JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M603503200 on June 5, 2006

J. Biol. Chem., Vol. 281, Issue 31, 22021-22028, August 4, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/31/22021    most recent
M603503200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, J.
Right arrow Articles by Ling, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, J.
Right arrow Articles by Ling, L.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Kynurenic Acid as a Ligand for Orphan G Protein-coupled Receptor GPR35*

Jinghong Wang, Nicole Simonavicius1, Xiaosu Wu, Gayathri Swaminath, Jeff Reagan, Hui Tian, and Lei Ling2

From the Amgen Inc., South San Francisco, California 94080

Received for publication, April 12, 2006 , and in revised form, May 31, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Local catabolism of the essential amino acid tryptophan is considered an important mechanism in regulating immunological and neurological responses. The kynurenine pathway is the main route for the non-protein metabolism of tryptophan. The intermediates of the kynurenine pathway are present at micromolar concentrations in blood and are regulated by inflammatory stimuli. Here we show that GPR35, a previously orphan G protein-coupled receptor, functions as a receptor for the kynurenine pathway intermediate kynurenic acid. Kynurenic acid elicits calcium mobilization and inositol phosphate production in a GPR35-dependent manner in the presence of Gqi/o chimeric G proteins. Kynurenic acid stimulates [35S]guanosine 5'-O-(3-thiotriphosphate) binding in GPR35-expressing cells, an effect abolished by pertussis toxin treatment. Kynurenic acid also induces the internalization of GPR35. Expression analysis indicates that GPR35 is predominantly detected in immune cells and the gastrointestinal tract. Furthermore, we show that kynurenic acid inhibits lipopolysaccharide-induced tumor necrosis factor-{alpha} secretion in peripheral blood mononuclear cells. Our results suggest unexpected signaling functions for kynurenic acid through GPR35 activation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
G protein-coupled receptors (GPCRs)3 constitute one of the largest gene families yet identified (1, 2). It has been estimated that half of all modern drugs target these receptors (3, 4). GPCRs contain seven transmembrane domains and are activated by a wide variety of ligands, including light, ions, metabolic intermediates, amino acids, nucleotides, lipids, peptides, and proteins. In addition to ~250 characterized receptors, ~120 human genes encode non-olfactory GPCRs whose ligands and function remain to be determined (1). These orphan receptors are expected to play important roles in the regulation of a diversity of physiological functions.

In the past decade an increasing number of GPCRs have been de-orphanized. Many of the identified ligands are metabolic intermediates, including succinate (ligand for GPR91) (5), {alpha}-ketoglutarate (ligand for GPR99) (5), fatty acids (ligands for GPR40/41/43/120) (6-10), ketone body (ligand for HM74a) (11), and bile acids (ligand for BG37) (12). We have built a library of ~300 biochemical intermediates to test their ability to activate orphan GPCRs. We identified kynurenic acid, one of the first metabolites of tryptophan isolated and characterized in mammals (13, 14), as a ligand for GPR35. Cloned as an orphan GPCR in 1998 (15), GPR35 shares 30% amino acid identity with GPR55. Expression analysis revealed prominent expression of GPR35 in immune and gastrointestinal tissues, suggesting potential physiological roles for GPR35 in these organs.

Tryptophan metabolites such as serotonin and melatonin are well known ligands for GPCRs. Kynurenic acid has been reported to play important physiological roles in the brain (16, 17). Most biological effects associated with kynurenic acid, such as neuroprotective activities, have been attributed to its antagonism on N-methyl-D-aspartate (NMDA) receptor (16, 18). Here we have identified a novel mechanism by which kynurenic acid may regulate peripheral cellular responses through activation of GPR35.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cloning and Cell Culture—Full-length human, mouse, and rat GPR35 were cloned by PCR from human universal cDNA, mouse spleen cDNA, and rat spleen cDNA (BD Bioscience Clontech), respectively. Sequence-confirmed cDNAs were inserted into the mammalian expression vector pcDNA3.1 (Invitrogen). Chinese hamster ovary (CHO) cells were maintained in Dulbecco's modified Eagle's medium/nutrient mixture F-12 (Cellgro) containing 10% fetal bovine serum and antibiotics. HeLa and HEK293 cells were grown in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and antibiotics. All cell lines were cultured at 37 °C with 5% CO2. CHO-GPR35 stable cells were generated by transfecting CHO cells with N-terminal-FLAG-tagged human GPR35 and subsequently selected in 1 mg/ml G418 (Invitrogen). Flow cytometry analysis was carried out on FACSCalibur (BD Biosciences) after staining with anti-FLAG M2 monoclonal antibody (Sigma) and goat anti-mouse IgG-fluorescein isothiocyanate secondary antibody (Caltag). All compounds tested were from Sigma.

Aequorin Assay—CHO cells were transfected with either empty vector or vector expressing GPR35 together with the aequorin reporter plasmid using Lipofectamine 2000 reagent (Invitrogen) (5, 19). For each 10-cm dish, 5 µg of GPR35 and 5 µg of aequorin reporter plasmids were used. When indicated, 2 µg of plasmids expressing small G proteins (G{alpha}16, Gqo5, Gqi9, and/or Gqs5) (20-23) were also included. 24 h after transfection cells were harvested and resuspended in Hanks' buffered salt solution containing 0.01% bovine serum albumin and 20 mM HEPES (Cellgro), loaded with 1 µg/ml coelenterazine f (P. J. K. Industrievertetungen, Handel, Germany) at room temperature for 1 h, and stimulated with compounds. Ligand-induced calcium mobilization, as indicated by an increase in aequorin luminescence, was recorded over a period of 20 s with a Microlumat luminometer (Berthold).


Figure 1
View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 1.
Identification of kynurenic acid as a ligand for GPR35. A, dose-dependent activation of GPR35 by kynurenic acid. CHO cells were transfected with human GPR35 or vector control in the presence of plasmids expressing aequorin reporter and G protein mixture (G{alpha}16, Gqo5, Gqi9, and Gqs5). Ligand-induced [Ca2+]i increase was recorded as aequorin luminescence signal. RLU, relative luminescence units. Data shown are the means ± S.E. for duplicate determinations. B, structure of kynurenic acid. C, tryptophan metabolic pathway (18). The kynurenine pathway, the main route for the metabolism of tryptophan, is shown in bold.

 
Inositol Phosphate Accumulation Assay—HEK293 cells seeded in 96-well plates were transfected with GPR35 (100 ng/well) and small G proteins (G{alpha}16 or Gqo5, 20 ng/well). After labeling with [3H]myoinositol (Amersham Biosciences) for 16 h, cells were stimulated with compounds in Hanks' buffered salt solution, 25 mM Hepes (pH 7.4), 10 mM LiCl, 0.01% bovine serum albumin at 37 °C for 1 h. 20 mM formic acid was used to lyse the cells at 4 °C for 4 h. Ysi-SPA beads (Amersham Biosciences) were added to the cell lysates and incubated overnight in the dark. Radioactivity was recorded on a Topcount 96/384 scintillation counter (Packard).

GTP{gamma}S Binding Assay—CHO-GPR35 stable cells were pretreated with or without pertussis toxin (Calbiochem, 100 ng/ml) for 16 h before harvesting. Cells were resuspended and homogenized in 10 mM Tris-HCl (pH 7.4), 1 mM EDTA followed by centrifugation at 1000 x g for 10 min at 4 °C to remove nuclei and cellular debris. Membrane fractions were collected by spinning the supernatant at 38,000 x g for 30 min and resuspended in 20 mM HEPES (pH 7.5) and 5 mM MgCl2. 25 µg of membranes was incubated at room temperature for 1 h in assay buffer (20 mM HEPES, 5 mM MgCl2, 0.1% bovine serum albumin (pH 7.5)) containing 3 µM GDP and 0.1 nM [35S]GTP{gamma}S (PerkinElmer Life Sciences) in the absence or presence of kynurenic acid. Reactions were terminated by vacuum filtration through GF/B filters, and the retained radioactivities were quantified on liquid scintillation counter.


Figure 2
View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 2.
Activation of GPR35 from various species by kynurenic acid. Human (A), mouse (B), or rat GPR35 (C) was tested in aequorin assay in the presence of a co-transfected G protein mixture (G{alpha}16, Gqo5, Gqi9, and Gqs5). [Ca2+]i increase, shown as aequorin luminescence signal, was recorded. Data are shown as the means ± S.E. for duplicate determinations. Quinolinic acid, another metabolite in tryptophan pathway, did not activate GPR35. RLU, relative luminescence units.

 
Immunofluorescence Staining—HeLa cells were seeded on coverslips in 6-well plates and transfected with N-terminal-FLAG-tagged human, mouse, or rat GPR35. For surface staining, cells were fixed with 4% paraformaldehyde, blocked with 5% goat serum in phosphate-buffered saline (Cellgro), and incubated with anti-FLAG M1 monoclonal antibody (Sigma) for 1 h on ice. After extensive washing in phosphate-buffered saline, cells were incubated with goat anti-mouse IgG-rhodamine secondary antibody for an additional 30 min. Internalization of GPR35 was induced by kynurenic acid (300 µM) for 30 min at 37 °C. After ligand stimulation, cells were fixed with 4% paraformaldehyde and permeabilized with 0.5% Triton before staining with antibodies. Images were captured with a CCD digital camera connected to a Leica DC500 microscope.


Figure 3
View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 3.
Potentiation of kynurenic acid-induced GPR35 activation by Gqo5 and Gqi9. CHO cells were transfected with human GPR35 and aequorin plasmid in the absence or presence of individual G protein plasmids (G{alpha}16, Gqo5, Gqi9, Gqs5). [Ca2+]i increase, shown as aequorin luminescence signal, was recorded. RLU, relative luminescence units.

 


Figure 4
View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 4.
Stimulation of inositol phosphate formation in GPR35-expressing cells by kynurenic acid. HEK293 cells were transiently transfected with human GPR35 (A) or mouse GPR35 (B) and G{alpha}16 or Gqo5 plasmids. Cells were labeled with [3H]myoinositol for 16 h and stimulated with compounds in 10 mM LiCl at 37 °C for 1 h. Data are shown as the means ± S.E. from quadruple determinations.

 
Quantitative RT-PCR Analysis—Total RNA from human or mouse tissues (BD Biosciences Clontech) were treated with DNase I (Ambion) before reverse transcription. Quantitative reverse transcriptase-PCR was performed on an ABI Prism 7700 sequence detector using Taqman PCR core reagents (Applied Biosystems). Ratios of GPR35 to glyceraldehyde-3-phosphate dehydrogenase message RNA were calculated using a {Delta}{Delta}Ct method (Applied Biosystems). Primers and probes were designed using Primer Express software (Applied Biosystems). Primer and probe sequences for human GPR35 were GTGCCCTCCTGGAGACGAT (forward) and GCAGCAGTTGGCATCTGAGA (reverse) and for the probe, 5'-FAM-CGTCGCGCCCTGTACATAACCAGC-BHQ-3'. (FAM, 6-carboxyfluorescein; BHQ, black hole quencher). Primer and probe sequences for mouse GPR35 were ATCACAGGTAAACTCTCAGACACCAACT (forward) and CTTGAACGCTTCCTGGAACTCT (reverse) and for the probe, 5'-FAM-TGGATGCCATCTGTTACTACTACATGGCCA-BHQ-3'.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 5.
Stimulation of [35S]GTP{gamma}S binding in GPR35-expressing cells by kynurenic acid. A, flow cytometry analysis. CHO cells stably expressing N-terminal-FLAG-tagged human GPR35 (CHO-GPR35) or vector control cells (CHO-vector) were incubated with anti-FLAG antibody and goat-anti-mouse IgG-fluorescein isothiocyanate secondary antibody. B, [35S]GTP{gamma}S binding assay. Membrane preparations of CHO-GPR35 cells were incubated with various concentrations of kynurenic acid. Specific incorporation of [35S]GTP{gamma}S was obtained by subtracting counts without ligand from the counts with ligand. 100 ng/ml pertussis toxin (PTX) was included when indicated. Data are shown as the means ± S.E. from duplicate determinations.

 
In Situ Hybridization—Mouse GPR35 cDNA cloned in pCMV-SPORT6 vector (Invitrogen) was used as a template for generating RNA probes using T7 and SP6 RNA polymerase (Promega). [33P]UTP-labeled antisense or sense GPR35 RNA probes were hybridized to paraformaldehyde-fixed, paraffin-embedded mouse tissue array (Imgenex). The hybridization buffer contained 50% formamide, 300 mM NaCl, 20 mM Tris-Cl (pH 8.0), 10 mM NaH2PO4, 10% dextran sulfate, 1x Denhardt's solution, 0.5 mg/ml tRNA as described (24). After extensive washing, slides were exposed to x-ray film, dipped in emulsion type NTB (Kodak), and developed after 3 weeks. Sections were counterstained with hematoxylin for nuclear visualization.


Figure 6
View larger version (65K):
[in this window]
[in a new window]
  		FIGURE 6.
Surface expression and internalization of GPR35. A, HeLa cells transfected with N-terminal-FLAG-tagged GPR35 were stained with anti-FLAG antibody without permeabilization. Anti-mouse-IgG-rhodamine was used as a secondary antibody. No detectable surface staining was observed in cells expressing an intracellular protein IKKbeta. Magnification, 400x. B, kynurenic acid-induced GPR35 internalization. Cells expressing N-terminal-FLAG-tagged human GPR35 were incubated with kynurenic acid at 37 °C for 30 min. The internalized receptors are shown as punctate vesicles inside the cells after permeabilization. Magnification, 400x.

 
Cytokine Secretion—Human peripheral blood mononuclear cells and CD14+ monocytes were purchased from Allcells. Peripheral blood mononuclear cells were seeded at a density of 2 x 106 cells/ml, and monocytes were seeded at 2 x 105 cells/ml in 24-well plates in RPMI 1640 medium. Kynurenic acid was added 1 h before lipopolysaccharides (LPS (Sigma), final concentration at 10 ng/ml). Cells were incubated at 37 °C for 18 h, and supernatant was collected for cytokine assay. Untreated cells were used as controls. TNF-{alpha} concentrations were determined with Quantikine enzyme-linked immunosorbent assay kits (R&D Systems) following the manufacturer's instructions.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
To search for natural ligands for orphan GPCRs, we tested a collection of ~300 biochemical intermediates for their ability to evoke an increase in intracellular Ca2+ concentration ([Ca2+]i) using the aequorin assay (19). CHO cells were transiently transfected with plasmids encoding human GPR35, aequorin reporter, and a mixture of promiscuous or chimeric small G proteins (G{alpha}16, Gqs5, Gqo5, and Gqi9), which have been reported to couple with GPCRs that are not normally linked to Ca2+ signaling and shift their signal transduction to calcium mobilization (21-23). Kynurenic acid evoked a specific rise in [Ca2+]i in cells expressing human GPR35 and G protein mixture, with a medium effective concentration (EC50)of39 µM (Fig. 1A). No specific response was observed in control cells (Fig. 1A). Kynurenic acid (structure shown in Fig. 1B)isa metabolite in the tryptophan metabolic pathway (Fig. 1C).

Kynurenic acid also activated mouse and rat orthologues of GPR35 (Fig. 2). Quinolinic acid, another metabolite of the tryptophan pathway and often indicated to have opposing functions to kynurenic acid (16), produced no response (Fig. 2). Interestingly, kynurenic acid is more potent on rodent GPR35 than on human GPR35, with EC50 values of 11 and 7 µM for mouse and rat GPR35, respectively. GPR35 was selectively activated by kynurenic acid but not by other tryptophan metabolic pathway intermediates (Table 1) such as 3-hydroxyanthranilic acid and 3-hydroxykynurenine that are implicated in T cell regulation (25). Of ~300 biochemical intermediates, kynurenic acid was found to be the most potent in stimulating GPR35 (data not shown). Furthermore, kynurenic acid did not activate ~40 other GPCRs, including GPR55, the closest homologue of GPR35 (data not shown).


View this table:
[in this window]
[in a new window]
  		TABLE 1
Tryptophan metabolites potency in aequorin assay EC50 indicates the concentration of a compound that produces 50% of the maximum response and is calculated from dose-response curves. Data were generated from CHO cells transfected with GPR35, aequorin, and chimeric G protein plasmids in aequorin assay. Inactive, no response at 1000 µM.

 
To dissect the signaling pathways of GPR35, CHO cells were transfected with plasmids encoding human GPR35 and individual small G proteins and tested in aequorin assay. The Gqi/o chimeras (22), Gqo5 and Gqi9, significantly potentiated the activation of GPR35 by kynurenic acid, whereas Gqs chimera (Gqs5) and the promiscuous G protein G{alpha}16 did not (Fig. 3). The use of Gqi/o chimera was reported to allow the Gi/o-coupled GPCRs to signal via the Gq pathway, leading to calcium mobilization (21). These results suggest that GPR35 may signal through Gi/o pathways in CHO cells.


Figure 7
View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 7.
Quantitative reverse transcriptase-PCR analysis of GPR35 expression. Expression of GPR35 in human tissues (A), mouse tissues (B), and sub-populations of human peripheral blood leukocytes (C) was determined. Ratios of GPR35 to glyceraldehyde-3-phosphate dehydrogenase mRNA were calculated. Data are shown as means ± S.E. from duplicate determinations. The primer and probe sequences are included under "Experimental Procedures."

 
Kynurenic acid induced the accumulation of inositol phosphate in HEK293 cells transiently transfected with GPR35 and Gqo5 (Fig. 4). No inositol phosphate formation was detected in the absence of co-transfected G proteins, suggesting that GPR35 may not signal through the Gq pathway (Fig. 4). These results agree with the observation that the Gqi/o chimeras significantly enhanced GPR35 activation in the aequorin assay (Fig. 3).

Flow cytometry analysis showed surface expression of GPR35 on CHO cells stably expressing N-terminal-FLAG-tagged human GPR35 but not vector control cells (Fig. 5A). Kynurenic acid stimulated [35S]GTP{gamma}S incorporation in membrane preparations from CHO-GPR35 cells, an effect abolished by preincubation with pertussis toxin (Fig. 5B). CHO-vector control cells did not respond to kynurenic acid (data not shown). The EC50 for kynurenic acid-induced activation of human GPR35 in [35S]GTP{gamma}S binding assay was 36 µM, similar to the EC50 value obtained from the aequorin assay. These results, together with the preference for Gqi/o chimeras in the aequorin and inositol phosphate formation assays suggest that GPR35 activation by kynurenic acid couples to a pertussis toxin-sensitive Gi/o pathway.


Figure 8
View larger version (87K):
[in this window]
[in a new window]
  		FIGURE 8.
In situ hybridization analysis of GPR35 expression in mouse tissues. A, mouse tissue arrays were hybridized to 33P-labeled antisense or sense GPR35 riboprobe. After extensive washing the slides were exposed to x-ray film. The names of the tissues that showed high GPR35 expression were shaded. B-D, localization of GPR35 (black grains) in duodenum (B), ileum (C), and colon (D). Crypts of Lieberkühn were indicated by arrowheads. Intestinal villi (Vi) and laminal propria (LP) were also labeled. Sections were counterstained with hematoxylin. Adjacent sections stained with GPR35 sense probe as negative controls were included for comparison. Magnification, 100x and 400x.

 
Ligand-induced receptor internalization is often characteristic of GPCR activation and signal attenuation (26). Immunofluorescence staining of cells expressing N-terminal-FLAG-tagged human, mouse, or rat GPR35 revealed that GPR35 proteins from different species were localized to the plasma membrane (Fig. 6A). In contrast, a FLAG-tagged protein IKKbeta (27) exhibited an expected intracellular localization (Fig. 6A). Kynurenic acid stimulation induced the translocation of GPR35 from plasma membrane to punctate intracellular structures (Fig. 6B), a characteristic of receptor internalization.

Expression analysis by quantitative reverse transcriptase-mediated PCR revealed that both human GPR35 and mouse GPR35 were predominantly expressed in immune and gastrointestinal tissues, with limited expression in other tissues (Fig. 7). In humans, GPR35 messenger RNA was mainly detected in the peripheral leukocytes, spleen, small intestine, colon, and stomach (Fig. 7A). In mice, high levels of GPR35 expression were detected in the spleen and gastrointestinal tract (Fig. 7B). Similar results were obtained using primers and probes annealing to different regions of GPR35 (data not shown). Among various subpopulations of immune cells, GPR35 was detected in CD14+ monocytes, T cells, neutrophils, and dendritic cells, with lower expression in B cells, eosinophils, basophils, and platelets (Fig. 7C).

In situ hybridization experiments using mouse multiple tissue arrays corroborated with quantitative reverse transcriptase-PCR data. Specific GPR35-positive signals were detected in the spleen and gastrointestinal tract, including duodenum, jejunum, ileum, cecum, colon, and rectum (Fig. 8A). GPR35 sense probe did not generate significant signals in these tissues (Fig. 8A). In various regions of the intestine (duodenum in Fig. 8B, ileum in Fig. 8C, and colon in Fig. 8D), GPR35 was primarily expressed in the epithelial cells located in the crypts of Lieberkühn, with lower expression in the intestinal villi. No significant signals were detected in lamina propria, muscularis propria, and enteric neurons (data not shown).


Figure 9
View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 9.
Inhibition of LPS-induced TNF-{alpha} release by kynurenic acid. Human peripheral blood mononuclear cells (A) or CD14+ monocytes (B) were incubated with kynurenic acid (mM) in the absence or presence of 10 ng/ml LPS. 18 h after the treatment, concentrations of TNF{alpha} in cell culture supernatants were determined.

 
To investigate the potential biological functions of kynurenic acid on immune cells expressing GPR35, we tested the effect of kynurenic acid on cytokine secretion in human peripheral blood mononuclear cells. Kynurenic acid by itself did not stimulate TNF{alpha} secretion in these cells (data not shown). However, kynurenic acid was able to attenuate LPS-induced TNF{alpha} secretion in a dose-dependent manner (Fig. 9A). Similar results were obtained using purified peripheral blood CD14+ monocytes (Fig. 9B).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
In the current study we have identified kynurenic acid, an intermediate in the tryptophan metabolic pathway, as a ligand for GPR35. Kynurenic acid activated GPR35 in aequorin assay and inositol phosphate accumulation assay in the presence of Gqi/o chimeric G proteins. Kynurenic acid also stimulated [35S]GTP{gamma}S binding in a GPR35-dependent manner and induced the internalization of GPR35. The discovery of kynurenic acid as an endogenous ligand for GPR35 further highlighted the importance of tryptophan catabolism in regulating biological functions.

The tryptophan metabolic pathway leading to the synthesis of kynurenine (kynurenine pathway) is the main route for non-protein metabolism of the essential amino acid tryptophan. Of the dietary tryptophan intake that is converted biochemically into other compounds, ~99% is metabolized by the kynurenine pathway (16). Given its roles in immunity and the central nervous system, the kynurenine pathway has emerged as an attractive target for drug development (16, 17, 25, 28). As an intermediate of the kynurenine pathway, kynurenic acid has been shown to be a naturally occurring antagonist for NMDA glutamate receptor (IC50 ~ 8-15 µM in the absence of glycine; IC50 ~ 230 µM in the presence of 10 µM glycine) (29, 30) and mediates a neuroprotective effect. Another intermediate in the pathway, quinolinic acid, could excite neurons and cause neurotoxicity in the central nervous system by acting as an agonist at the NMDA receptors (17, 18). The EC50 values of kynurenic acid on GPR35 activation reported in the current study are comparable with the concentration required for NMDA receptor antagonism.

Tryptophan metabolic pathway is activated during inflammatory conditions such as viral invasion, bacterial lipopolysaccharide, or interferon-{gamma} stimulation (31, 32). The activation of tryptophan metabolism causes a reduced plasma tryptophan level and an elevation of kynurenic acid level (16). Kynurenic acid has a basal plasma level of ~140 nM (33), and its concentration is substantially elevated to micromolar level by inflammatory responses and cytokine release (34-37). The concentrations of kynurenic acid required for GPR35 activation in in vitro assays are higher than basal plasma kynurenic acid level (EC50 values were ~39, 11, and 7 µM for human, mouse, and rat GPR35, respectively, in aequorin assays). However, it is frequently observed that a much higher ligand concentration is required when Gi/o-coupled receptors are converted to Gq signaling by coexpressing chimeric G proteins (11, 38, 39). Furthermore, serum or plasma measurements only reflect the concentration of kynurenic acid after diffusion and dilution from the site of release and, therefore, may underestimate the effective concentration at the site of action. This is particularly true when a local inflammatory reaction occurs after infection, injury, or immune cell activation. Because kynurenic acid is a metabolite that is not subject to rapid subsequent metabolism, it is conceivable that higher concentrations than blood levels can be achieved in local tissues to evoke a significant biological effect.

The predominant expression of GPR35 in immune cells and the elevation of kynurenic acid levels during inflammation suggest that this receptor-ligand pair may play important roles in immunological regulation. In fact, kynurenic acid inhibited LPS-induced TNF{alpha} secretion in peripheral blood monocytes (Fig. 9). Because the tryptophan metabolic pathway is activated by pro-inflammatory stimuli, the anti-inflammatory effect of kynurenic acid provides an interesting feedback mechanism in modulating immune responses. More in depth studies are needed to address whether the anti-inflammatory effects of kynurenic acid are mediated by GPR35 activation.

GPR35 is enriched in the intestinal crypts of Lieberkühn, which are rich in actively proliferating stem cells and progenitor cells crucial for the self-renewal of gastrointestinal epithelium (40). Interestingly, elevated plasma levels of kynurenic acid are reported in patients with inflammatory bowel diseases (36, 37). The involvement of GPR35 in inflammatory bowel diseases such as ulcerative colitis and Crohn disease and other gastrointestinal disorders should be further investigated.

GPR35 has limited expression in the brain, where kynurenic acid is known to exert neuroprotective effects (18). Although mechanisms such as NMDA receptor blockade by kynurenic acid have been recognized, the roles of GPR35 in these processes are unknown. It remains to be investigated whether some of the effects mediated by kynurenic acid in the brain might result from GPR35 activation. GPR35-deficient mice will be valuable for dissecting the biological functions of kynurenic acid.

GPR35 has been reported as a potential oncogene implicated in gastric cancer (41). The kynurenine pathway is activated in immune cells surrounding the core of solid tumors (16). It is possible that kynurenic acid produced by activated immune cells could stimulate the abnormal growth of gastrointestinal cells expressing GPR35, contributing to tumorigenesis in these tissues.

Thus, we have identified the tryptophan metabolite kynurenic acid as an endogenous ligand for GPR35. This study together with others (5-10) suggests that metabolic intermediates previously believed to be biologically inactive merit further investigation. The signaling functions of these chemicals shall emerge as a new area for pharmacological studies. The newly identified receptors for these metabolic intermediates shall present novel opportunities for drug discovery and development.


   FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Present address: Breakthrough Breast Cancer Research Centre, The Institute of Cancer Research, London SW3 6JB, UK. Back

2 To whom correspondence should be addressed. Tel.: 650-244-2560; Fax: 650-244-2400; E-mail: lling{at}amgen.com.

3 The abbreviations used are: GPCR, G protein-coupled receptor; GTP{gamma}S, guanosine 5'-O-(3-thiotriphosphate); [Ca2+]i, intracellular Ca2+ concentration; EC50, medium effective concentration; NMDA, N-methyl-D-aspartate; CHO, Chinese hamster ovary; LPS, lipopolysaccharides; TNF{alpha}, tumor necrosis factor {alpha}. Back


   ACKNOWLEDGMENTS
 
We thank Drs. Russ Cattley, Gene Cutler, Helene Baribault, Peter Coward, and Phil Babij for support and discussion. We also thank David Goeddel for critical reading of the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Fredriksson, R., and Schioth, H. B. (2005) Mol. Pharmacol. 67, 1414-1425[Abstract/Free Full Text]
  2. Fredriksson, R., Lagerstrom, M. C., Lundin, L. G., and Schioth, H. B. (2003) Mol. Pharmacol. 63, 1256-1272[Abstract/Free Full Text]
  3. Flower, D. R. (1999) Biochim. Biophys. Acta 1422, 207-234[Medline] [Order article via Infotrieve]
  4. Wise, A., Gearing, K., and Rees, S. (2002) Drug Discov. Today 7, 235-246[CrossRef][Medline] [Order article via Infotrieve]
  5. He, W., Miao, F. J., Lin, D. C., Schwandner, R. T., Wang, Z., Gao, J., Chen, J. L., Tian, H., and Ling, L. (2004) Nature 429, 188-193[CrossRef][Medline] [Order article via Infotrieve]
  6. Briscoe, C. P., Tadayyon, M., Andrews, J. L., Benson, W. G., Chambers, J. K., Eilert, M. M., Ellis, C., Elshourbagy, N. A., Goetz, A. S., Minnick, D. T., Murdock, P. R., Sauls, H. R., Jr., Shabon, U., Spinage, L. D., Strum, J. C., Szekeres, P. G., Tan, K. B., Way, J. M., Ignar, D. M., Wilson, S., and Muir, A. I. (2003) J. Biol. Chem. 278, 11303-11311[Abstract/Free Full Text]
  7. Brown, A. J., Goldsworthy, S. M., Barnes, A. A., Eilert, M. M., Tcheang, L., Daniels, D., Muir, A. I., Wigglesworth, M. J., Kinghorn, I., Fraser, N. J., Pike, N. B., Strum, J. C., Steplewski, K. M., Murdock, P. R., Holder, J. C., Marshall, F. H., Szekeres, P. G., Wilson, S., Ignar, D. M., Foord, S. M., Wise, A., and Dowell, S. J. (2003) J. Biol. Chem. 278, 11312-11319[Abstract/Free Full Text]
  8. Le Poul, E., Loison, C., Struyf, S., Springael, J. Y., Lannoy, V., Decobecq, M. E., Brezillon, S., Dupriez, V., Vassart, G., Van Damme, J., Parmentier, M., and Detheux, M. (2003) J. Biol. Chem. 278, 25481-25489[Abstract/Free Full Text]
  9. Itoh, Y., Kawamata, Y., Harada, M., Kobayashi, M., Fujii, R., Fukusumi, S., Ogi, K., Hosoya, M., Tanaka, Y., Uejima, H., Tanaka, H., Maruyama, M., Satoh, R., Okubo, S., Kizawa, H., Komatsu, H., Matsumura, F., Noguchi, Y., Shinohara, T., Hinuma, S., Fujisawa, Y., and Fujino, M. (2003) Nature 422, 173-176[CrossRef][Medline] [Order article via Infotrieve]
  10. Hirasawa, A., Tsumaya, K., Awaji, T., Katsuma, S., Adachi, T., Yamada, M., Sugimoto, Y., Miyazaki, S., and Tsujimoto, G. (2005) Nat. Med. 11, 90-94[CrossRef][Medline] [Order article via Infotrieve]
  11. Taggart, A. K., Kero, J., Gan, X., Cai, T. Q., Cheng, K., Ippolito, M., Ren, N., Kaplan, R., Wu, K., Wu, T. J., Jin, L., Liaw, C., Chen, R., Richman, J., Connolly, D., Offermanns, S., Wright, S. D., and Waters, M. G. (2005) J. Biol. Chem. 280, 26649-26652[Abstract/Free Full Text]
  12. Maruyama, T., Miyamoto, Y., Nakamura, T., Tamai, Y., Okada, H., Sugiyama, E., Nakamura, T., Itadani, H., and Tanaka, K. (2002) Biochem. Biophys. Res. Commun. 298, 714-719[CrossRef][Medline] [Order article via Infotrieve]
  13. Ellinger, A. (1904) Hoppe-Seyler's Z. Physiol. Chem. 43, 325-337
  14. Homer, A. (1914) J. Biol. Chem. 17, 509-518[Free Full Text]
  15. O'Dowd, B. F., Nguyen, T., Marchese, A., Cheng, R., Lynch, K. R., Heng, H. H., Kolakowski, L. F., Jr., and George, S. R. (1998) Genomics 47, 310-313[CrossRef][Medline] [Order article via Infotrieve]
  16. Stone, T. W., and Darlington, L. G. (2002) Nat. Rev. Drug Discov. 1, 609-620[CrossRef][Medline] [Order article via Infotrieve]
  17. Schwarcz, R. (2004) Curr. Opin. Pharmacol. 4, 12-17[CrossRef][Medline] [Order article via Infotrieve]
  18. Stone, T. W., Mackay, G. M., Forrest, C. M., Clark, C. J., and Darlington, L. G. (2003) Clin. Chem. Lab. Med. 41, 852-859[CrossRef][Medline] [Order article via Infotrieve]
  19. Stables, J., Green, A., Marshall, F., Fraser, N., Knight, E., Sautel, M., Milligan, G., Lee, M., and Rees, S. (1997) Anal. Biochem. 252, 115-126[CrossRef][Medline] [Order article via Infotrieve]
  20. Amatruda, T. T., III, Steele, D. A., Slepak, V. Z., and Simon, M. I. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 5587-5591[Abstract/Free Full Text]
  21. Conklin, B. R., Farfel, Z., Lustig, K. D., Julius, D., and Bourne, H. R. (1993) Nature 363, 274-276[CrossRef][Medline] [Order article via Infotrieve]
  22. Coward, P., Chan, S. D., Wada, H. G., Humphries, G. M., and Conklin, B. R. (1999) Anal. Biochem. 270, 242-248[CrossRef][Medline] [Order article via Infotrieve]
  23. Milligan, G., Marshall, F., and Rees, S. (1996) Trends Pharmacol. Sci. 17, 235-237[CrossRef][Medline] [Order article via Infotrieve]
  24. Chuang, P. T., Kawcak, T., and McMahon, A. P. (2003) Genes Dev. 17, 342-347[Abstract/Free Full Text]
  25. Platten, M., Ho, P. P., Youssef, S., Fontoura, P., Garren, H., Hur, E. M., Gupta, R., Lee, L. Y., Kidd, B. A., Robinson, W. H., Sobel, R. A., Selley, M. L., and Steinman, L. (2005) Science 310, 850-855[Abstract/Free Full Text]
  26. von Zastrow, M., and Kobilka, B. K. (1994) J. Biol. Chem. 269, 18448-18452[Abstract/Free Full Text]
  27. Woronicz, J. D., Gao, X., Cao, Z., Rothe, M., and Goeddel, D. V. (1997) Science 278, 866-869[Abstract/Free Full Text]
  28. Steinman, L. (2004) Nat. Immunol. 5, 575-581[CrossRef][Medline] [Order article via Infotrieve]
  29. Kessler, M., Terramani, T., Lynch, G., and Baudry, M. (1989) J. Neurochem. 52, 1319-1328[Medline] [Order article via Infotrieve]
  30. Pereira, E. F., Hilmas, C., Santos, M. D., Alkondon, M., Maelicke, A., and Albuquerque, E. X. (2002) J. Neurobiol. 53, 479-500[CrossRef][Medline] [Order article via Infotrieve]
  31. Taylor, M. W., and Feng, G. S. (1991) FASEB J. 5, 2516-2522[Abstract]
  32. Mellor, A. L., and Munn, D. H. (2004) Nat. Rev. Immunol. 4, 762-774[CrossRef][Medline] [Order article via Infotrieve]
  33. Swartz, K. J., During, M. J., Freese, A., and Beal, M. F. (1990) J. Neurosci. 10, 2965-2973[Abstract]
  34. Heyes, M. P., Saito, K., Crowley, J. S., Davis, L. E., Demitrack, M. A., Der, M., Dilling, L. A., Elia, J., Kruesi, M. J., Lackner, A., et al. (1992) Brain 115, 1249-1273[Abstract/Free Full Text]
  35. Saito, K., Markey, S. P., and Heyes, M. P. (1992) Neuroscience 51, 25-39[CrossRef][Medline] [Order article via Infotrieve]
  36. Forrest, C. M., Gould, S. R., Darlington, L. G., and Stone, T. W. (2003) Adv. Exp. Med. Biol. 527, 395-400[Medline] [Order article via Infotrieve]
  37. Forrest, C. M., Youd, P., Kennedy, A., Gould, S. R., Darlington, L. G., and Stone, T. W. (2002) J. Biomed. Sci. 9, 436-442[Medline] [Order article via Infotrieve]
  38. Liu, C., Chen, J., Sutton, S., Roland, B., Kuei, C., Farmer, N., Sillard, R., and Lovenberg, T. W. (2003) J. Biol. Chem. 278, 50765-50770[Abstract/Free Full Text]
  39. Liu, C., Eriste, E., Sutton, S., Chen, J., Roland, B., Kuei, C., Farmer, N., Jornvall, H., Sillard, R., and Lovenberg, T. W. (2003) J. Biol. Chem. 278, 50754-50764[Abstract/Free Full Text]
  40. Hauck, A. L., Swanson, K. S., Kenis, P. J., Leckband, D. E., Gaskins, H. R., and Schook, L. B. (2005) Birth Defects Res. C. Embryo Today 75, 58-71[CrossRef][Medline] [Order article via Infotrieve]
  41. Okumura, S., Baba, H., Kumada, T., Nanmoku, K., Nakajima, H., Nakane, Y., Hioki, K., and Ikenaka, K. (2004) Cancer Sci. 95, 131-135[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
Q. Han, H. Robinson, and J. Li
Crystal Structure of Human Kynurenine Aminotransferase II
J. Biol. Chem., February 8, 2008; 283(6): 3567 - 3573.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.Home page
J. Guo, D. J. Williams, H. L. Puhl III, and S. R. Ikeda
Inhibition of N-Type Calcium Channels by Activation of GPR35, an Orphan Receptor, Heterologously Expressed in Rat Sympathetic Neurons
J. Pharmacol. Exp. Ther., January 1, 2008; 324(1): 342 - 351.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Wang, X. Wu, N. Simonavicius, H. Tian, and L. Ling
Medium-chain Fatty Acids as Ligands for Orphan G Protein-coupled Receptor GPR84
J. Biol. Chem., November 10, 2006; 281(45): 34457 - 34464.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/31/22021    most recent
M603503200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, J.
Right arrow Articles by Ling, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, J.
Right arrow Articles by Ling, L.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.