![]()
|
|
||||||||
J. Biol. Chem., Vol. 281, Issue 32, 22674-22683, August 11, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1
2
From the
Howard Hughes Medical Institute and Departments of
Biochemistry and
Medicine, Duke University Medical Center, Durham, North Carolina 27710
Received for publication, April 17, 2006
| ABSTRACT |
|---|
|
|
|---|
and MutL
. Cells deficient in either of these activities are resistant to the cytotoxic effects of this class of chemotherapeutic drug. Because killing by Sn1 methylators has been attributed to O6-methylguanine (MeG), we have constructed nicked circular heteroduplexes that contain a single MeG-T mispair, and we have examined processing of these molecules by mismatch repair in nuclear extracts of human cells. Excision provoked by MeG-T is restricted to the incised heteroduplex strand, leading to removal of the MeG when it resides on this strand. However, when the MeG is located on the continuous strand, the heteroduplex is irreparable. MeG-T-dependent repair DNA synthesis is observed on both reparable and irreparable 3' and 5' heteroduplexes as judged by [32P]dAMP incorporation. Labeling with [
-32P]dATP followed by a cold dATP chase has demonstrated that newly synthesized DNA on irreparable molecules is subject to re-excision in a reaction that is MutL
-dependent, an effect attributable to the presence of MeG on the template strand. Processing of the irreparable 3' heteroduplex is also associated with incision of the discontinuous strand of a few percent of molecules near the thymidylate of the MeG-T base pair. These results provide the first direct evidence for mismatch repair-mediated iterative processing of DNA methylator damage, an effect that may be relevant to damage signaling events triggered by this class of chemotherapeutic agent. | INTRODUCTION |
|---|
|
|
|---|
The mismatch repair-dependent damage response has been most thoroughly studied for lesions produced by Sn1 DNA methylators. The cytotoxicity of this class of compounds, which includes N-methyl N-nitrosourea, N-methyl N'-nitro-N-nitrosoguanidine, temozolomide (8-carbamoyl-3-methylimidazo[5,1-d]-1,2,3,5-tetrazin-4(3H)-one), procarbazine (N-isopropyl-
-(2-methylhydrazino)-p-toluamide), and dacarbazine (5-(3,3-dimethyl-1-triazenyl)-1H-imidazole-4-carboxamide), is largely because of production of O6-methylguanine (MeG)3 (10, 11), which can pair with either thymine or cytosine (12, 13). MutS
(MSH2·MSH6 heterodimer) and MutL
(MLH1·PMS2 heterodimer) have been implicated in the earliest steps of the cellular response to Sn1 methylators. Perhaps the most compelling evidence for this view has been provided by the finding that MutS
and MutL
act upstream of damage signaling kinases in response to methylator damage (14, 15). Ataxia-telangiectasia-mutated and Rad3-related (ATR) and Ataxia-telangiectasia-mutated (ATM) kinases have been implicated in these events (1520). Although both MeG-T and MeG-C lesions are recognized by MutS
and both are subject to MutS
-dependent processing in nuclear extracts, MeG-T is a considerably better substrate (14, 21).
Two models, which are not mutually exclusive, have been proposed to explain the MutS
- and MutL
-dependent damage response to DNA methylators. The futile cycling model posits that replication bypass of a template strand MeG produces a base pair anomaly that activates the mismatch repair system. Because excision-repair by this system is restricted to the new strand, the MeG cannot be removed. This would lead to iterative and futile turnover of the daughter strand, which is postulated to activate damage signaling (10, 11). In the alternate model, recruitment of a damage recognition complex consisting of MutS
, MutL
, and perhaps other activities to a MeG lesion in the absence of an excision-repair response is sufficient to trigger kinase activation (22). Although no direct evidence for either of these models currently exists, the finding that Sn1 DNA methylators result in G2 arrest in the second cell cycle following exposure suggests that replication may be required to elicit the effect (10, 23). Although consistent with the futile turnover model, replication would also be required for production of an MeG-T base pair, which, as noted above, is better recognized by MutS
than is MeG-C. In fact, several DNA polymerases have been shown to display a significant preference for incorporation of thymidylate opposite a template MeG (2426).
To further clarify the nature of mismatch repair-dependent processing of Sn1 methylator damage, we have constructed both reparable and irreparable nicked heteroduplex DNAs containing a single MeG-T base pair. Analysis of the fate of these DNAs in nuclear extracts has demonstrated that an irreparable heteroduplex molecule, containing MeG on the template strand, is subject to multiple rounds of excision. We have also observed that a small fraction of irreparable molecules is subject to cleavage on the incised strand near the mismatch in a manner that depends on functional MutL
.
| MATERIALS AND METHODS |
|---|
|
|
|---|
and MutL
(29, 30) were prepared as described previously. Recombinant human alkylguanine alkyltransferase (AGT) and O6-benzylguanine (O6BG) were generously provided by Henry Friedman (Duke Medical Center). Restriction enzymes were obtained from New England Biolabs, and T4 DNA ligase and RNase A were from Roche Applied Science.
Substrate Synthesis and PurificationPlasmid pUC19Y (31), a gift from J. Hays (Oregon State University), was digested with SapI and AatII; the 1927-bp fragment was gel-purified and ligated to one of two oligonucleotide cassettes containing HindIII and SalI sites. Plasmid pSYAH was constructed by ligation to the oligonucleotide duplex d(AGCCGTCGACTCCGATGCGGAAGCTTCGAGGACGGTAGCGAGAGACTCGACGT) annealed to d(CGAGTCTCTC
GCTACCGTCCTCGAAGCTTCCGCATCGGAGTCGACG
), which contains two N.BstNBI sites (underlined; location of nicking sites marked by
) on the antisense strand (defined as the transcribed strand of the
-lactamase gene and indicated as the outer or top strand in all figures). For plasmid pSYSH, the two N.BstNBI incision sites were placed on the sense strand (depicted as the inner or bottom strand in figures) by ligation of the 1927-bp pUC19Y fragment to the oligonucleotide cassette d(AGCGGAAGAGTCTCTC
GCTACCGTCCTCGAAGCTTCCGCATCGGAGTCGACG
T) hybridized to d(CGACTCCGATGCGGAAGCTTCGAGGACGGTAGCGAGAGACTCTTCC). pSYAH and pSYSH plasmids were digested with SspI, which cleaves
150 bp from the HindIII site. The linearized plasmid was blunt end-ligated to an oligonucleotide cassette containing a BbvCI site, d(TGGGATCCTCAGCATTATCG), and its complement. Resulting plasmids, pSYAH1A and pSYSH1B, contain a site for N.BbvCIB incision on the antisense strand 5' to the HindIII sequence and an N.BbvCIA incision site on the sense strand 3' to the HindIII site. All constructs were verified by DNA sequencing.
pSYAH1A and pSYSH1B plasmids were used for preparation of G-T and MeG-T heteroduplexes, as well as control A·T homoduplex DNAs, by a strategy similar to that described by Wang and Hays (32). In a typical preparation, 400 µg (300 pmol) of plasmid were incubated with 1000 units of N.BstNBI for 2 h at 55°C in 10 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 150 mM KCl, 1 mM dithiothreitol. After supplementation with an additional 400 units of enzyme and incubation for an additional hour, the reaction was terminated by the addition of 30 nmol of d(CGTCGACTCCGATGCGGAAGCTTCGAGGACGGTAGC) and heating at 82 °C for 20 min. This inactivated the enzyme and melted out the 36-mer between N.BstNBI nicking sites, which was prevented from rehybridizing to the gapped circle by the excess exogenous oligonucleotide. The gapped plasmid was separated from oligonucleotides using either Hipure columns (Roche Applied Science, per manufacturer instructions) or by precipitation with 10% PEG8000. A 10-fold excess of synthetic 36-mer 5'd(pGCTACCGTCCTCGAXGCTTCCGCATCGGAGTCGACG) (X represents either G or MeG) was annealed to the gapped plasmid in T4 DNA ligase buffer (Roche Applied Science) by heating to 80 °C for 10 min and slow cooling to room temperature over an hour in a heating block. The reaction was supplemented with fresh 1 mM ATP and T4 DNA ligase (0.5 units/µg plasmid) and incubated at room temperature for 2 h to overnight. Approximately 50% of the molecules was converted to a closed circular form, which was isolated by CsCl ethidium bromide equilibrium centrifugation.
Nicked circular heteroduplexes were prepared by digestion with 5 units of either N.BbvCIA or N.BbvCIB per µg of plasmid for 1 h at 37°C to generate a strand break 3' or 5' to the mismatch. Nicking was stopped by phenol extraction and substrate recovered by ethanol precipitation. For pSYAH1A derivatives, 3' and 5' nicks were located 152 or 155 bp from the mispair, respectively; corresponding values for pSYSH1B derivatives were 146 and 149 bp. Overall yield of nicked substrate was typically 1520% relative to starting material. As shown in Fig. 1, G-T or MeG-T mismatches resided within overlapping restriction sites for XhoI and HindIII. As judged by XhoI and HindIII sensitivity, heteroduplex preparations contained <10% homoduplex contamination. Nicked circular homoduplex DNAs were prepared either by the procedures outlined above or by direct incision of pSYAH1A and pSYSH1B plasmid DNAs with N.BbvCIA or N.BbvCIB. No significant differences were observed between preparations obtained by the two methods.
In Vitro Mismatch Excision and RepairHeLa extract containing endogenous AGT was diluted with 1 volume of 10 mM HEPES-KOH (pH 7.4), 110 mM KCl (to 1218 mg/ml) and incubated with 25 µM O6BG for 30 min on ice prior to use in repair or excision reactions. When indicated, MeG-T heteroduplex DNA (100 ng) was pretreated with AGT. Reactions (4 µl) contained 10 mM HEPES-KOH (pH 7.4), 150 mM KCl, 400 fmol of AGT, and 100 ng (77 fmol) of heteroduplex. After incubation at 37 °C for 30 min, samples were chilled on ice prior to use. AGT treatment in this manner converted 80% of XhoI-resistant MeG-C heteroduplex to an endonuclease-sensitive form (not shown). We attribute the residual 20% resistant form to the presence of a contaminant in commercial MeG-containing oligonucleotide preparations. Similar contamination has been observed by others and has been attributed to incomplete deprotection of the modified guanine (33).
|
Mismatch repair reactions were performed in a similar manner except that 100 µM dNTPs were included; reactions were stopped after 15 min, and recovered DNA was digested with BanI and XhoI (to score repair to G·C) or BanI and HindIII (to score repair to A·T). Use of the recommended buffer for HindIII (New England Biolabs buffer 2) resulted in cleavage of about 50% of MeG-T heteroduplex. Because this sensitivity was reduced to <10% by treatment with AGT, HindIII is apparently capable of cleaving a recognition site that contains MeG-T in place of the canonical A·T base pair. This problem was obviated (9095% resistance) by performing HindIII digests (2 units of enzyme/100 ng of DNA, 37 °C for 1 h) in 50 mM Tris-HCl (pH 7.9), 150 mM NaCl, 10 mM MgCl2, 1 mM dithiothreitol, which was used for the experiments described here.
Label-Chase AnalysisLabel-chase reactions (20 µl) with 5' substrates were performed as described above, except that dNTP composition was 50 µM dCTP, dTTP, and dGTP, 1 µM dATP, and 10 µCi of [
-32P]dATP (3000 Ci/mmol; PerkinElmer Life Sciences). After 5 min at 37 °C, a 6-µl sample was removed and quenched by addition to 10 µl of stop solution as above. The remainder of the reaction was immediately supplemented with 1.5 µl of 10 mM Tris-HCl, 1 mM EDTA (control), or 10 mM unlabeled dATP (chase). Additional samples were removed at 15 and 30 min, and reactions were terminated as above. Quenched samples were incubated for 3060 min at 37 °C, and DNA was recovered as described above. DNA products were digested with N.BbvCIB and AflII and subjected to electrophoresis through 1% alkaline agarose 360 V-h. Gels were dried onto DEAE paper (Whatman), and radioactivity was quantified by PhosphorImager analysis using IQMac software (GE Healthcare). For presentation here, line graphs are offset slightly along the x axis to facilitate visual comparison.
Label-chase analysis using 3' substrates was performed in a similar manner except that cold dATP chase was initiated after 15 min of incubation at 37 °C, and reactions done using HCT116BBR extracts were supplemented with 250 fmol of MutL
as indicated. After digestion with N.BbvCIA, AflIII, AflII, and BanI, DNA products were analyzed by electrophoresis through 8% polyacrylamide in 89 mM Tris, 89 mM boric acid, 2 mM EDTA, 7 M urea (pH 8.0). Gels were dried and analyzed by PhosphorImager as above.
Indirect End Labeling of 3' Repair ProductsMismatch repair reactions were performed in the presence of unlabeled 100 µM dNTPs, and DNA products were recovered as described above. Samples were digested with NlaIII before separating on an 8% polyacrylamide urea gel as above. DNA was transferred to Hybond N+ using a semidry electrotransfer apparatus (Owl Scientific) at 200 mA for 1530 min per manufacturer's instructions. The membrane was incubated in blocking buffer (6x SSC, 5x Denhardt's, 0.5% SDS) for 1 h at 45°C before addition of oligonucleotide a136 d(CCGCGCACATTTCCCCGAAAAGTG), which had been end-labeled with 32P using T4 polynucleotide kinase. Following PhosphorImager analysis, the blot was stripped by three 20-min washes with 0.1% SDS, 0.2 M NaOH at 68 °C. The membrane was then blocked again and reprobed with end-labeled oligonucleotide s149 d(CACTTTTCGGGGAAATGTGCGCGG).
| RESULTS |
|---|
|
|
|---|
150 bp either 3' or 5' to the mismatch, as viewed along the shorter path in the circular DNAs. Mismatches containing MeG activate the mismatch repair system in nuclear extracts (14). However, when MeG resides on the continuous strand of a nicked heteroduplex, the lesion is not expected to be removed because mismatch-provoked excision is restricted to the incised heteroduplex strand (34). This issue is addressed in Fig. 2 using HeLa nuclear extract, which was pretreated with O6BG to inactivate endogenous AGT. As shown in Fig. 2A, G-T and MeG-T heteroduplexes were subject to mismatch-provoked excision in nuclear extract, as was the MeG-T heteroduplex from which the O6-methyl group was removed by pretreatment with AGT. G-T and T-MeG mismatches were also efficiently repaired to G·C or T·A base pairs, respectively, as judged by conversion to XhoI or HindIII sensitivity, and production of these products was unaffected by AGT pretreatment (Fig. 2B). However, the MeG-T heteroduplex was not subject to detectable repair under these conditions but was corrected to G·C provided that the heteroduplex was pretreated with AGT (Fig. 2B).
|
-32P nucleotides was used to visualize DNA synthesis associated with mismatch repair. In agreement with previous studies (28, 35, 36), repair synthesis occurring on a nicked circular DNA in nuclear extract was dependent on the presence of a mismatch within the molecule (Fig. 3A, compare lanes 3, 9, and 15 with lane 19). Analysis of this effect with a G-T heteroduplex showed synthesis to be MutS
-dependent and demonstrated that a 660-nucleotide segment of the incised strand that spans the mispair (fragment A) was labeled to a specific activity three times that of the 1337-nucleotide remainder of the strand (fragment B; supplemental Fig. 1), and synthesis was strongly biased to the incised strand. For G-T and MeG-T heteroduplexes, isotopic labeling of the nicked strand exceeded that of fragment C, which corresponds to the full-length continuous strand, by a factor of 10 or more (Fig. 3 and supplemental Fig. 1).
|
The irreparable 5' MeG-T heteroduplex was also distinguished from the G-T and AGT-treated MeG-T DNAs in terms of the stability of repair DNA synthetic tracts, which was evaluated by labeling with [
-32P]dATP for 5 min and then chasing for 10 or 25 min with a 1000-fold excess of cold dATP (Fig. 3A). For the 5' G-T heteroduplex, isotopic incorporation into fragments A, B, and C was stable to a 10-min chase (Fig. 3B, top). However, label in DNA smaller than fragment A was reduced substantially during the chase, suggesting that this material represents intermediates produced during the course of repair synthesis. The irreparable 5' MeG-T heteroduplex behaved differently (Fig. 3B, center). Although the label in fragments B and C was largely resistant to chase, the label in fragment A, which spans the mispair, was not, with a substantial fraction turning over during a 10-min chase. Because the MeG-T lesion in the irreparable heteroduplex activates excision (Fig. 2), production of full-length fragment A during the 5-min labeling period indicates bypass of the template MeG by repair DNA synthesis. Subsequent turnover of this labeled material therefore implies occurrence of an iterative repair/excision process, a presumed consequence of persistence of MeG on the template strand in the 5' MeG-T heteroduplex. Importantly, pretreatment of the MeG-T heteroduplex with AGT completely eliminated this chase effect (Fig. 3B, bottom), proving that it is a consequence of the MeG lesion.
Although fragment A label was stable to chase for the G-T, AGT-pretreated MeG-T, and T-MeG heteroduplexes, about 35% of that associated with the MeG-T heteroduplex was consistently turned over (Fig. 3C). The extent of fragment A turnover observed with the 5' MeG-T heteroduplex was essentially independent of the whether the cold dATP chase was begun at 5, 10, or 15 min after initiation of the repair reaction (data not shown). Furthermore, DNA synthesis occurring on the MeG-T heteroduplex was greatly reduced, especially during the early stage of the reaction, if both strands of the circular substrate were covalently continuous (supplemental Fig. 3). We therefore attributed the interative excision observed to events occurring on a subset of molecules that retained a strand discontinuity during incubation in nuclear extract. Indeed, an iterative excision mechanism would be expected to inhibit ligation, and this was confirmed to be the case. As shown in supplemental Fig. 4A, ligation of the 5' MeG-T heteroduplex was retarded as compared with 5' G-T, AGT-pretreated MeG-T, or T-MeG heteroduplexes. Although only 40% of 5' G-T, AGT-pretreated MeG-T, or T-MeG heteroduplexes remained unligated after a 5 min incubation in nuclear extract, about 70% of MeG-T heteroduplexes retained a strand discontinuity during this period, and this differential persisted upon further incubation. Thus, the finding that about 35% of the MeG-T fragment A label was turned over during chase implies that at least half of those molecules capable of being processed by the mismatch repair system were subject to interative excision.
Processing of a 3' MeG-T HeteroduplexMismatch repair in nuclear extracts of human cells can be directed by a strand break located either 3' or 5' to the mispair (34). The polarity of DNA synthesis dictates that excision and repair synthesis occurring on an irreparable 3' MeG-T heteroduplex will regenerate a 3' substrate. Because one round of excision and repair synthesis on an irreparable 5' heteroduplex is expected to yield a strand discontinuity 3' to the mispair, 3'-directed processing of a MeG-T heteroduplex is of particular interest. In MutL
-deficient HCT116BBR nuclear extract, DNA synthesis was limited on both homoduplex and heteroduplex DNAs. Synthesis that did occur in the absence of MutL
was biased to the nicked strand but displayed no preference for the region of the heteroduplex that contained the mispair (Fig. 4A, lanes 1, 2, 7, 8, 13, and 14; see supplemental Fig. 5). Although MutL
supplementation had no significant effect on background DNA synthesis occurring on the 3' A·T control homoduplex (Fig. 4A, lanes 1318), synthesis on 3' G-T and MeG-T heteroduplexes was enhanced substantially (compare lanes 36 with lanes 1 and 2; and lanes 912 with lanes 7 and 8). Enhanced synthesis was strongly biased to the incised heteroduplex strand (compare the sum of label in fragments A and D with that present in fragment E), and fragment A, which spans the mispair, was labeled to the highest specific activity, although labeling of fragments B and D was also elevated (supplemental Fig. 5). Similar mismatch-dependent labeling of these fragments was observed in HeLa nuclear extract (Fig. 4A, lanes 1924).
|
-32P]dATP followed by a 15-min chase with excess cold dATP was employed to assess stability of repair DNA synthesis tracts on 3' heteroduplexes. Repair synthesis tracts on the 3' G-T heteroduplex were stable to chase in both MutL
-supplemented HCT116BBR and HeLa extracts (Fig. 4, B and C). By contrast, re-excision was readily apparent with the MeG-T heteroduplex, occurring primarily in fragment A but also in adjacent fragments B and D (Fig. 4, B, bottom panel, and C). This effect was abolished by prior treatment of the MeG-T substrate with AGT. As observed with the 5' MeG-T heteroduplex described above, about 3040% of label incorporated into the 3' MeG-T substrate was subject to re-excision (Fig. 4C), and ligation was retarded in a manner that depended on MutL
and the presence of MeG in the template DNA strand (supplemental Fig. 4, B and C).
|
-supplemented HCT116BBR nuclear extracts (Fig. 4A, arrowheads). Restriction digestion (not shown) indicated these two species were derived from fragment A and included about 4% of total label incorporated into fragment A. Labeling of both fragments implies that they can be generated after excision and resynthesis, suggesting two potential modes of origin as follows: stalling of a subset of repair synthesis events at that template MeG accompanied by re-initiation of DNA synthesis on the distal side of the lesion, or occurrence of a single or double strand endonucleolytic event near the MeG-T mismatch.
To eliminate the detection bias introduced by the labeling protocol, DNA products were analyzed by a blotting procedure using hybridization probes specific for each heteroduplex strand near the MeG-T lesion. As shown in Fig. 5A, this approach demonstrated the presence of a discontinuity at or near the thymidylate of MeG-T mismatch, without a corresponding break in the other strand of the helix. Production of this discontinuity occurred on 12% of the molecules, was MutL
-dependent, and was abolished by pretreatment of the heteroduplex with AGT. NaOH or RNase A treatment of DNA products prior to electrophoretic analysis did not alter the size nor the yield of the radiolabeled fragments (not shown). Taken together, these findings are most consistent with an endonucleolytic event occurring near the thymidylate of the MeG-T mispair, but the molecular events leading to putative incision in this manner are uncertain. The role of the mismatch repair system in this effect is not clear, but it is noteworthy that use of a covalently closed circular MeG-T heteroduplex reduced the efficiency of incision in this manner (Fig. 5B). Furthermore, the apparent yield of the incised species was reduced substantially with a 5' MeG-T heteroduplex as compared with that observed with the 3' MeG-T substrate (not shown). The latter reduction may be indicative of fundamentally different modes of repair complex assembly on 5' and 3' heteroduplexes. In fact, evidence for differential involvement of MutL
and proliferating cell nuclear antigen in 3'- as opposed to 5'-directed mismatch repair is available, both in nuclear extract and purified systems (30, 3739).
| DISCUSSION |
|---|
|
|
|---|
or MutL
are resistant to the cytotoxic effects of such agents, including the clinically useful compounds temozolomide and procarbazine. Alkylation tolerance attributable to mismatch repair deficiency has been widely documented in cultured cell systems (2, 46), but it is important to note that development of procarbazine resistance associated with MSH2 deficiency has also been demonstrated for a malignant glioma propagated as a xenograft in athymic mice (40). Attempts to account for the function of mismatch repair in the cytotoxic response to Sn1 alkylating agents have invoked lesion recognition and perhaps processing by the system as key elements in the activation of the damage signaling kinases ATR (ataxia-telangiectasia-mutated and Rad3-related) and perhaps ATM (ataxia-telangiectasia-mutated) (10, 1422, 41). To address involvement of the mismatch repair system in the processing of Sn1 methylator lesions, we have examined the fate of heteroduplexes containing a single MeG-T mispair in nuclear extracts. Our findings demonstrate that this lesion activates the repair system irrespective of location of the MeG on the template strand or that subject to excision. When located on the template strand, MeG leads to abortive turnover of the other strand via mismatch-provoked excision and lesion bypass repair DNA synthesis, followed by a subsequent repair attempt, a process observed with both 5' and 3' MeG-T heteroduplexes. These results are consistent with the futile cycling model of Thilly and co-workers (10), which invokes turnover of newly synthesized DNA at the replication fork upon bypass of a template MeG and ultimate activation of damage signaling systems. Although the work described here does not establish a link between iterative repair attempts and the activation of the damage signaling kinases, it seems unlikely that abortive turnover of newly synthesized DNA at the replication fork would go unnoticed by cellular damage-sensing systems. On the other hand, only a small fraction of the MeG lesions resulting from Sn1 methylator exposure are expected to be involved in a replication fork encounter at any given instant, and it has been suggested that MeG lesions residing in resting DNA may also trigger a damage response (22). However, these two mechanisms need not be mutually exclusive.
Model studies with bacteriophage T4 DNA polymerase have implicated its 3' to 5' editing exonuclease in idling of the enzyme at template MeG lesions (42). Although our results do not rule out a similar phenomenon involving a mammalian DNA polymerase, it is important to note that bypass of MeG lesions is an efficient process in nuclear extracts as judged by production of newly synthesized DNA segments that extend a hundred nucleotides or more beyond the location of a template MeG (Figs. 3A and 4A). Such segments are, however, subject to re-excision in a manner that depends on the integrity of the mismatch repair system.
We have also found that a very small but significant fraction of the irreparable 3' MeG-T heteroduplex is subject to apparent incision on the nicked DNA strand at or near the thymidylate of the mispair, but the molecular events responsible for this MeG-dependent effect are not clear. Incision in this manner is reduced substantially with closed circular and irreparable 5' MeG-T heteroduplexes, suggesting that such events may depend on heteroduplex orientation. Although the initial round of abortive repair on a 5' heteroduplex is expected to convert the molecule into a 3' substrate, we have been unable to convincingly detect similar incision events with the 5' MeG-T heteroduplex (not shown). Inasmuch as incision of the 3' MeG-T heteroduplex is limited to 12% of the substrate (Fig. 5) and because re-excision is restricted to about 35% of the 5' MeG-T molecules (Fig. 3), this detection problem could be due to a sensitivity issue. However, it could also reflect potential differences in the nature of repair complexes initially assembled onto 5' and 3' heteroduplexes. Furthermore, although the low level incision observed with the 3' MeG-T heteroduplex is MutL
-dependent, it is unclear whether this dependence on the mismatch repair system is direct or indirect. However, it is interesting to note in this regard that previous studies have indicated physical and biological interactions between the mismatch repair system and other excision repair pathways (43, 44), and that the human G-T mismatch thymine glycosylase is functional on MeG-T mispairs (45). Additional analysis of the nature of this phenomenon is underway.
| FOOTNOTES |
|---|
The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. 15. ![]()
1 Supported in part by a Physician Postdoctoral Fellowship from the Howard Hughes Medical Institute. ![]()
2 An Investigator of the Howard Hughes Medical Institute. To whom correspondence should be addressed: Howard Hughes Medical Institute and Dept. of Biochemistry, Box 3711, Duke University Medical Center, Durham, NC 27710. Tel.: 919-684-2775; Fax: 919-681-7874; E-mail: modrich{at}biochem.duke.edu.
3 The abbreviations used are: MeG, O6-methylguanine; O6BG, O6-benzylguanine; AGT, alkylguanine alkyltransferase. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
L J Worrillow, A G Smith, K Scott, M Andersson, A J Ashcroft, G M Dores, B Glimelius, E Holowaty, G H Jackson, G L Jones, et al. Polymorphic MLH1 and risk of cancer after methylating chemotherapy for Hodgkin lymphoma J. Med. Genet., March 1, 2008; 45(3): 142 - 146. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mojas, M. Lopes, and J. Jiricny Mismatch repair-dependent processing of methylation damage gives rise to persistent single-stranded gaps in newly replicated DNA Genes & Dev., December 15, 2007; 21(24): 3342 - 3355. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||