ApaI TfR fragment and the ApaI/NotI IgA Fc fragment were simultaneously ligated into the EcoRI and NotI restriction sites of the gateway vector pENTR1A (Invitrogen) yielding pBAR355. The LR clonase reaction was used with gateway reading frame-A cassette adapted pCR3 (Invitrogen) to create the construct pBAR357 expressing the N-terminal transmembrane region of the transferrin receptor fused, at the hinge region, to the IgA Fc. The IgA1-Fc mutants were constructed by PCR of pBAR355 using Turbo Pfu (Stratagene) followed by phosphorylation and ligation of the linear PCR product as previously described (19). The LL257,258MI mutation reaction used the primer pair oBW308 GGTTCAGAAGCGAACCTCACG and oBW269 GATCATCAGGTCCTCGAGGGCCG, the A442R mutation used the primer pair oBW266 ACACAGAAGACCATCGACCG and oBW202 GAAGCGCAGCGGCAGGGCCTCG, the PLAF(440–443)HNHY mutation used oBW270 GCCCTGCACAACCACTACACACAGAAGACCATCGACCG and oBW271 CTCGTGGCCCACCATGCAG, and the N263T mutation used the primer pair oBW268 GGTTCAGAAGCGACCCTCAC and oBW309 TAAGAGCAGGTCCTCGAGTGCCG.
FcRI-Fc2b Construct—The Fc region of mouse IgG2b was amplified from cDNA prepared from Balb/c splenocytes using the primers oBW137 GGGATCCGAGCCCAGCGGGCCCATTTC and oBW172 GCCCGGGCTATTTACCCGGAGACCGGGA as described above. Splice overlap PCR was used to add the sequence GGGCCCCCTGCAGAACTGGTTCCGCGTGGATCC onto the 3'-end of the cDNA encoding the FcRI ectodomains (pBAR152) (20) immediately following the codon for Ile-208 (i.e. corresponding amino acid sequence I208-GPPAELVPRGS, thrombin cleavage site in italics). These two DNAs were ligated at their BamHI sites, and the chimeric DNA was subcloned into the StuI site of pFastBac (Life Tech) making pBAR213. The chimeric DNA was then further subcloned into the EcoRI/XbaI sites of pcDNA3 (Invitrogen). CHO-K1 cells were transfected with this construct, pBAR225, using Lipofectamine 2000 (Invitrogen) and resistant colonies selected with 1 mg/ml G418. The cell line 225CHO expressing FcRI-Fc2b was cloned by two rounds of single cell limiting dilution.
Biosensor Analysis of rSSL7 Binding to Chimeric IgA2—A BIAcore CM5 chip was derivatized with 3-nitro-4-hydroxyphenylacetate (NP-OSu, Genosys, Cambridgeshire, UK) as described in Ref. 21, and an equilibrium binding analysis was performed as described previously (19) using a BIAcore2000TM (BIAcore, Melbourne, Australia). Briefly, 1 µg/ml recombinant chimeric IgA2 anti-NIP (gift of Drs. Margaret Goodall and Roy Jefferies) was reacted (30 µl, flow rate of 10 µl/min) with the derivatized chip. The immobilized IgA2 layer was then reacted with rSSL7 in the concentration range 0.6–80 nM (100 µl, flow rate of 2 µl/min), and the response end point of each injection, above that of the injection of buffer alone, was taken as approaching the equilibrium binding response for the SSL7:IgA2 interaction. The data were fitted to the single binding site model, Req = B · A/(KD + A), where A is the free analyte concentration, and B is the binding capacity.
Expression and Binding to TfR-IgA Fc Fusion Proteins—Transient expression in CHOP cells (22) in 10 cm2 wells was performed by transfection with 5 µg of plasmid DNA and Lipofectamine 2000 reagent according to the manufacturer's instructions. After 48 or 72 h the expression of TfR-IgA Fc was measured by incubating cells (50 µl, 105cells) 1 h on ice with FITC-conjugated sheep Fab'2 anti-human IgA (Silenus/Chemicon, Melbourne, Australia) diluted 1/200 in phosphate-buffered saline containing 0.1% bovine serum albumin. After incubation the cells were resuspended in 3 ml of phosphate-buffered saline containing 0.1% bovine serum albumin and centrifuged (1000 rpm, 5 min), and the collected cells were analyzed using a FACSCalibur (Becton Dickinson). SSL7 binding activity of the mutants of IgA Fc was measured by incubating cells (105) 1 h on ice with 0.2 µg (10 pmol) of biotinylated SSL7. Unbound SSL7 was removed, and the cells were incubated in 1/400 dilution of 0.5 mg/ml phycoerythrin-conjugated streptavidin (Pharmingen) for 1 h on ice. FcRI binding activity of the mutants of IgA Fc was measured by incubating cells (105) 1 h on ice with 0.5 ml of 225CHO cell supernatant containing FcRI-Fc2b fusion protein (
0.5 µg, 5 pmol). Unbound receptor was removed, and the cells were incubated in a 1/200 dilution of FITC-conjugated sheep Fab'2 anti-mouse Ig (Silenus/Chemicon) for 1 h on ice.
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
700 response units of antibody binding and a variation between cycles of 
10 response units (Fig. 1A). The binding to this immobilized IgA2 of SSL7 at different concentrations was recorded (Fig. 1B) after 3000 s when equilibrium was being approached. Plotting the equilibrium binding responses fitted best to a single binding site with an apparent affinity of 5.0 ± 1.5 nM (n = 5, Fig. 1C, one representative experiment KD = 6.8 ± 0.8 nM).
SSL7 Inhibits FcRI-Ig Binding to IgA Fc—The Fc region of human IgA1 derived from Dakiki cells was fused to the N-terminal region of the transferrin receptor, a type II integral membrane protein. FACS analyses of transfections of CHOP cells with the WT and with the A422R IgA Fc transferrin receptor fusion constructs is shown in Fig. 2. The surface expression of the WT and mutant IgA fusion proteins was determined by staining with anti-IgA FITC (Fig. 2A) and the rSSL7 (Fig. 2B), and FcRI-Ig (Fig. 2C) binding to the same transfectants was also determined. In agreement with our previous data the binding of FcRI-Ig to WT IgA Fc fusion protein expressing cells (mean fluorescent intensity (MFI) = 38.6 ± 2) was inhibited 90% in the presence of 2 µM (40 µg/ml) rSSL7 (MFI = 8 ± 2, background staining MFI = 5 ± 1, Fig. 2D). Hence in this experimental system FcRI-Ig binding to the TfR-IgA Fc fusion protein is inhibited by rSSL7 just as rSSL7 inhibits serum IgA binding to isolated leukocytes (8).
|
RI binding to IgA, SSL7 may bind directly to the FcRI binding site, which is conserved in IgA1 and IgA2.
Molecular analysis of the SSL7 binding site was performed by mutating residues at the C2/C3 interface of IgA Fc comprising the FcRI binding site. The MFIs from FACS profiles showed the level of expression of the WT IgA fusion protein varied between experiments from a MFI = 150 (Figs. 2A and 3) in one set of transfections to 60 in another (Fig. 4). In each experiment the A442R mutant IgA Fc was always apparently expressed 2–3-fold lower than the WT. This may indicate that a proportion of this mutant IgA Fc may not fold correctly and not progress through the secretory pathway. Another possibility is that the mutation could cause a significant local alteration of the protein such that a major epitope(s) among those recognized by the anti-IgA polyclonal antiserum is disrupted leading to loss of polyclonal reactivity, rather than a lower surface expression. To go some way to address this, WT IgA Fc fusion protein-expressing cells were incubated with 5 µM (100 µg/ml) SSL7 prior to staining with the anti-IgA polyclonal antiserum (Fig. 3). Although the WT cells stained with a MFI = 146 (±5, n = 4) the staining of the cells preincubated with SSL7 (MFI = 53 ± 2) was reduced to that of the A442R mutant-expressing cells (MFI = 57 ± 2). Thus SSL7 binding to IgA Fc inhibits binding of the anti-human IgA antiserum indicating some of the recognized epitopes lie close to the SSL7 binding site, and these epitopes may be affected by mutation of this site. Thus it is possible that the A442R mutation may likewise affect the reactivity with the antiserum. Although the A442R mutation has been used to elucidate the IgA binding site of FcRI (23, 24), to avoid any ambiguity another mutation of this region, PLAF440-443HNHY was made where the FG loop of C3, PLAF, was altered to the equivalent sequence of human IgG1. The PLAF440-443HNHY mutant (MFI = 140 ± 7) was expressed at levels equivalent to the WT protein (MFI = 146 ± 5) and hence was unlikely to be misfolded (Fig. 3). Other residues of IgA, Leu-257 and Leu-258 important in FcRI binding (16, 23–25) were also mutated in the TfR-IgA Fc fusion protein to the equivalent residues in IgG1. This mutant LL257,258MI was also expressed at levels equivalent to that of the WT fusion protein (MFI = 54 ± 2, c.f. 61 ± 10; Fig. 4A). Finally a mutation of the IgA Fc fusion protein N263T abolished the IgA C2 N-glycosylation site. The expression of this protein (MFI = 54 ± 6, n = 4) was also not significantly different from that of the WT protein (MFI = 61 ± 10, n = 4) (Fig. 4A).
|
|
RI binding activities of the various TfR-IgA Fc proteins expressed on the surface of CHOP transfectants were evaluated. The binding of biotinylated rSSL7 to WT IgA fusion protein was readily detectable (Fig. 4B, MFI = 350 ± 40, n = 4). In contrast, the level of binding of SSL7 to the A442R mutant IgA Fc fusion protein (MFI = 4.5 ± 0.2) was indistinguishable from the binding to the mock-transfected cells (MFI = 4.3 ± 0.2). It is notable that an experiment with higher surface expression of IgA Fc fusion protein (Fig. 2), with correspondingly higher SSL7 binding to the WT (Fig. 2B, MFI = 980 ± 21), did reveal some low level binding of SSL7 to the A442R mutant protein (MFI = 8.4 ± 0.4, 0.15% relative to WT 100%, mock MFI = 6.9 ± 0.3). The greatly reduced SSL7 binding paralleled the reduced binding of the FcRI-Ig fusion protein, which bound surface-expressed WT IgA Fc (MFI = 29.2 ± 0.2) but not the A442R mutant (MFI = 6.5 ± 0.5, mock MFI = 6.5 ± 0.1 (Fig. 4C)). The other mutations predicted to affect FcRI binding also ablated SSL7 binding. The alternative mutation in the FG loop of domain 3 PLAF440-443HNHY abolished both SSL7 binding (MFI = 4.7 ± 0.2, mock = 4.3 ± 0.2) and FcRI-Ig binding to levels equivalent to that of the mock transfections (Fig. 4C). Mutation of residues Leu-257 and Leu-258 in the C2 AB helix/loop of IgA Fc also affected both SSL7 (MFI = 35 ± 3, 9% of WT) and FcRI-Ig binding (MFI = 8.1 ± 0.8, 7% of WT). Mutation of the N-linked glycosylation site (N263T) did not affect SSL7 binding (MFI = 330 ± 19, 94 ± 6% of WT) and only modestly reduced FcRI-Ig binding (MFI = 24 ± 2, 80 ± 6% of WT).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
RI (8). S. aureus infection of the bloodstream can lead to septicemia, and asymptomatic carriage of S. aureus can occur in the nose while life-threatening infections of the respiratory tract also occur (12). We previously had characterized SSL7 binding to serum IgA, of which the major form is IgA1 (8). The importance of S. aureus adaptation to mucosal environments prompted us to characterize the interaction of SSL7 with IgA2, the major mucosal subclass of IgA. Here we report that IgA2 also bound SSL7 with nanomolar affinity. This high affinity interaction marks SSL7 as a potential factor in the survival of S. aureus not only in the blood, but also at mucosal sites. This study has further shown that the SSL7 binding site and that of FcRI utilize common residues in the Fc region of human IgA. Residues Leu-257 and Leu-258 in the AB loop/helix of domain C2 of IgA and residues 440–443 PLAF in the FG loop of domain C3 of IgA have been found in domain swap, mutagenesis (23–25), and x-ray crystallographic studies (16) to make major contributions to the binding of the leukocyte receptor FcRI (Fig. 5). Mutation of these residues resulted in an expected decrease in soluble FcRI-Ig binding consistent with the structural data (16) and, in addition, completely abrogated SSL7 binding indicating the binding sites of SSL7 and FcRI comprise many of the same residues. In the crystal structure of IgA bound to FcRI, the N-linked carbohydrate of IgA extends down the external face of the C2 domain to the C2/C3 interface (16) (Fig. 5) and thus may potentially be involved in interaction with molecules binding to this region. The role of the carbohydrate in SSL7 binding was examined using the N-linked glycosylation site point mutant N263T. The N263T IgA Fc mutant was expressed at levels equivalent to WT and bound similar levels of SSL7 indicating that the carbohydrate did not contribute to SSL7 binding. Thus despite the fact that other bacterial proteins containing an OB-fold domain have been shown to bind oligosaccharides (26), we conclude that this is not the case for the SSL7/IgA interaction. Interestingly the IgA Asn-263-linked glycan is close to (8 Å), but not contacting, FcRI in the crystal complex (16), and in this study only a modest effect on the binding of FcRI-Ig to the glycan deficient N263T mutant was observed.
Leukocyte recruitment, phagocytosis, and respiratory burst are critical aspects of protective immunity to Gram-positive bacteria. Interfering with FcRI-mediated recognition of IgA opsonized bacteria by blocking the receptor binding site on IgA is a strategy utilized by pathogenic group A (27, 28) and group B streptococci (29, 30) to frustrate IgA-mediated protective immunity. Our report that SSL7 binds IgA with high affinity and inhibits interaction with FcRI (8) clearly demonstrates that this evasion strategy is utilized by staphylococci as well as streptococci. It is notable that these two organisms also share superantigens, which are structurally similar to the SSL structure. It is striking these unrelated IgA binding factors from group A and group B streptococci (29) and from S. aureus are functionally convergent, all targeting the same residues at the C2/C3 interface of IgA (Fig. 5), the binding site for FcRI. A second noteworthy parallel is that the different streptococcal proteins in addition to IgA binding also bind complement proteins, with the M proteins (Sir22/Arp4) also binding the classical complement regulator C4bp (and IgG) (31) and the -protein also binding the complement regulator factor H (32). An unrelated S. aureus protein, extracellular fibrinogen binding protein (Efb) also inhibits the complement pathway, in this case by binding C3 (33). Taken together these observations, including the binding of C5 and the inhibition of complement subsequent to C5 by SSL7 (8), suggest strong selection of pathogenic group A and group B streptococci (27–30) and pathogenic S. aureus to evade both host complement and IgA/Fc receptor effector systems.
|
FOOTNOTES |
|---|
1 To whom correspondence should be addressed: Austin Research Institute, Austin Health, Studley Rd., Heidelberg, Victoria 3084, Australia. Tel.: 613-9287-0644; Fax: 613-9287-0600; E-mail: b.wines{at}ari.unimelb.edu.au.
2 The abbreviations used are: TfR, transferrin receptor; FITC, fluorescein isothiocyanate; MFI, mean fluorescent intensity; NP, 3-nitro-4-hydroxyphenylacetate; SSL, staphylococcal superantigen-like protein; FACS, fluorescence-activated cell sorter; WT, wild type.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. J. Lewis, M. Meehan, P. Owen, and J. M. Woof A Common Theme in Interaction of Bacterial Immunoglobulin-binding Proteins with Immunoglobulins Illustrated in the Equine System J. Biol. Chem., June 20, 2008; 283(25): 17615 - 17623. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A. Ramsland, N. Willoughby, H. M. Trist, W. Farrugia, P. M. Hogarth, J. D. Fraser, and B. D. Wines Structural basis for evasion of IgA immunity by Staphylococcus aureus revealed in the complex of SSL7 with Fc of human IgA1 PNAS, September 18, 2007; 104(38): 15051 - 15056. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Abi-Rached, K. Dorighi, P. J. Norman, M. Yawata, and P. Parham Episodes of Natural Selection Shaped the Interactions of IgA-Fc with Fc{alpha}RI and Bacterial Decoy Proteins J. Immunol., June 15, 2007; 178(12): 7943 - 7954. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Bestebroer, M. J. J. G. Poppelier, L. H. Ulfman, P. J. Lenting, C. V. Denis, K. P. M. van Kessel, J. A. G. van Strijp, and C. J. C. de Haas Staphylococcal superantigen-like 5 binds PSGL-1 and inhibits P-selectin-mediated neutrophil rolling Blood, April 1, 2007; 109(7): 2936 - 2943. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. W. Senior and J. M. Woof Sites in the CH3 Domain of Human IgA1 That Influence Sensitivity to Bacterial IgA1 Proteases J. Immunol., September 15, 2006; 177(6): 3913 - 3919. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
