Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M604705200 on June 13, 2006

J. Biol. Chem., Vol. 281, Issue 32, 22729-22735, August 11, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/32/22729    most recent
M604705200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rodriguez, J. M.
Right arrow Articles by Cress, W. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rodriguez, J. M.
Right arrow Articles by Cress, W. D.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Bok, Bcl-2-related Ovarian Killer, Is Cell Cycle-regulated and Sensitizes to Stress-induced Apoptosis*

Jose M. Rodriguez{ddagger}§||, Michele A. Glozak{ddagger}§, Yihong Ma{ddagger}§, and W. Douglas Cress{ddagger}§||1

From the {ddagger}Molecular Oncology Program, H. Lee Moffitt Cancer Center and Research Institute, §Department of Interdisciplinary Oncology, Cancer Biology Ph.D. Program, ||University of South Florida, Tampa, Florida 33612

Received for publication, May 16, 2006


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bok/Mtd (Bcl-2-related ovarian killer/Matador) is considered a pro-apoptotic member of the Bcl-2 family. Although identified in 1997, little is known about its biological role. We have previously demonstrated that Bok mRNA is up-regulated following E2F1 overexpression. In the current work, we demonstrate that Bok RNA is low in quiescent cells and rises upon serum stimulation. To determine the mechanism underlying this regulation, we cloned and characterized the mouse Bok promoter. We find that the mouse promoter contains a conserved E2F binding site (-43 to -49) and that a Bok promoter-driven luciferase reporter is activated by serum stimulation dependent on this site. Chromatin immunoprecipitation assays demonstrate that endogenous E2F1 and E2F3 associate with the Bok promoter in vivo. Surprisingly, we find that H1299 cells can stably express high levels of exogenous Bok protein. However, these cells are highly sensitive to chemotherapeutic drug treatment. Taken together these results demonstrate that Bok represents a cell cycle-regulated pro-apoptotic member of the Bcl-2 family, which may predispose growing cells to chemotherapeutic treatment.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The E2F family of transcription factors has key roles in regulating the G1/S transition (1-4). There are nine E2F proteins identified, so far (5-15). These proteins can be divided into three distinct groups based on both structure and function. E2F1, -2, and -3A make up the first distinct group. Structurally, a long N-terminal region, of unclear function, distinguishes these E2Fs. They also contain a cyclin A binding domain important for their down-regulation in S phase (16-18). At the C terminus, each possesses a potent transcriptional activation domain that contains an Rb binding motif (5, 8, 10, 11). Functionally, these E2Fs appear necessary for cell cycle progression (3, 19, 20), they are primarily expressed at the G1/S boundary (3, 7, 21-28) and they potently drive S phase when expressed in otherwise quiescent rodent fibroblast (1, 2, 29, 30).

In contrast, members of the second group of E2Fs (-3B, -4, and -5) lack the N-terminal region and are expressed ubiquitously through the cell cycle (31). They can activate transcription of G1/S genes when overexpressed in rodent fibroblast, particularly E2F3B (32), but do so less efficiently than E2F1-3A (2, 29). These E2Fs appear essential to maintain growth arrest (33, 34) and contribute to differentiation (34, 35). Mechanistically these E2Fs may primarily serve to tether Rb to E2F-regulated promoters during G0 (33, 35), and may also serve to generate an initial pulse of E2F activity that is subsequently amplified by activating the transcription of the more potent E2F1, -2, and -3A.

Finally, E2F6, -7, and -8 represent the third group. These E2Fs appear to lack the transcriptional activation/Rb binding domain present in other E2Fs and serve exclusively to repress transcription via interaction with transcriptional repressors (6, 12-15, 36, 37). For example, E2F6 binds to transcriptional co-repressors because of its ability to bind polycomb protein molecules and generally serves to repress growth (36).

Apoptosis or programmed cell death is an important process for the maintenance of tissue homeostasis and the prevention of diseases such as cancer. Whereas the E2F family is clearly implicated in the control of cell cycle there is also extensive evidence that E2Fs play a critical role in the regulation of programmed cell death (29, 38-40). A number of targets in E2F-regulated cell death have been identified and these include members of the Bcl-2 family (38, 41-43). The Bcl-2 family of proteins consists of different anti- and pro-apoptotic members that mediate cytochrome c release from mitochondria and thus play important roles in the "decision" step of the intrinsic apoptotic pathway (44, 45). BOK, a pro-apoptotic member of the Bcl-2 family, was first cloned in a yeast two-hybrid screen of an ovarian cDNA library for proteins that interacted with Mcl-1, BHRF1, and Bfl-1 (46). The mouse homolog (Mtd) was identified bioinformatically (47). Bok contains Bcl-2 homology domains (BH1, -2, and -3) and can heterodimerize with Mcl-1, BHRF-1, and Bfl-1, but not Bcl-2 or Bcl-xl (46-48). Bok can induce apoptosis in a variety of cell types (46-51) and this activity is inhibited by Mcl-1, BHRF-1, and Bfl-1, but not Bcl-2 or Bcl-xl. In the present work, we investigated the transcriptional regulation of Bok and its potential roles in cell cycle. We find that Bok is an E2F-regulated gene activated by serum stimulation, and that it may function as a checkpoint sensitizing growing cells to stress-induced apoptosis.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cloning the Bok Promoter—Approximately 5 x 105 plaques from a Sau3AI partially digested 129SV mouse genomic library in {lambda}FIXII (Stratagene) were screened in duplicate at high stringency with a mixture of human and mouse Bok cDNA probes. Following plaque purification, seven purified positive plaques were identified. Phage DNA was extracted from plate lysates using the Qiagen MIDI {lambda} Kit according to manufacturer's specifications. NotI digestion of the phage DNA indicated that each clone had a different sized insert, each in the ~15-20-kb range. Restriction digestion and Southern blotting showed that the clones were unique and covered the entire Bok genomic locus. Each of the phage DNAs was then digested with NotI to excise the entire insert for cloning into pBluescript (pBS). In addition, based on differential hybridization patterns, phage DNAs were also digested with XhoI or SstI to subclone smaller fragments into pBS. Bluescript clones containing inserts were sequenced with T3 and T7 promoter to confirm the ends of each clone against the published genomic sequence (NT_039173 [GenBank] ).


Figure 1
View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 1.
Bok mRNA is activated by E2F1 or serum stimulation. NIH 3T3 cells were brought to quiescence by 48 h incubation in 0.5% calf serum. Cells were then stimulated with 10% fetal calf serum or were infected with 10 plaque-forming units of the indicated adenovirus per cell. Cells were harvested after 24 (serum) or 30 h (virus). A,20 µg of total RNA were subjected to Northern analysis using the indicated cDNA probes. B, NIH 3T3 cells were treated as above, fixed with 70% ethanol/PBS, stained with PI, and analyzed by FACS. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; FBS, fetal bovine serum.

 
Plasmids—Mouse Bok promoter reporters were generated by digestion of pBS-13S2 with SstI and ligated into pGL3 basic. Initial PCR primers were designed to amplify 331 bp (-244/+87) of our sequenced Bok promoter, which are numbered relative to the transcriptional start site. The forward (192 forward) and reverse (141 reverse) PCR primers for the Bok promoter were 5'-GGTACCAGAACTTGTGCTGGCCTTTCT-3' and 5'-AAGCTTAGTTCTGGTTTCAGGACCCGC-3', respectively. The forward primer added a KpnI site, and the reverse added a HindIII site to facilitate subcloning. The E2F binding site mutant of the Bok promoter was generated by site-directed mutagenesis with PCR. The initial reaction was done using 192 forward and 192 reverse (5'-TCCGCCGGTCTTCCATCGCGC-3'); a second reaction used primer 141 forward (5'-CGCGATGGAAGACCGGCGGA-3') and 141 reverse. The PCR products from these reactions, 192 and 141 bp, respectively, were band purified, phenol/chloroform extracted, and ethanol precipitated. They were then resuspended in water, combined, and used as template in another PCR using the flanking primers 192 forward and 141 reverse. The resulting PCR product was inserted in pCRII-TOPO, followed by digestion with KpnI and HindIII (to excise PCR insert). Insert was then band purified and ligated to the pGL3 luciferase vector. The E2F1 mutant constructs, E2F1-(1-284) and E2F1-(Eco132) have been previously described (52, 53).


Figure 2
View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 2.
Overlapping subclones in pBS encompassing the entire Bok genomic locus. A, subclones were excised from the phage clones with SstI (S), XhoI (X), or NotI (N). NotI subclones represent the entire insert of the phage clones, whereas SstI and XhoI subclones contain only part of the original phage clone. Numbering is relative to the Mus musculus chromosome 1 genomic contig NT_039173.2, which contains the Bok locus. Solid boxes indicate exons. Exon 1 is noncoding. The ATG start codon is located at position 8083483 in exon 2. The stop codon is located at position 8092198 in exon 5. B, the pBS-13S2 was further subcloned into pGL3 luciferase vector using SstI, SmaI, or XbaI. These subclones contain the Bok promoter region and the four putative E2F binding sites marked by black circles.

 
Cell Culture—Mouse NIH 3T3 fibroblasts were cultured in Dulbecco's modified Eagle's medium supplemented with 5% calf serum. The H1299 lung cancer cell line was cultured in Dulbecco's modified Eagle's medium supplemented with 5% fetal bovine serum. H1299 cells that constitutively express the FLAG-Bok fusion protein were obtained by transfecting with pcDNA3-FLAG-Bok (a gift from Gabriel Nunez, University of Michigan) and selecting for transformants in 400 µg/ml G418. G418-resistant lines were screened for expression of FLAG-Bok. Adenoviruses were described previously (54) and titered by plaque assay. Cell cycle parameters were measured by fixing cells with 70% ethanol-PBS,2 staining with propidium iodide (PI), and analyzing by FACS, using ModFit.

Biochemical Assays—Transfections were performed using Lipofectamine PLUS® Reagent from Invitrogen with test DNA totaling 2.85 µg of DNA per 60-mm dish. Transfections included 100 ng of expression plasmids (pcDNA3-based vectors), 2.5 µg of test construct firefly luciferase reporter plasmid (pGL3, Promega), and 250 ng of Renilla luciferase reporter plasmid (pRL-TK, Promega). Cells were harvested 48 h after transfection, and luciferase assays were performed using the Dual Luciferase Reporter Assay System following the manufacturer's protocol (Promega). Experiments were done in duplicate or triplicates, and the relative activities and standard deviation values were determined. To control for transfection efficiency, firefly luciferase values were normalized to the values for Renilla luciferase. Western blots were performed as previously described (39) using monoclonal antibody against FLAG epitope (F3165, Sigma) or against poly(ADP)-ribose polymerase (PARP) antibody (Cell Signaling 9542). Western blots were stripped and re-probed with an antibody to actin (A5441, Sigma) to ensure equivalent loading.


Figure 3
View larger version (82K):
[in this window]
[in a new window]
  		FIGURE 3.
Conserved E2F binding site. An alignment between the mouse (NT_039173) and human (AC110299) Bok gene sequences using MegAlign (DNASTAR, Inc.) showed a conserved putative E2F binding site that extends from position -42 to -49 relative to the putative transcriptional start site in the mouse sequence. Shaded blocks indicate sequence identity of at least five base pairs. Boxed areas indicate putative transcription factor binding sites identified by MatInspector (Genomatix). The highlighted G at +1 in the mouse sequence indicates the putative transcription start site based on NCBI annotations (60).

 
Reverse Transcriptase-PCR—Isolation of total RNA was done using the RNeasy mini kit (Qiagen 74104) as recommended by manufacturer. Total RNA was primed with random hexamers, and cDNA was created using the SuperScrip® First Strand Synthesis System for reverse transcriptase-PCR (Invitrogen 11904-018). PCR primers were designed to amplify 490 bp. The forward and reverse primers were 5'-CGCTCGCCCACAGACAAGGA-G-3' and 5'-TCTGTGCTGACCACACACTTG-3'.

Chromatin Immunoprecipitation—Chromatin immunoprecipitation assays were performed as previously described (39, 55-59). Briefly, asynchronously growing NIH 3T3 cells were treated with formaldehyde to create protein-DNA cross-links, and the cross-linked chromatin was then extracted, diluted with chromatin immunoprecipitation buffer, and sonicated. Sonicated chromatin was divided into equal samples for immunoprecipitation. Antibodies used included E2F1 (sc-193X), E2F3 (sc-878X), and IgG (sc-2027) (from Santa Cruz Biotechnology).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Bok mRNA Is Induced by E2F1 Overexpression and by Serum Stimulation—In a previous microarray screen (54), we identified Bok as a potential E2F1 target gene. To confirm this observation, we tested if overexpression of E2F1 would correlate with increased expression of Bok mRNA. NIH 3T3 cells were brought to quiescence by a 48-h incubation in 0.5% calf serum. Cells were then stimulated with 10% fetal calf serum or were infected with 10 plaque-forming units of the indicated adenovirus per cell. Fig. 1A highlights the observation that Bok mRNA is very low in quiescent NIH 3T3 fibroblasts (lane 3), but is highly induced following infection with an E2F1-expressing adenovirus (lane 1). Lane 4 reveals that serum treatment, which stimulates quiescent cells to enter S phase, also elevated Bok message (lane 4), suggesting that Bok is E2F and cell cycle regulated. Data provided in Fig. 1B confirm the cell cycle status of treated cells (Fig. 1A).

The Bok Promoter Contains a Conserved E2F Binding Sequence Central to Its Cell Cycle Regulation—To understand how Bok is regulated in an E2F/cell cycle-dependent manner, we compared the genomic sequences of human (AC110299 [GenBank] ) and mouse Bok (NT_039173 [GenBank] ). To obtain authentic Bok genomic sequence from mouse, we screened a {lambda} phage library using a mixture of human cDNA probes and mouse untranslated region Bok probes. Fig. 2A shows a schematic of the various clones obtained. One of the subclones, 13S2, which contains the first two Bok exons and over 900 bp of upstream promoter region, was sequenced. Comparison of the mouse and human Bok 5' regions (shown in Fig. 3) revealed significant sequence homology within the first exon (non-coding) and in a region-244 upstream of the putative transcriptional start site in mouse (60).


Figure 4
View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 4.
The Bok promoter is activated by addition of serum dependent upon a conserved E2F binding site. A, schematic representation of the Bok promoter containing the wild type (closed circle) or mutated (x) E2F binding site. These fragments were then cloned into pGL3. B, NIH 3T3 cells were transfected with the WT or MUT -244/+87 Bok promoter luciferase construct and then brought to quiescent by 48 h incubation with 0.5% calf serum. Following starvation cells were stimulated with 10% fetal calf serum and harvested every 6 h and assayed for luciferase activity. C, cell cycle progression of NIH 3T3 cells after treatment as in B. Cells were fixed with 70% ethanol/PBS, stained with PI, and analyzed by FACS. WT, wild type.

 
Crude deletion analysis localized the promoter to -244/+87 (not shown). Potentially important motifs within this region include numerous SP1 binding sites and, most importantly, a conserved E2F1 consensus-binding site. We used PCR to generate a luciferase reporter vector using the mouse genomic sequence from -244/+87. To examine the role of the conserved E2F1 site spanning from position -43 to -49, we also generated a mutated version of the -244/+87 construct in which the E2F1 site was rendered nonfunctional. Fig. 4A shows a schematic representation of the constructs generated. They differ in that the consensus E2F binding site CGCGCGGGAAGACCGGCGGA (wild type) is changed to CGCGATGGAAGACCGGCGGA (mutant).

To characterize the activity of the cloned Bok promoter throughout the cell cycle, NIH 3T3 cells were transfected with Bok -244/+87 WT or MUT promoter/reporter. Cells were brought to quiescence by incubation with 0.5% calf serum for 48 h and were then serum stimulated with 10% fetal calf serum and harvested every 6 h. In parallel, cells were fixed with 70% ethanol/PBS, stained with PI, and analyzed by FACS to determine cell cycle status. Fig. 4B shows that the activity of the WT Bok promoter is maximal at 6 and 12 h after addition of serum corresponding to the mid to late G1 phase of the cell cycle (Fig. 4C). This pattern of regulation is very typical of an E2F1-regulated gene. In contrast, the activity of the MUT Bok promoter is unaffected by serum addition. This supports the conclusion that the conserved E2F binding site at -49/-43 is central to the cell cycle regulation of Bok.


Figure 5
View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 5.
S phase promoting members of the E2F family activate the Bok promoter. A, E2F binding site MUT and WT Bok promoters were co-transfected with expression vectors for different members of the E2F family and their ability to activate the Bok promoter was measured. B, same as in A except focusing on the strongest S phase promoting E2Fs. E2F3A is the most potent activator of the Bok promoter. WT, wild type.

 
Activation of the Bok Promoter Is Not Specific to E2F1—E2F1 is the most potent inducer of apoptosis among the E2F family of proteins and appears essential for E2F-induced apoptosis (29, 61). Because Bok is a known pro-apoptotic protein, we anticipated that E2F1 might be a specific activator of Bok. To test this idea, we compared the ability of various E2Fs to induce the Bok luciferase reporter. We co-transfected the wild type (Bok -244/+87 WT) promoter, or the E2F site mutant (Bok -244/+87 MUT) in the presence and absence of exogenous E2F proteins (Fig. 5A). E2Fs 1, 2, and 3B expression each led to promoter activation. This result suggests that activation of Bok is not specific to E2F1. The growth-repressing members of the E2F family E2F4, -5, and -6 did not significantly activate the promoter and neither did two E2F1 mutants. E2F1-(1-283) is a C-terminal truncated version of E2F1 (52) that does not have a transcriptional activation domain, indicating that activation of the Bok promoter requires the activation domain. Likewise, the DNA binding E2F1 mutant, Eco132 (53), was unable to activate transcription. Thus, DNA binding is required for activation of the Bok promoter.


Figure 6
View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 6.
E2F1 and E2F3 associate with the Bok promoter in vivo. Asynchronously growing NIH 3T3 were subject to chromatin immunoprecipitation analysis with antibodies against E2F1 (lane 4), E2F3 (lane 5), or IgG (lane 6). Following DNA purification, samples were subject to PCR with primers designed to amplify the Bok promoter or the albumin promoter as control. Ab, antibody.

 
Because E2F1 and E2F3B were the most potent activators of the Bok promoter in comparison of Fig. 5A, we focused experiments on comparing E2F1, E2F3A, and E2F3B. Together Fig. 5, A and B, reveal that E2F3A is the most potent inducer of the Bok promoter followed by E2F3B, E2F1, and E2F2. Although the importance of this pattern of activity is not certain, it is clear that E2F1 is unlikely to be the sole regulator of Bok. The observation that overexpression of E2Fs can stimulate the MUT Bok reporter suggests that additional functional E2F binding sites may exist in the promoter, if E2F levels are sufficiently high.

E2F1 and E2F3 Associate with the Bok Promoter in Vivo—In light of the fact that E2F1 and E2F3A potently activate the Bok promoter in context of a luciferase reporter, we wanted to determine whether E2Fs associate with the Bok promoter in vivo. For this, we turned to a chromatin immunoprecipitation assay of asynchronous NIH 3T3 cells. As shown in Fig. 6, using Bok-specific oligonucleotide primers that span -244 to +87 of the murine Bok gene, E2F1 and E2F3 each associate with the Bok promoter in vivo, in agreement with the aforementioned luciferase result. The fact that immunoprecipitation with a control antibody (anti-IgG) results in the absence of signal from the Bok promoter, demonstrates the specificity of the interaction between E2Fs and the Bok promoter. In addition, the lower panel in Fig. 6 reveals that the murine albumin promoter, which does not possess E2F sites and has been shown not to associate with E2F (55), is not immunoprecipitated with E2F antibodies under identical conditions.

Bok Expression Sensitizes Cells to Flavopiridol-induced Apoptosis—To determine the functional effect of increased Bok expression, we created H1299 cells lines that constitutively express a FLAG epitope-tagged version of Bok. Expression of the introduced FLAG-Bok protein was confirmed via reverse transcriptase-PCR and Western blot (Fig. 7, A and B). Surprisingly, constitutive expression of FLAG-Bok did not necessarily induce spontaneous apoptosis in these cells, and several lines were developed. Clone number 8 expressed the highest level of FLAG-Bok and this was used for subsequent experiments. The FLAG-Bok expressing cells grew at the same rate as parental H1299s (Fig. 7C).


Figure 7
View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 7.
Stable overexpression of FLAG-Bok protein sensitizes H1299 cells to flavopiridol-induced apoptosis. A, FLAG-Bok expressing H1299 cell lines were generated by transfection with pcDNA3-Flag-Bok followed by selection with G418 (see "Experimental Procedures"). G418-resistant colonies emerged with the same efficiency as control pcDNA3. Of the first six lines emerging from this screen three expressed FLAG-Bok as measured by anti-FLAG Western blot. Clone number 8 was used for subsequent experiments. B, total RNA was harvested from the indicated cell lines and subjected to reverse transcriptase-PCR. 1 µg or 10 ng of RNA were used as template in the reverse transcriptase step, then 1/20 of the reverse transcriptase reaction was used for PCR with radioactive dNTPs for 25 cycles. C, H1299 and H1299 FLAG-Bok cell line number 8 were plated in 60-mm plates and their growth rate/survival was measured by trypsinization, followed by counting trypan blue excluding cells after treatment with Me2SO control or flavopiridol (200 nM). D, in parallel, sub-G1 DNA content was measured by PI labeling after flavopiridol treatment. E, protein extracts of H1299 or H129 FLAG-Bok cell lines after treatment of flavopiridol were harvested in 24-h intervals and Western blotted for PARP.

 
In light of the observation that FLAG-Bok overexpression alone is not sufficient for apoptosis induction, we sought to determine whether overexpression of FLAG-Bok sensitizes cells to stress-induced apoptosis. To this end, the H1299-FLAG-Bok number 8 cell line (as well as parental H1299s) was assayed for viability after treatment with the cyclin-dependent kinase inhibitor flavopiridol, which we have previously shown to induce apoptosis in H1299 cells (39, 40). Fig. 7C reveals that flavopiridol-induced loss of viability is greatly accelerated in FLAG-Bok expressing cells. Similar results were obtained with other chemotherapeutic agents (not shown).

We next sought to verify our viability assay in a more direct measurement of apoptosis induction. The H1299-FLAG-Bok cell line and control H1299s were treated with flavopiridol, harvested at 24-h intervals, stained with PI, and assayed for sub-G1 DNA content via flow cytometry. In agreement with low viability, there was a significant increase in sub-G1 content within the flavopiridol-treated H1299-FLAG-Bok cell lines in comparison to the parental controls (Fig. 7D). For further confirmation, we conducted Western blot analysis for the presence of PARP cleavage (a measurement of apoptosis) within the same experiment. As expected, both H1299-FLAG-Bok and parental H1299s displayed cleavage of PARP, however, PARP cleavage began 24 h post-flavopiridol treatment and was maximal at 48 h in the FLAG-Bok expressing cell line, whereas PARP cleavage was noticeable 48 h and maximal at 72 h within the H1299 parental controls (Fig. 7E). Taken together, these data suggest that expression of FLAG-Bok sensitizes cells to rapid apoptosis induction.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
In the current work we show that the Bok promoter is activated by serum addition in a manner dependent upon a conserved E2F site in the promoter. The Bok promoter is also activated by overexpression of S phase promoting members of the E2F family. We also show by ChIP assay that E2F1 and E2F3 both bind the Bok promoter region in vivo. Finally we find that Bok overexpression sensitizes to flavopiridol-induced apoptosis.

Our understanding of the interactions between the E2F and Bcl-2 families of proteins that modulate survival are growing increasingly complex and interwoven. This is the first example of a pro-apoptotic member of the Bcl-2 family found to have its expression tied to cell cycle progression, although this is not the first example of regulation of the Bcl-2 family by E2F1 in its apoptotic role. It has been known for some time that E2F1 can repress the expression of Bcl-2 (42) and, we have demonstrated that E2F1 can directly repress the Mcl-1 promoter (38, 54). Other laboratories have found that several pro-apoptotic BH3-only members of the Bcl-2 family (PUMA, Noxa, Bim, and Hrk/DP5) are also activated by E2F1 (43). In the current work, we find that E2F1 can directly activate expression of Bok. Because E2F1 is a well characterized inducer of apoptosis its effects on Mcl-1, PUMA, Noxa, Bim, Hrk/DP5, and Bok are logical. The net consequence of overactive E2F1 is thus to tip the balancing act within the Bcl-2 family toward apoptosis.

The transcriptional activation of Bok at the G1/S boundary by serum stimulation was not anticipated because Bok is considered a pro-apoptotic member of the Bcl-2 family. Bok might have a number of roles at G1/S. For example, recent work has shown that BID (a pro-apoptotic Bcl-2 protein) can induce an S phase arrest following its phosphorylation by ATM (62-64). Whereas we cannot formally exclude the possibility that Bok has a specific G1/S function, we have performed extensive small interfering RNA experimentation aimed at depleted proliferating cells of Bok. Although we are confident in our ability to deplete cells of 80-90% of endogenous Bok mRNA or exogenous protein, we obtained no convincing evidence that Bok deficiency affects cell cycle progression. Of course these studies are hampered by the lack of good quality antibody to Bok, and so, it is possible that future studies will find an additional role for Bok in the cell cycle.

An alternative role for Bok induction at the G1/S boundary would be to serve as a checkpoint. G1/S phase cells are known to be highly sensitive to apoptosis induction and it reasonable that expression of Bok might mediate this sensitivity, at least in part. This model would lead to the prediction that cells expressing exogenous FLAG-Bok would survive and grow normally, but would be sensitive to apoptosis-inducing stresses. Indeed, this appears to be the case because FLAG-Bok expressing H1299 cell lines are obtained with high efficiency and they grow normally, yet they are much more readily killed by treatment with flavopiridol, as well as by other death-inducing agents (not shown). Taken together the results in this article demonstrate that Bok is a cell cycle-regulated member of the Bcl-2 family that serves as a checkpoint sensitizing replicating cells to stressinduced apoptosis.


   FOOTNOTES
 
* This work was supported by National Institutes of Health NCI Grant CA90489 (to W. D. C.), a Minority Supplement to CA090489 (to J. M. R.), Department of Defense National Functional Genomics Pilot Project 12-12990-01-01 (to W. D. C.), and the Molecular Biology, Flow Cytometry, Analytical Microscopy, and the Molecular Imaging Core Facilities of the Moffitt Cancer Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: 12902 Magnolia Dr., Tampa, FL 33612. Tel.: 813-979-6703; E-mail: cressd{at}moffitt.usf.edu.

2 The abbreviations used are: PBS, phosphate-buffered saline; PARP, poly-(ADP)-ribose polymerase; PI, propidium iodide; FACS, fluorescence-activated cell sorter. Back


   ACKNOWLEDGMENTS
 
We acknowledge Scott N. Freeman for scientific input and review.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Johnson, D. G., Schwarz, J. K., Cress, W. D., and Nevins, J. R. (1993) Nature 365, 349-352[CrossRef][Medline] [Order article via Infotrieve]
  2. Lukas, J., Petersen, B. O., Holm, K., Bartek, J., and Helin, K. (1996) Mol. Cell. Biol. 16, 1047-1057[Abstract]
  3. Leone, G., DeGregori, J., Yan, Z., Jakoi, L., Ishida, S., Williams, R. S., and Nevins, J. R. (1998) Genes Dev. 12, 2120-2130[Abstract/Free Full Text]
  4. Mann, D. J., and Jones, N. C. (1996) Curr. Biol. 6, 474-483[CrossRef][Medline] [Order article via Infotrieve]
  5. Helin, K., Lees, J. A., Vidal, M., Dyson, N., Harlow, E., and Fattaey, A. (1992) Cell 70, 337-350[CrossRef][Medline] [Order article via Infotrieve]
  6. Cartwright, P., Muller, H., Wagener, C., Holm, K., and Helin, K. (1998) Oncogene 17, 611-623[CrossRef][Medline] [Order article via Infotrieve]
  7. Sardet, C., Vidal, M., Cobrinik, D., Geng, Y., Onufryk, C., Chen, A., and Weinberg, R. A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 2403-2407[Abstract/Free Full Text]
  8. Ivey-Hoyle, M., Conroy, R., Huber, H. E., Goodhart, P. J., Oliff, A., and Heimbrook, D. C. (1993) Mol. Cell. Biol. 13, 7802-7812[Abstract/Free Full Text]
  9. He, Y., Armanious, M. K., Thomas, M. J., and Cress, W. D. (2000) Oncogene 19, 3422-3433[CrossRef][Medline] [Order article via Infotrieve]
  10. Kaelin, W. G., Jr., Krek, W., Sellers, W. R., DeCaprio, J. A., Ajchenbaum, F., Fuchs, C. S., Chittenden, T., Li, Y., Farnham, P. J., Blanar, M. A., Livingston, D. M., and Flemington, E. K. (1992) Cell 70, 351-364[CrossRef][Medline] [Order article via Infotrieve]
  11. Lees, J. A., Saito, M., Vidal, M., Valentine, M., Look, T., Harlow, E., Dyson, N., and Helin, K. (1993) Mol. Cell. Biol. 13, 7813-7825[Abstract/Free Full Text]
  12. Trimarchi, J. M., Fairchild, B., Wen, J., and Lees, J. A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 1519-1524[Abstract/Free Full Text]
  13. Maiti, B., Li, J., de Bruin, A., Gordon, F., Timmers, C., Opavsky, R., Patil, K., Tuttle, J., Cleghorn, W., and Leone, G. (2005) J. Biol. Chem. 280, 18211-18220[Abstract/Free Full Text]
  14. de Bruin, A., Maiti, B., Jakoi, L., Timmers, C., Buerki, R., and Leone, G. (2003) J. Biol. Chem. 278, 42041-42049[Abstract/Free Full Text]
  15. Di Stefano, L., Jensen, M. R., and Helin, K. (2003) EMBO J. 22, 6289-6298[CrossRef][Medline] [Order article via Infotrieve]
  16. Kitagawa, M., Higashi, H., Suzuki-Takahashi, I., Segawa, K., Hanks, S. K., Taya, Y., Nishimura, S., and Okuyama, A. (1995) Oncogene 10, 229-236[Medline] [Order article via Infotrieve]
  17. Krek, W., Xu, G., and Livingston, D. M. (1995) Cell 83, 1149-1158[CrossRef][Medline] [Order article via Infotrieve]
  18. Xu, M., Sheppard, K. A., Peng, C. Y., Yee, A. S., and Piwnica-Worms, H. (1994) Mol. Cell. Biol. 14, 8420-8431[Abstract/Free Full Text]
  19. Wu, L., Timmers, C., Maiti, B., Saavedra, H. I., Sang, L., Chong, G. T., Nuckolls, F., Giangrande, P., Wright, F. A., Field, S. J., Greenberg, M. E., Orkin, S., Nevins, J. R., Robinson, M. L., and Leone, G. (2001) Nature 414, 457-462[CrossRef][Medline] [Order article via Infotrieve]
  20. Humbert, P. O., Verona, R., Trimarchi, J. M., Rogers, C., Dandapani, S., and Lees, J. A. (2000) Genes Dev. 14, 690-703[Abstract/Free Full Text]
  21. Adams, P. D., and Kaelin, W. G., Jr. (1996) Curr. Top. Microbiol. Immunol. 208, 79-93[Medline] [Order article via Infotrieve]
  22. Flores, A. M., Kassatly, R. F., and Cress, W. D. (1998) Oncogene 16, 1289-1298[CrossRef][Medline] [Order article via Infotrieve]
  23. Hsiao, K. M., McMahon, S. L., and Farnham, P. J. (1994) Genes Dev. 8, 1526-1537[Abstract/Free Full Text]
  24. Ikeda, M. A., Jakoi, L., and Nevins, J. R. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 3215-3220[Abstract/Free Full Text]
  25. Johnson, D. G., Ohtani, K., and Nevins, J. R. (1994) Genes Dev. 8, 1514-1525[Abstract/Free Full Text]
  26. Moberg, K., Starz, M. A., and Lees, J. A. (1996) Mol. Cell. Biol. 16, 1436-1449[Abstract]
  27. Neuman, E., Sellers, W. R., McNeil, J. A., Lawrence, J. B., and Kaelin, W. G., Jr. (1996) Gene (Amst.) 173, 163-169[CrossRef][Medline] [Order article via Infotrieve]
  28. Sears, R., Ohtani, K., and Nevins, J. R. (1997) Mol. Cell. Biol. 17, 5227-5235[Abstract]
  29. DeGregori, J., Leone, G., Miron, A., Jakoi, L., and Nevins, J. R. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 7245-7250[Abstract/Free Full Text]
  30. Kowalik, T. F., DeGregori, J., Schwarz, J. K., and Nevins, J. R. (1995) J. Virol. 69, 2491-2500[Abstract]
  31. Vairo, G., Livingston, D. M., and Ginsberg, D. (1995) Genes Dev. 9, 869-881[Abstract/Free Full Text]
  32. He, Y., and Cress, W. D. (2002) J. Biol. Chem. 277, 23493-23499[Abstract/Free Full Text]
  33. Gaubatz, S., Lindeman, G. J., Ishida, S., Jakoi, L., Nevins, J. R., Livingston, D. M., and Rempel, R. E. (2000) Mol. Cell 6, 729-735[CrossRef][Medline] [Order article via Infotrieve]
  34. Rempel, R. E., Saenz-Robles, M. T., Storms, R., Morham, S., Ishida, S., Engel, A., Jakoi, L., Melhem, M. F., Pipas, J. M., Smith, C., and Nevins, J. R. (2000) Mol. Cell 6, 293-306[CrossRef][Medline] [Order article via Infotrieve]
  35. Persengiev, S. P., Kondova, I. I., and Kilpatrick, D. L. (1999) Mol. Cell. Biol. 19, 6048-6056[Abstract/Free Full Text]
  36. Ogawa, H., Ishiguro, K., Gaubatz, S., Livingston, D. M., and Nakatani, Y. (2002) Science 296, 1132-1136[Abstract/Free Full Text]
  37. Logan, N., Delavaine, L., Graham, A., Reilly, C., Wilson, J., Brummelkamp, T. R., Hijmans, E. M., Bernards, R., and La Thangue, N. B. (2004) Oncogene 23, 5138-5150[CrossRef][Medline] [Order article via Infotrieve]
  38. Croxton, R., Ma, Y., Song, L., Haura, E. B., and Cress, W. D. (2002) Oncogene 21, 1359-1369[CrossRef][Medline] [Order article via Infotrieve]
  39. Ma, Y., Cress, W. D., and Haura, E. B. (2003) Mol. Cancer Ther. 2, 73-81[Abstract/Free Full Text]
  40. Ma, Y., Freeman, S. N., and Cress, W. D. (2004) Cancer Biol. Ther. 3, 1262-1269[Medline] [Order article via Infotrieve]
  41. Flinterman, M., Guelen, L., Ezzati-Nik, S., Killick, R., Melino, G., Tominaga, K., Mymryk, J. S., Gaken, J., and Tavassoli, M. (2005) J. Biol. Chem. 280, 5945-5959[Abstract/Free Full Text]
  42. Eischen, C. M., Packham, G., Nip, J., Fee, B. E., Hiebert, S. W., Zambetti, G. P., and Cleveland, J. L. (2001) Oncogene 20, 6983-6993[CrossRef][Medline] [Order article via Infotrieve]
  43. Hershko, T., and Ginsberg, D. (2004) J. Biol. Chem. 279, 8627-8634[Abstract/Free Full Text]
  44. Reed, J. C. (1997) Nature 387, 773-776[CrossRef][Medline] [Order article via Infotrieve]
  45. Cory, S., Huang, D. C., and Adams, J. M. (2003) Oncogene 22, 8590-8607[CrossRef][Medline] [Order article via Infotrieve]
  46. Hsu, S. Y., Kaipia, A., McGee, E., Lomeli, M., and Hsueh, A. J. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 12401-12406[Abstract/Free Full Text]
  47. Inohara, N., Ekhterae, D., Garcia, I., Carrio, R., Merino, J., Merry, A., Chen, S., and Nunez, G. (1998) J. Biol. Chem. 273, 8705-8710[Abstract/Free Full Text]
  48. Hsu, S. Y., and Hsueh, A. J. (1998) J. Biol. Chem. 273, 30139-30146[Abstract/Free Full Text]
  49. Suominen, J. S., Yan, W., Toppari, J., and Kaipia, A. (2001) Eur. J. Endocrinol. 145, 771-778[Abstract]
  50. Ha, S. H., Lee, S. R., Lee, T. H., Kim, Y. M., Baik, M. G., and Choi, Y. J. (2001) Mol. Cells 12, 368-371[Medline] [Order article via Infotrieve]
  51. Brown, C. Y., Bowers, S. J., Loring, G., Heberden, C., Lee, R. M., and Neiman, P. E. (2004) Dev. Comp. Immunol. 28, 619-634[CrossRef][Medline] [Order article via Infotrieve]
  52. Cress, W. D., and Nevins, J. R. (1994) J. Virol. 68, 4213-4219[Abstract/Free Full Text]
  53. Cress, W. D., Johnson, D. G., and Nevins, J. R. (1993) Mol. Cell. Biol. 13, 6314-6325[Abstract/Free Full Text]
  54. Ma, Y., Croxton, R., Moorer, R. L., Jr., and Cress, W. D. (2002) Arch. Biochem. Biophys. 399, 212-224[CrossRef][Medline] [Order article via Infotrieve]
  55. Wells, J., Boyd, K. E., Fry, C. J., Bartley, S. M., and Farnham, P. J. (2000) Mol. Cell. Biol. 20, 5797-5807[Abstract/Free Full Text]
  56. Wells, J., Graveel, C. R., Bartley, S. M., Madore, S. J., and Farnham, P. J. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 3890-3895[Abstract/Free Full Text]
  57. Wells, J., Yan, P. S., Cechvala, M., Huang, T., and Farnham, P. J. (2003) Oncogene 22, 1445-1460[CrossRef][Medline] [Order article via Infotrieve]
  58. Rezai-Zadeh, N., Zhang, X., Namour, F., Fejer, G., Wen, Y. D., Yao, Y. L., Gyory, I., Wright, K., and Seto, E. (2003) Genes Dev. 17, 1019-1029[Abstract/Free Full Text]
  59. Gyory, I., Wu, J., Fejer, G., Seto, E., and Wright, K. L. (2004) Nat. Immunol. 5, 299-308[CrossRef][Medline] [Order article via Infotrieve]
  60. Maglott, D., Ostell, J., Pruitt, K. D., and Tatusova, T. (2005) Nucleic Acids Res. 33, D54-D58[Abstract/Free Full Text]
  61. Kowalik, T. F., DeGregori, J., Leone, G., Jakoi, L., and Nevins, J. R. (1998) Cell Growth & Differ. 9, 113-118[Abstract]
  62. Gross, A. (2006) Cell Cycle 5, 582-584[Medline] [Order article via Infotrieve]
  63. Zinkel, S. S., Hurov, K. E., Ong, C., Abtahi, F. M., Gross, A., and Korsmeyer, S. J. (2005) Cell 122, 579-591[CrossRef][Medline] [Order article via Infotrieve]
  64. Kamer, I., Sarig, R., Zaltsman, Y., Niv, H., Oberkovitz, G., Regev, L., Haimovich, G., Lerenthal, Y., Marcellus, R. C., and Gross, A. (2005) Cell 122, 593-603[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Cancer Res.Home page
J. Zeilstra, S. P.J. Joosten, M. Dokter, E. Verwiel, M. Spaargaren, and S. T. Pals
Deletion of the WNT Target and Cancer Stem Cell Marker CD44 in Apc(Min/+) Mice Attenuates Intestinal Tumorigenesis
Cancer Res., May 15, 2008; 68(10): 3655 - 3661.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/32/22729    most recent
M604705200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rodriguez, J. M.
Right arrow Articles by Cress, W. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rodriguez, J. M.
Right arrow Articles by Cress, W. D.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement