Originally published In Press as doi:10.1074/jbc.M604644200 on June 7, 2006
J. Biol. Chem., Vol. 281, Issue 31, 22421-22426, August 4, 2006
The
Subunit of the Granulocyte-Macrophage Colony-stimulating Factor Receptor Interacts with c-Kit and Inhibits c-Kit Signaling*
Jian Chen
1,
Juan M. Cárcamo
2, and
David W. Golde

From the
Department of Pharmacology, Weill Graduate School of Medical Sciences of Cornell University, New York, New York 10021 and the
Program in Molecular Pharmacology and Chemistry, Memorial Sloan-Kettering Cancer Center, New York, New York 10021
Received for publication, May 15, 2006
 |
ABSTRACT
|
|---|
The cytokine granulocyte-macrophage colony-stimulating factor (GM-CSF) regulates hematopoiesis and the function of mature host defense cells through the GM-CSF receptor (GMR), which is composed of
(
GMR) and
(
GMR) subunits. Stem cell factor is another important hematopoietic cytokine that signals through c-Kit, a receptor tyrosine kinase, and regulates hematopoietic stem cell maintenance and erythroid development. Like other cytokine receptors, GMR and c-Kit are generally deemed as independent adaptor molecules capable of transducing cytokine-specific signals. We found that the
GMR directly interacts with c-Kit and that the interaction is mediated by the cytoplasmic domains. Furthermore,
GMR inhibited c-Kit auto-phosphorylation induced by the ligand stem cell factor. Consistent with the inhibitory effect, the expression of
GMR was suppressed in cells whose viability was dependent on c-Kit signaling. In contrast, the alternatively spliced
2 isoform of the
GMR could not inhibit c-Kit signaling, providing a rationale for the existence of the
2 isoform. Our results suggest that in addition to having the commonly appreciated roles in cytokine signal transduction, the receptors
GMR and c-Kit could interact to coordinate their signal initiation.
 |
INTRODUCTION
|
|---|
Human granulocyte-macrophage colony-stimulating factor (GM-CSF)3 is a key cytokine in host defense regulation, and the GM-CSF receptor (GMR) is expressed on hematopoietic precursors, in mature host defense cells, and in certain non-hematopoietic tissues (1-4). The high affinity receptor for GM-CSF is composed of an
subunit (
GMR) that binds ligand with low affinity and a
subunit (
GMR) that does not bind GM-CSF on its own (5-8). Although the
GMR initiates most GM-CSF-induced signaling pathways, the short intracellular domain (54 amino acids) of
GMR is required for GMR signaling (9-12). We and others have used genetic and biochemical approaches to find proteins interacting with
GMR, and several proteins were identified with different functional implications (13-15). There is a soluble isoform of
GMR as well as an
2 isoform (
2GMR) derived from alternative mRNA splicing (16, 17). The
2GMR has a different cytoplasmic domain but generally exhibits similar properties to
GMR in the cooperation with
GMR (17). Unlike the
GMR, the
2GMR is not up-regulated in granulocyte/macrophage (G/M) lineages, and the
2GMR appears to be more relevant in undifferentiated hematopoietic progenitor cells (18). Signaling of GM-CSF through
2GMR/
GMR leads to more erythroid differentiation than through
GMR/
GMR, suggesting that the receptor isoforms could guide cell differentiation (18).
c-Kit is a transmembrane receptor tyrosine kinase that regulates the proliferation and differentiation of hematopoietic stem cells, erythropoiesis, melanogenesis, and gametogenesis (19-22). Stem cell factor (SCF, also known as kit ligand or Steel factor) is the ligand for c-Kit. The intracellular region of c-Kit has two kinase domains separated by a kinase insert (23, 24). SCF binding to c-Kit induces receptor dimerization and auto-phosphorylation, leading to activation of downstream signaling pathways (25). In mice, c-Kit is encoded at the white spotting (W) locus, its ligand SCF is encoded at the steel (Sl) locus, and mutations at the W or the Sl locus lead to sterility, pigment cell deficiency, and macrocytic anemia (26).
c-Kit and
GMR are well known markers of differentiation, especially in hematopoietic cells. Starting with a high level of c-Kit and negligible amount of
GMR, hematopoietic stem or progenitor cells down-regulate c-Kit and up-regulate
GMR when they enter into the G/M lineage (22, 27). The receptor subunits are generally deemed as passively regulated adaptor molecules, and a direct interaction between
GMR and c-Kit has not been reported. Using our preliminary computational method for predicting protein interactions, we identified c-Kit as a possible interacting protein for
GMR. Here we describe how the
GMR/c-Kit physical interaction regulates signal initiation of the receptors and how
2GMR is different from
GMR on modulating c-Kit signaling.
 |
EXPERIMENTAL PROCEDURES
|
|---|
Vectors for 293T Cell ExpressionCells (293T) were maintained in high glucose Dulbecco's modified Eagle's medium supplemented with 10% bovine calf serum, 1% sodium pyruvate, 1% L-glutamine, and antibiotics. Human
GMR (in pMX) and mouse c-Kit (in pcDM8) were subcloned into HindIII and NotI sites of pcDNA4/His-V5c (Invitrogen). The 5' primer for human
GMR is GCCGCAAGCTTAGCACCATGCTTCTCCTGGTGACA. The 3' primer for full-length
GMR is GATAGTTTAGCGGCCGCGGTAATTTCCTTCACGGT. Mouse c-Kit was subcloned using 3' GATAGTTTAGCGGCCGCGGCATCTTCGTGCACGAG. The 5' primer for full-length c-Kit is GCCGCAAGCTTACCGCGATGAGAGGCGCTCGCGGC, and the 5' primer for 256 amino acids at C terminus of c-Kit (kit256) is GCCGCAAGCTTGCGATGGACATGAAGCCTGGC.
ImmunoprecipitationThe cDNAs encoding
GMR (pcDNA4/His-V5c, 5 µg) and c-Kit (in pcDNA4/His-V5c, 5 µg) were transfected into 293T cells by calcium phosphate precipitation (28). Antibodies M-14 and C-18 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were used for immunoprecipitation of c-Kit and
GMR, respectively, in lysis buffer (modified phosphate-buffered saline with 135 mM K+, 5 mM Na+, and 1.0% Triton X-100, protease, and phosphatase inhibitor cocktails from Sigma). Protein A (Sigma) was used to capture the antibodies.
GMR and c-Kit were detected with anti-V5-HRP (Invitrogen). The
GMR and kit256 (C terminus part of c-Kit) interaction experiments used
GMR in the pMX vector and kit256 in the pcDNA4/His-V5c vector.
GMR was immunoprecipitated and detected with C-18 antibody. The kit256 protein was detected with anti-V5-HRP.
Detection of Phosphorylated c-KitCells (293T) were transfected with mouse c-Kit (0.7 µg in pcDM8 vector) alone or in combination with
GMR (4 µg in pMX vector) for 16 h. Cells were harvested and treated with 100 ng/ml mouse SCF (R&D Systems Inc., Minneapolis, MN) for 10 or 20 min at room temperature. The cells were then lysed in lysis buffer (0.1% Triton X-100), and c-Kit was immunoprecipitated with the M-14 antibody. Protein A was used for capturing the antibody. Phosphorylated c-Kit was detected with anti-phosphotyrosine antibody clone 4G10 (Upstate%20Biotechnology">Upstate Biotechnology, Inc. Lake Placid, NY), and c-Kit was detected with the M-14 antibody.
Retroviral Vector Expression of
GMR Isoforms and MutantsTF-1 and K562 cells were obtained from the American Type Culture Collection (Manassas, VA). TF-1 cells were maintained in RPMI 1640 medium with 2 mM L-glutamine adjusted to contain 1.5 g/liter sodium bicarbonate, 4.5 g/liter glucose, 10 mM HEPES, and 1.0 mM sodium pyruvate, 10% fetal bovine serum, and 10 ng/ml human SCF (29). K562 cells were maintained in RPMI 1640 medium supplemented with 10% fetal calf serum and antibiotics (penicillin and streptomycin). Recombinant human SCF and GM-CSF are from R&D Systems.
GMR,
GMR-375,
GMR-356, and
2GMR were subcloned by PCR into the HindIII site and NotI site of pRETRO-GFP (kindly provided by Dr. Adrian Ting) (30) using the 5' primer GCCGCAAGCTTAGCACCATGCTTCTCCTGGTGACA and 3' primers AGTTTAGCGGCCGCTCAGGTAATTTCCTTCACGGT (
GMR), AGTTTAGCGGCCGCTCACTCGTCTTCCACCTCATG (
GMR-375), AGTTTAGCGGCCGCTCAGAACAGCCGCTGTATCCT (
GMR-356), and AGTTTAGCGGCCGCTCACAGAGATGACTCTGACCC (
2GMR). Plasmids encoding the
GMR isoforms and mutants 5 µg each), the gag-pol vector (3.5 µg), and the vector for vesicular stomatitis virus G protein (VSV-G) (1.5 µg) were transfected into 293T cells in a 10-cm plate using the calcium phosphate precipitation method for 24 h. Transfected 293T cells were switched to cytokine-free TF-1 cell medium for 24 h, and the medium containing retroviruses was stored at -80 °C after 5 min of 1500 rpm centrifugation. The stored retroviruses (1 ml) were mixed with TF-1 cells (1 ml) or K562 cells (1 ml) with 4 µg/ml polybrene (Sigma).

View larger version (35K):
[in this window]
[in a new window]
|
FIGURE 1. GMR interacts with c-Kit. A, the GMR peptide (347-364, KRFLRIQRLFPPVPQIKD) interacts with caprine c-Kit peptide (731-747, YVVPTKAADKRRSARIG) in reverse orientation. The GMR peptide sequence was reversed as denoted by the arrows. N, N terminus. B, the alignment of GMR-interacting sequences of human, mouse, and caprine c-Kit. IP, immunoprecipitation. C, total proteins from 293T cells transfected with human GMR (pcDNA4/His-V5c) or co-transfected with GMR and mouse c-Kit (pcDNA4/His-V5c) are shown in the left two lanes. Extracts immunoprecipitated with c-Kit antibody M-14 from cells transfected with GMR and co-transfected with GMR and c-Kit were shown in the right two lanes. GMR and c-Kit were detected with anti-V5-HRP antibody. D, GMR interacts with an intracellular domain of mouse c-Kit (kit256). Total proteins from 293T cells transfected with kit256 or co-transfected with kit256 and GMR (in pMX vector) are shown in the left two lanes. Extracts immunoprecipitated with GMR antibody C-18 from cells transfected with kit256 and co-transfected with kit256 and GMR are shown in the right two lanes. GMR was detected with C-18 antibody (top panel) and kit256 was detected with anti-V5-HRP antibody (lower panel).
|
|
Flow Cytometry Analysis of
GMR ExpressionTF-1 cells or K562 cells were infected with retroviruses encoding the
GMR isoforms and mutants. For flow cytometry analysis, cells were suspended in pH 7.4 phosphate-buffered saline with 1% heat-inactivated fetal calf serum and 0.1% sodium azide (Sigma) containing FITC-conjugated anti-
GMR antibody S-20 (Santa Cruz Biotechnology, Inc.) for 30 min at 4 °C. Cells were then washed with the staining buffer and analyzed with FACScalibur (BD Biosciences). The results were analyzed with FlowJo software.
 |
RESULTS
|
|---|
aGMR Interacts with c-KitThe short intracellular domain of
GMR is required for GM-CSF signaling, and the membrane-proximal proline-rich region is especially important (9-12). An 18-amino acid peptide of
GMR (KRFLRIQRLFPPVPQIKD) from this region (347-364) was used in the application of our computational protein interaction prediction method.4 A peptide from caprine c-Kit (731-747, YVVPTKAADKRRSARIG, in the kinase insert domain) was found to be a likely interaction partner with the
GMR peptide in reverse orientation (Fig. 1A). Since the sequences of human, mouse, and caprine c-Kit have a very high degree of similarity (Fig. 1B), we tested the interaction between human
GMR and mouse c-Kit in co-immunoprecipitation experiments. When co-expressed in 293T cells, human
GMR was co-immunoprecipitated with mouse c-Kit (Fig. 1C). We also made a construct with 256 amino acids (kit256) from the C terminus of mouse c-Kit that contains the putative
GMR-interacting domain and found that kit256 was co-immunoprecipitated with
GMR when co-expressed in 293T cells (Fig. 1D). Therefore the
GMR and c-Kit appeared to interact through their intracellular domains.
aGMR Inhibits c-Kit Auto-phosphorylation Induced by SCFThe physical interaction between c-Kit and
GMR suggested cooperation or cross-inhibition between SCF/c-Kit and GM-CSF/
GMR signaling. Binding of
GMR to c-Kit, most likely to the kinase insert domain, implied that
GMR could modulate c-Kit kinase activity, and therefore we investigated whether
GMR influenced c-Kit kinase activity in 293T cells expressing mouse c-Kit and human
GMR. Mouse SCF stimulated time- and dose-dependent phosphorylation of c-Kit in 293T cells transfected only with c-Kit as detected by anti-phosphotyrosine antibody (Fig. 2). When cells were co-transfected with
GMR and c-Kit, the phosphorylation of c-Kit induced by SCF was clearly inhibited (Fig. 2). This result suggested an inhibitory function of the
GMR/c-Kit interaction.

View larger version (43K):
[in this window]
[in a new window]
|
FIGURE 3. SCF/c-Kit signaling and GMR do not co-exist. A, construction of retroviral expression vectors including wild type human GMR, intracellular domain deletion mutants GMR-375 and GMR-356, and another isoform, 2GMR. B, flow cytometry analysis of GMR, GMR-375, GMR-356, and 2GMR expression in K562 cells infected by retroviruses for 48 h without cytokine supplements. The four proteins were detected with FITC-conjugated anti- GMR antibody clone S-20, and the percentages of positive cells in the polygonal region are indicated. The x axis is FITC fluorescence intensity, and the y axis is nonspecific fluorescence. Non-infected cells are included for control (first panel). C, TF-1 cells were cultured in 2 ng/ml human SCF and infected with retroviruses for 48 h for protein expression. GMR and its mutants as well as its isoform were recognized by anti- GMR-FITC. Control cells are not infected with retroviruses. The percentages of positive cells in the polygonal region are indicated and also normalized to the percentages in K562 cells (panel B) that received the same amounts of respective retroviruses shown at the bottom.
|
|
SCF/c-Kit-maintained Cells Restrict
GMR ExpressionWe asked whether
GMR could inhibit c-Kit signaling in the human hematopoietic cell line TF-1 that responds to growth factors such as SCF, GM-CSF, interleukin-3, or erythropoietin (29). SCF stimulation through human c-Kit maintains the viability and proliferation of TF-1 cells, providing a good model of human c-Kit signaling for testing the
GMR inhibitory activity. We generated retroviral expression vectors for
GMR,
2GMR (the
GMR isoform with a variant cytoplasmic tail),
GMR-375 (the common portion of
GMR and
2GMR with 25 amino acids deleted from
GMR C terminus), and
GMR-356 (44 amino acids deleted from
GMR C terminus) (Fig. 3A). The four
GMR-related proteins have an identical extracellular domain that can be detected by flow cytometry using the same FITC-conjugated anti-
GMR antibody, conveniently allowing comparison of expression levels. The retroviruses produced in 293T cells were tested in the erythroleukemia cell line K562 that proliferates without requirement for growth factor supplements (31). The four
GMR-related proteins were expressed by retrovirus infection of K562 cells with variations in expression levels and infection percentages, possibly reflecting different amounts of retroviruses delivered (Fig. 3B). When a retroviral vector expresses an inhibitor for SCF/c-Kit signaling in TF-1 cells maintained by SCF, the viability and proliferation of the infected cells should be decreased when compared with cells expressing a non-inhibitory protein. The results showed that in TF-1 cells,
GMR-356 (the intracellular domain deletion mutant) and
2GMR were expressed at high levels, whereas
GMR expression level was low as measured by fluorescence intensity (Fig. 3C).
GMR-375 was expressed at an intermediate level (Fig. 3C), suggesting that the two domains sequentially deleted from the intracellular portion of
GMR are both involved in the interaction with c-Kit. We also normalized the percentages of the TF-1 cells expressing the four
GMR-related proteins to those of K562 cells (Fig. 3B), in which we used the same doses of retroviruses. The normalized percentages also supported that
GMR inhibited c-Kit and
GMR-375 partially inhibited c-Kit (Fig. 3C).
Exogenous
GMR Expression in TF-1 Cells Inhibits Endogenous SCF/c-Kit SignalingWe further attempted to achieve the expression of
GMR and
2GMR in TF-1 cells and test whether exogenously expressed
GMR could inhibit endogenous c-Kit signaling. To allow expression of
GMR in TF-1 cells, another growth factor, GM-CSF, was included in addition to SCF, relieving the viability dependence on SCF/c-Kit signaling. We noticed under a microscope that the addition of GM-CSF to SCF caused a significant TF-1 cell size increase and that the bigger cells could be driven back to smaller size in culture with SCF alone, quantifiable in the flow cytometry forward scatter/side scatter (FSC/SSC) plot (Fig. 4A). If TF-1 cells express a protein inhibitor of SCF/c-Kit signaling, SCF should be unable to drive enlarged cells to smaller cells. Therefore we used the cell population ratio of the lower left quadrant (LL, smaller cells) to the lower right quadrant (LR, bigger cells) from the FSC/SSC plot of TF-1 cells treated first with GM-CSF and SCF and then with SCF alone to measure the SCF response. A bigger LL/LR ratio would indicate a higher response. We identified cells positive with
GMR,
GMR-375,
GMR-356, and
2GMR with an anti-
GMR antibody in flow cytometry (Fig. 4B) and analyzed their FSC/SSC plots (Fig. 4C).
2GMR- and
GMR-356-positive cells had an LL/LR ratio similar to non-infected cells (low fluorescence population) (Fig. 4, C and D), indicating that
2GMR and
GMR-356 did not inhibit SCF/c-Kit signaling.
GMR-375 partially inhibited SCF response, and
GMR had the strongest inhibition (Fig. 4, C and D). The results demonstrated that the expression of human
GMR but not
2GMR inhibited human c-Kit signaling and that the inhibition was dependent on the intracellular domain of
GMR. Our results supported that the membrane-proximal region of the
GMR intracellular domain (used in our protein-interaction prediction) was involved in the interaction with c-Kit. It appeared that the membrane-distal region of
GMR intracellular domain enhanced the interaction with c-Kit and that the membrane-distal cytoplasmic tail of
2GMR prevented the protein-protein interaction with c-Kit.

View larger version (45K):
[in this window]
[in a new window]
|
FIGURE 4. GMR inhibits SCF/c-Kit signaling in TF-1 cells. A, FSC/SSC plot of normal TF-1 cells cultured with 10 ng/ml SCF + 100 pM GM-CSF (left panel). FSC roughly measures cell size, and SSC is a cell morphology indicator. When the culture was switched from SCF + GM-CSF to 10 ng/ml SCF alone for 48 h, cells were mostly shifted to smaller size in the lower left quadrant (right panel). B, in 10 ng/ml SCF + 100 pM GM-CSF culture, TF-1 cells express all four GMR-related proteins. Cells were then cultured in 10 ng/ml SCF for 48 h and analyzed for GMR expression. The polygonal regions for GMR, GMR-375, GMR-356, and 2GMR select positive cells subject to further analysis (panels C and D). For control, we selected a region of non-infected cells from the same data file of GMR. C, FSC/SSC analysis of control and infected cells. SCF induced a cell size change that shifts the cell population to low FSC and low SSC region in control, GMR-356-, and 2GMR-expressing cells. Cells expressing GMR do not have such shift, and GMR-375-expressing cells have a partial shift. D, ratios of LL/LR from panel C are summarized in the column graph. A higher ratio indicates a higher SCF response.
|
|
 |
DISCUSSION
|
|---|
Our present study defines a molecular interaction between the
GMR and c-Kit, which is quite unique in that it involves a receptor tyrosine kinase and a non-kinase receptor subunit. The c-Kit kinase insert domain is known to bind phosphatidyl-inositol 3-kinase (24), suggesting that it is a domain accessible for interaction with other proteins, and therefore it is understandable that the
GMR/c-Kit interaction utilizes their intracellular domains.
Our findings suggest that the inhibition of c-Kit signaling by
GMR is a result of direct receptor-receptor modulation. Not only could we roughly confirm the predicted interaction domains, we also demonstrated that
GMR inhibited c-Kit auto-phosphorylation in 293T cells with protein overexpression. Auto-phosphorylation is an early step in c-Kit signaling pathways, indicating that the inhibition is at the receptor level. If the inhibition occurred indirectly, i.e. through a third party mediator, the would-be mediator also needs to reach overexpression level to overtake c-Kit. It is very unlikely that 293T cells would happen to have such a mediator at that high level induced by
GMR; therefore the
GMR and c-Kit interaction appears to be direct. Our data do not exclude the possibility that
GMR binding to c-Kit affects SCF binding. Direct receptor-receptor trans-modulations are probably not rare as there are other examples including the hepatocyte growth factor receptor Met inhibition of Fas signaling and the 67-kDa laminin receptor inhibition of GM-CSF receptor signaling (15, 32).
As a measurement for SCF-induced cellular responses, we utilized an observation that SCF-supplemented TF-1 cells were smaller than GM-CSF-supplemented cells. The reduction of TF-1 cell size with SCF/c-Kit signaling is consistent with previous reports that c-Kit signaling-deficient mice had severe macrocytic anemia, in which the average size of erythrocytes was larger than normal (21, 26).
The expressions of
GMR and
2GMR at the mRNA level were studied during CD34+ hematopoietic progenitor cell differentiation, and it was found that the ratio of
2GMR to
GMR was about 30-60-fold higher in undifferentiated hematopoietic cells (c-Kit positive) than in cells of G/M lineages (c-Kit negative) (18). This implies that the biological function of the alternatively spliced
2 isoform is to transduce GM-CSF signal in the presence of c-Kit. Both
GMR and
2GMR can cooperate with
GMR to transduce GM-CSF signals, and thus, their differential effects on c-Kit signaling might be an important biological reason for the existence of the receptor isoforms.
As an inhibitor for c-Kit signaling,
GMR would be expected to interfere with biological processes in which c-Kit is known to be important, such as erythropoiesis. It was found that expression of human
GMR, but not
GMR or interleukin-3 receptor
subunit, in avian primary erythroblasts actively inhibited their outgrowth and erythroid differentiation, in which erythropoietin receptor and c-Kit are involved (33).
GMR in those erythroblasts appeared to have induced changes reflective of the anemic phenotype in c-Kit-deficient mice, substantiating that
GMR is a c-Kit inhibitor. Another finding indicated that the signaling of GM-CSF through
2GMR/
GMR leads to more erythroid differentiation and less G/M differentiation than through
GMR/
GMR in FDCP-Mix cells (18). Our theory could potentially account for the observed differences in that
2GMR allows c-Kit signaling and permits both erythroid and G/M differentiations, whereas
GMR inhibits c-Kit signaling and permits predominantly G/M differentiation. Using
GMR in the G/M lineage and c-Kit in the erythroid lineage, hematopoietic cells could ensure lineage divisions because the
GMR and c-Kit signaling pathways are intrinsically non-coexistent. The regulation of hematopoiesis has been extensively studied, and there are other known hematopoietic lineage regulators such as transcription factors PU.1 and CCAAT/enhancer binding protein
(C/EBP
) (34, 35).
GMR and c-Kit are quite special because these receptors were not previously known to coordinate their own signaling patterns.
We attempted to use the retroviral vectors to express
GMR and its variants in purified human bone marrow CD34+ cells and investigate whether
GMR could influence lineage differentiation in colony formation assays. The CD34+ cells supplemented with SCF, GM-CSF, interleukin-3, and erythropoietin could express
2GMR,
GMR-375, and
GMR-356 but not
GMR in 24 h, similar to SCF-supplemented TF-1 cells (data not shown). The incompatibility of
GMR expression in CD34+ cells probably reflects the importance of c-Kit signaling for the maintenance of CD34+ cells (22). The suppression of
GMR expression in c-Kit signaling-dependent cells suggested that some differentiation markers can be naturally incompatible in hematopoietic stem cells, providing the stem cells a possible maintenance mechanism.
Although the
GMR-expressing G/M lineage cells come from the c-Kit-expressing hematopoietic stem or progenitor cells, intermediate cells with both c-Kit and
GMR are rare (27), suggesting that the intermediate cells only exist for a short duration during differentiation. Therefore a natural cell system with both
GMR and c-Kit was mechanistically not readily available for us to demonstrate the endogenous
GMR/c-Kit association. Nevertheless, it can be inferred from our results that overexpression of
GMR is not required for inhibiting endogenous c-Kit signaling since SCF-supplemented TF-1 cells could only allow very little
GMR expression, suggesting that the amount of
GMR needed for inhibiting TF-1 endogenous c-Kit signaling is very low.
In summary, our studies showed that the
GMR could interact with c-Kit and inhibit c-Kit signaling, but
2GMR could not inhibit c-Kit signaling. The receptors
GMR and c-Kit are more than regulated adaptor molecules for transducing cytokine signals; rather, they are signal regulators in their own right.
 |
FOOTNOTES
|
|---|
* This work was supported by grants from the National Institutes of Health (CA30388), the New York State Department of Health, and the Lebensfeld and Schultz Foundations. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
Deceased August 9, 2004. 
1 To whom correspondence may be addressed. E-mail: jchen10021{at}yahoo.com.
2 To whom correspondence may be addressed. Tel.: 917-575-8593; Fax: 212-849-2525; E-mail: jcarcamo{at}enzobio.com.
3 The abbreviations used are: GM-CSF, granulocyte-macrophage colony-stimulating factor; GMR, GM-CSF receptor;
GMR,
subunit of GMR;
GMR,
subunit of GMR;
2GMR,
2 isoform of
GMR; SCF, stem cell factor; HRP, horse-radish peroxidase; FSC/SSC, flow cytometry forward scatter/side scatter; FITC, fluorescein isothiocyanate; LL, lower left quadrant; LR, lower right quadrant. 
4 J. Chen and J. M. Cárcamo, manuscript in preparation. 
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Peter Besmer for providing mouse c-Kit cDNA, Dr. Colin A. Sieff for
2GMR cDNA, and Dr. Adrian Ting for the retrovirus expression system.
 |
REFERENCES
|
|---|
- Hirsch, T., Eggstein, S., Frank, S., Farthmann, E. H., and von Specht, B. U. (1995) Biochem. Biophys. Res. Commun. 217, 138-143[CrossRef][Medline]
[Order article via Infotrieve]
- Rivas, C. I., Vera, J. C., Delgado-Lopez, F., Heaney, M. L., Guaiquil, V. H., Zhang, R. H., Scher, H. I., Concha, I. I., Nualart, F., Cordon-Cardo, C., and Golde, D. W. (1998) Blood 91, 1037-1043[Abstract/Free Full Text]
- McKinstry, W. J., Li, C. L., Rasko, J. E., Nicola, N. A., Johnson, G. R., and Metcalf, D. (1997) Blood 89, 65-71[Abstract/Free Full Text]
- Gasson, J. C. (1991) Blood 77, 1131-1145[Free Full Text]
- Metcalf, D., Nicola, N. A., Gearing, D. P., and Gough, N. M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 4670-4674[Abstract/Free Full Text]
- Park, L. S., Martin, U., Sorensen, R., Luhr, S., Morrissey, P. J., Cosman, D., and Larsen, A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 4295-4299[Abstract/Free Full Text]
- Gearing, D. P., King, J. A., Gough, N. M., and Nicola, N. A. (1989) EMBO J. 8, 3667-3676[Medline]
[Order article via Infotrieve]
- Hayashida, K., Kitamura, T., Gorman, D. M., Arai, K., Yokota, T., and Miyajima, A. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9655-9659[Abstract/Free Full Text]
- Polotskaya, A., Zhao, Y., Lilly, M. B., and Kraft, A. S. (1994) J. Biol. Chem. 269, 14607-14613[Abstract/Free Full Text]
- Matsuguchi, T., Zhao, Y., Lilly, M. B., and Kraft, A. S. (1997) J. Biol. Chem. 272, 17450-17459[Abstract/Free Full Text]
- Doyle, S. E., and Gasson, J. C. (1998) Blood 92, 867-876[Abstract/Free Full Text]
- Lilly, M. B., Zemskova, M., Frankel, A. E., Salo, J., and Kraft, A. S. (2001) Blood 97, 1662-1670[Abstract/Free Full Text]
- Ebner, K., Bandion, A., Binder, B. R., de Martin, R., and Schmid, J. A. (2003) Blood 102, 192-199[Abstract/Free Full Text]
- Tu, J., Karasavvas, N., Heaney, M. L., Vera, J. C., and Golde, D. W. (2000) Blood 96, 794-799[Abstract/Free Full Text]
- Chen, J., Carcamo, J. M., Borquez-Ojeda, O., Erdjument-Bromage, H., Tempst, P., and Golde, D. W. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 14000-14005[Abstract/Free Full Text]
- Raines, M. A., Liu, L., Quan, S. G., Joe, V., DiPersio, J. F., and Golde, D. W. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 8203-8207[Abstract/Free Full Text]
- Crosier, K. E., Wong, G. G., Mathey-Prevot, B., Nathan, D. G., and Sieff, C. A. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7744-7748[Abstract/Free Full Text]
- Slater, N. J., Yamaguchi, M., Rothwell, D. G., Baker, P., Heyworth, C. M., and Chopra, R. (2003) Br. J. Haematol. 122, 150-158[CrossRef][Medline]
[Order article via Infotrieve]
- Kissel, H., Timokhina, I., Hardy, M. P., Rothschild, G., Tajima, Y., Soares, V., Angeles, M., Whitlow, S. R., Manova, K., and Besmer, P. (2000) EMBO J. 19, 1312-1326[CrossRef][Medline]
[Order article via Infotrieve]
- Yarden, Y., Kuang, W. J., Yang-Feng, T., Coussens, L., Munemitsu, S., Dull, T. J., Chen, E., Schlessinger, J., Francke, U., and Ullrich, A. (1987) EMBO J. 6, 3341-3351[Medline]
[Order article via Infotrieve]
- Chabot, B., Stephenson, D. A., Chapman, V. M., Besmer, P., and Bernstein, A. (1988) Nature 335, 88-89[CrossRef][Medline]
[Order article via Infotrieve]
- Domen, J., and Weissman, I. L. (2000) J. Exp. Med. 192, 1707-1718[Abstract/Free Full Text]
- Tanaka, S., Yanagisawa, N., Tojo, H., Kim, Y. J., Tsujimura, T., Kitamura, Y., Sawasaki, T., and Tachi, C. (1997) Biochim. Biophys. Acta 1352, 151-155[Medline]
[Order article via Infotrieve]
- Lev, S., Givol, D., and Yarden, Y. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 678-682[Abstract/Free Full Text]
- Linnekin, D. (1999) Int. J. Biochem. Cell Biol. 31, 1053-1074[CrossRef][Medline]
[Order article via Infotrieve]
- Besmer, P., Manova, K., Duttlinger, R., Huang, E. J., Packer, A., Gyssler, C., and Bachvarova, R. F. (1993) Dev. Suppl. 125-137
- de Jong, M. O., Westerman, Y., Wagemaker, G., and Wognum, A. W. (1997) Stem Cells (Durham) 15, 275-285
- Pear, W. S., Nolan, G. P., Scott, M. L., and Baltimore, D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8392-8396[Abstract/Free Full Text]
- Kitamura, T., Tange, T., Terasawa, T., Chiba, S., Kuwaki, T., Miyagawa, K., Piao, Y. F., Miyazono, K., Urabe, A., and Takaku, F. (1989) J. Cell. Physiol. 140, 323-334[CrossRef][Medline]
[Order article via Infotrieve]
- He, K. L., and Ting, A. T. (2002) Mol. Cell. Biol. 22, 6034-6045[Abstract/Free Full Text]
- Marks, D. C., Davey, M. W., Davey, R. A., and Kidman, A. D. (1995) Biochem. Pharmacol. 50, 475-480[CrossRef][Medline]
[Order article via Infotrieve]
- Wang, X., DeFrances, M. C., Dai, Y., Pediaditakis, P., Johnson, C., Bell, A., Michalopoulos, G. K., and Zarnegar, R. (2002) Mol. Cell 9, 411-421[CrossRef][Medline]
[Order article via Infotrieve]
- Wessely, O., Bauer, A., Quang, C. T., Deiner, E. M., von Lindern, M., Mellitzer, G., Steinlein, P., Ghysdael, J., and Beug, H. (1999) Biol. Chem. 380, 187-202[CrossRef][Medline]
[Order article via Infotrieve]
- Scott, E. W., Simon, M. C., Anastasi, J., and Singh, H. (1994) Science 265, 1573-1577[Abstract/Free Full Text]
- Zhang, D. E., Zhang, P., Wang, N. D., Hetherington, C. J., Darlington, G. J., and Tenen, D. G. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 569-574[Abstract/Free Full Text]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.