Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M603215200 on May 31, 2006

J. Biol. Chem., Vol. 281, Issue 32, 23191-23206, August 11, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/32/23191    most recent
M603215200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugii, S.
Right arrow Articles by Chang, T.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugii, S.
Right arrow Articles by Chang, T.-Y.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Roles of Endogenously Synthesized Sterols in the Endocytic Pathway*

Shigeki Sugii{ddagger}12, Song Lin{ddagger}1, Nobutaka Ohgami{ddagger}13, Masato Ohashi§, Catherine C. Y. Chang{ddagger}, and Ta-Yuan Chang{ddagger}4

From the {ddagger}Department of Biochemistry, Dartmouth Medical School, Hanover, New Hampshire 03755 and §Okazaki Institute for Integrative Bioscience, National Institutes of Natural Sciences, Okazaki 444-8787, Japan

Received for publication, April 4, 2006 , and in revised form, May 30, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The effect(s) of endogenously synthesized cholesterol (endo-CHOL) on the endosomal system in mammalian cells has not been examined. Here we treated Chinese hamster ovary cell lines with lovastatin (a hydroxymethylglutaryl-CoA reductase inhibitor) and mevalonate (a precursor for isoprenoids) to block endo-CHOL synthesis and then examined its effects on the fate of cholesterol liberated from low density lipoprotein (LDL-CHOL). The results showed that blocking endo-CHOL synthesis for 2 h or longer does not impair the hydrolysis of cholesteryl esters but partially impairs the transport of LDL-CHOL to the plasma membrane. Blocking endo-CHOL synthesis for 2 h or longer also alters the localization patterns of the late endosomes/lysosomes and retards their motility, as monitored by time-lapse microscopy. LDL-CHOL overcomes the effect of blocking endo-CHOL synthesis on endosomal localization patterns and on endosomal motility. Overexpressing Rab9, a key late endosomal small GTPase, relieves the endosomal cholesterol accumulation in Niemann-Pick type C1 cells but does not revert the reduced endosomal motility caused by blocking endo-CHOL synthesis. Our results suggested that endo-CHOL contributes to the cholesterol content of late endosomes and controls its motility, in a manner independent of NPC1. These results also supported the concept that endosomal motility plays an important role in controlling cholesterol trafficking activities.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cholesterol is an important lipid molecule present ubiquitously in mammalian cells. It plays important structural and functional roles in cell membranes (1). In specialized cells such as steroidogenic cells or hepatocytes, cholesterol serves as an obligatory precursor for steroid hormones and bile acids. Almost all mammalian cells receive exogenous cholesterol, mainly via the classic low density lipoprotein (LDL)5 receptor pathway; LDL binds to the LDL receptor and enters the cell interior by receptor-mediated endocytosis (2). Although present in the earlier endosomal compartment(s), most of the cholesteryl esters in LDL are hydrolyzed by the enzyme acid lipase (3); the free (unesterified) cholesterol liberated from cholesteryl ester then emerges in the late endosomes (3, 4). The egress of cholesterol from the late endosomes requires the concerted actions of several proteins, including the Niemann-Pick type C1 (NPC1) and NPC2 proteins (reviewed in Ref. 5); both NPC1 and NPC2 proteins directly bind cholesterol (Refs. 6 and 7 and reviewed in Ref. 8). Mutations in either NPC1 or NPC2 cause cholesterol (and other lipids) to be entrapped in the aberrant endosomes/lysosomes and prevent it from being delivered to various destinations, including the plasma membranes (PM), trans-Golgi network (TGN), and the endoplasmic reticulum (ER), where cholesterol would normally be reesterified by the ER resident enzyme acyl-coenzyme A:cholesterol acyltransferase 1 (ACAT1) (reviewed in Refs. 5 and 9). In addition to the cells that contain NPC1 or NPC2 mutations, cells treated with U18666A (a hydrophobic amine (10)) or cells that contain various other mutations (11, 12) can also accumulate cholesterol abnormally and exhibit NPC-like phenotypes (reviewed in Ref. 8). Late endosomes exhibit long distance, bidirectional motility between the peripheral region and the perinuclear region of the cells (13). In general, the motility of endosomal organelles depends on microtubules, various motor proteins, and Rab proteins (reviewed in Ref. 14). Rab proteins are a family of small GTPases present in various endosomal organelles and play important roles in membrane trafficking events (reviewed in Ref. 15). Recently, it was shown that in cells that display NPC-like phenotypes, cholesterol derived from LDL accumulates and blocks the dissociation of Rab7, a Rab protein mainly located in the late endosomes, from its regulator protein guanine nucleotide dissociation inhibitor, causing the Rab7 protein to be locked in an inactive state and significantly diminishing the motility of the late endosomes (13). This study links late endosomal motility with intracellular cholesterol trafficking activities. The accumulation of cholesterol in NPC cells also inhibits the function of Rab4, a different GTPase that is mainly located in the earlier endosomes (16).

In addition to receiving cholesterol via LDL, essentially all mammalian cells also synthesize cholesterol endogenously (endo-CHOL). The de novo biosynthesis of endo-CHOL uses acetyl coenzyme A as the simple precursor and involves many enzymatic reactions. The terminal stage of endo-CHOL synthesis is at the ER (reviewed in Ref. 17). Once synthesized, the nascent endo-CHOL is rapidly transported in an energydependent manner to the caveolae/lipid raft microdomain of the PM within 10-20 min (18-21). These processes do not require NPC1 (22). At the PM, endo-CHOL may recycle rapidly (within minutes) between the PM and the recycling endosomes (23). Other fate(s) of the endo-CHOL remains largely unclear. However, it is known that in mutant NPC1 cells, 8 h or longer after its initial synthesis, a certain portion of endo-CHOL is significantly trapped within the late endosomes; the entrapment partially disables the recycling of endo-CHOL from the late endosomes to the PM and its movement to the ER for esterification by ACAT1 (24, 25). Thus, similar to the LDL-CHOL, the post-PM intracellular trafficking of endo-CHOL partially depends on NPC1. These results suggest that endo-CHOL that traverses through the endocytic compartment may play important role(s) in controlling the function/properties of the late endosome(s). In the this study, we used wild-type (WT) and various well characterized mutant Chinese hamster ovary (CHO) cells as tools and investigated the role of endo-CHOL in the endocytic pathway. We blocked endo-CHOL synthesis by treating cells with lovastatin (also called mevinolin) and mevalonate. Lovastatin is the drug that blocks endo-CHOL synthesis by inhibiting the key enzyme HMG-CoA reductase in the earlier part of the sterol biosynthesis pathway (26). Mevalonate is the reaction product of HMG-CoA reductase. It is an obligatory intermediate for all isoprenoids, including cholesterol, ubiquinone, dolichol, etc., that are all needed for cell growth and survival (reviewed in Ref. 27). When added to the culture medium, only a small amount of mevalonate can enter the cell interior; it cannot satisfy the needs of the lovastatin-treated cells for sterol, but it enables them to synthesize various other mevalonate-derived nonsterol metabolites necessary for cell growth. We examined the endocytic activities of the cells by monitoring the fate of cholesterol liberated from the low density lipoprotein LDL (LDL-CHOL). Our results indicate that endo-CHOL plays a significant role in maintaining the functions of the late endosomes.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Fetal bovine serum (FBS), 2-hydroxypropyl-beta-cyclodextrin (CD), paraformaldehyde, and mevalonic acid (mevalonate) were from Sigma. The lipid-free FBS was prepared as described (28). Mevinolin, also called lovastatin, was a gift from Alfred Alberts (Merck). The acyl-coenzyme A:cholesterol transferase (ACAT) inhibitor F12511 [GenBank] (29) was a gift of Pierre Fabre Research (Castres, France). Percoll and [1,2,6,7-3H]cholesteryl linoleate (30-60 Ci/mmol) were from Amersham Biosciences. [3H]Acetate (20 Ci/mmol) and [1-14C]acetate (56.7 mCi/mmol) were from American Radiolabeled Chemicals. The FuGENE 6 transfection reagent was from Roche Applied Science. ProLong antifade kit, Alexa Fluor 488 or 568 goat anti-rabbit or anti-mouse IgG, LysoTracker Red (DND-99), and DiI (DiIC18(3)) were from Molecular Probes. The rabbit anti-NPC2 polyclonal antiserum was a generous gift from Dr. Peter Lobel (Robert Wood Johnson Medical School). The monoclonal antibody against hamster Lamp2 was from Developmental Studies Hybridoma Bank maintained by the University of Iowa. The mouse anti-beta-actin antibody (clone AC-74) was from Sigma. LDL (density of 1.019-1.063 g/ml) was prepared from fresh human plasma by sequential flotation as described previously (30). [3H]Cholesteryl linoleate-labeled LDL ([3H]CL-LDL) with specific radioactivity of ~5 x 104 cpm/mg protein was prepared according to published procedure (31). DiI-LDL was prepared as described previously (32). The NPC1-GFP expression plasmid was as described previously (33). The Rab9-YFP expression plasmid was a gift of Dr. Yiannis Ioannou (Mount Sinai School of Medicine) (34).

Production of Antibodies against Hamster NPC1 (DM105)—The N-terminal portion of the hamster NPC1 protein (amino acid residues 35-172, ~34 kDa) was expressed as a fusion protein adduct with the bacterial protein GST. To produce the fusion protein, the primer sets used for PCR are as follows: forward primer, CGCGGATCCTTTGGAGATAAGAAGTACAAC (corresponding to BamHI restriction site and to the nucleotide sequence 103-123 of hamster NPC1 (38)); reverse primer, CCGGAATTCGGCCTTCTCATTACTTGCAGG (corresponding to EcoRI restriction site and to the nucleotide sequence 498-516 of hamster NPC1). The resulting PCR product was digested with BamHI and EcoRI and ligated into the pGEX-4T1 vector (Amersham Biosciences) that had been digested with BamHI and EcoRI, followed by gel purification. The fusion protein was expressed in Escherichia coli and purified by SDS-PAGE, based on the procedure employed previously (29). The purified protein in 0.2% SDS solution was sent to Cocalico Co. (Philadelphia, PA) to generate antisera in rabbits. The antisera were purified via GST-NPC1 fusion protein affinity column chromatography and stored at 4 °C in 0.1 M Trisglycine buffer, pH 7.0, under sterile conditions.

Immunoblotting Analysis—Western blotting with anti-NPC1 polyclonal antibodies (DM105) was performed as follows. WT CHO cells were solubilized in lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Nonidet P-40, and protease inhibitors mixture (Sigma)) on ice for 30 min, followed by centrifugation at 13,000 rpm for 20 min at 4 °C. After adding (4x) SDS-loading buffer with 0.1 M dithiothreitol to the solubilized cell lysate, the samples were kept on ice until the SDS-PAGE analysis. Treating the samples in SDS at 37 or 60 °C caused a large loss in NPC1 signal in Western blotting (result not shown). The primary antibodies used were the affinity-purified IgG against the GST-NPC1 protein, at 0.8 µg/ml, in TBS, 0.3% Tween 20 buffer containing 1% skim milk. Western blotting with anti-NPC2 polyclonal antisera was performed essentially as described previously (7). Results of Western blots were quantified by using the NIH image (version 1.63). To normalize the values, the mean pixel intensities obtained with anti-NPC1 or with anti-NPC2 were divided by those obtained with anti-beta-actin.

Cell Lines and Procedures for Cell Culture Work—WT CHO cells were originally from the ATCC. 25RA cells were derived from the WT CHO cells; they are resistant to the cytotoxicity of 25-hydroxycholesterol (35) and contain a gain of function mutation in the sterol regulatory element-binding protein (SREBP) cleavage-activating protein (SCAP) (36). CT43 mutant cells were isolated as one of the cholesterol-trafficking mutants from mutagenized 25RA cells (37), containing a premature translational termination mutation near the 3'-end of the NPC1 coding sequence and producing a nonfunctional, truncated NPC1 protein (38). M19 cells were isolated from mutagenized WT CHO cells; these cells fail to respond to sterol-dependent regulation of HMG-CoA reductase and LDL receptors (39) because these cells contain a deletion mutation in site 2 protease that is required to cleave the SREBP into an active form (40). LEX1 cells are mutant CHO cells isolated from WT cells. LEX1 cells exhibit defects in fusion between the late endosomes and the lysosomes and are defective in the disintegration of LDL particles labeled with fluorescent phospholipids (41). The molecular lesion of the LEX1 cells is unknown. The LEX2 mutant cells were also isolated from WT CHO cells; they exhibit an arrested multivesicular body (MVB) and show defects in the transport of the cation-independent mannose 6-phosphate receptor from the MVB back to the trans-Golgi network (TGN). In addition, these mutant cells contain another defect in the transport of lysosomal proteins and apoB100 in LDL to the late endosomes (42). LEX2 cells contain a molecular lesion in the gene encoding NAD(P)H-dependent sterol dehydrogenase-like protein (NSDHL), an enzyme in the late stage of the cholesterol biosynthesis pathway. A stable transfectant of LEX2 cells that expresses an active NSDHL, called the LEX2LIB3 cell, has been reported (43). The expression of this enzyme resulted in the correction of the cholesterol biosynthesis defect in the LEX2 cells. In LEX2LIB3 cells, the transport of cation-independent mannose 6-phosphate receptor from the MVB to the TGN is normal, and the arrested MVB disappears. However, the defective processing of endocytosed LDL to the degradative compartment remains uncorrected, suggesting that in the LEX2LIB3 cells, there remains a defect in the late stage of the endocytic pathway (43). The LEX1 and LEX2 cells belong to different complementation groups. All of the CHO cells were maintained in Medium A (Ham's F-12 plus 10% FBS and 10 mg/ml gentamycin) as monolayers at 37 °C with 5% CO2. Medium A contains bovine LDL, which provides LDL-CHOL. Medium D refers to Ham's F-12 supplemented with 5% lipid-free FBS plus 35 mM oleic acid and 10 mg/ml gentamycin. Medium D lacks LDL-CHOL. Medium S refers to Medium D plus 50 µM lovastatin and 230 µM mevalonate. In cells grown in Medium S, the endo-CHOL synthesis rate is 99% inhibited (37). When Medium D or Medium S was used at lower temperatures (18 °C or lower), Ham's F-12 without sodium bicarbonate was used, and cells were placed in a water bath without CO2.

Assays to Monitor the Fate of [3H]Cholesteryl Linoleate in LDL—Cells were plated in Medium A in 6- or 12-well dishes, as described previously (38, 24), and were cultured for 36 h in Medium D to deplete stored cholesterol within the cell. Prior to labeling, cells were pre-chilled on ice, then labeled with 30 µg/ml [3H]CL-LDL in Medium D for 5 h at 18°C, washed once with cold PBS that contained 1% bovine serum albumin, and washed three more times with cold PBS. Cells were then fed with cold Medium D and placed in a water bath for the indicated chase time at 37 °C. At 18 °C, LDL was internalized and accumulated in pre-lysosomal compartments without significant hydrolysis of CL. When the temperature was increased to 37 °C, CL in LDL was rapidly hydrolyzed to become free cholesterol and transported to designated locations in a time-dependent manner (3). After the chase, the labeled cellular lipids were extracted and analyzed by TLC as described (37); the percent hydrolysis was calculated as [3H]cholesterol and [3H]cholesteryl oleate counts divided by the sum of [3H]cholesteryl linoleate, [3H]cholesterol, and [3H]cholesteryl oleate counts; the percent reesterification was calculated as [3H]cholesteryl oleate counts divided by the sum of [3H]cholesteryl linoleate, [3H]cholesterol, and [3H]cholesteryl oleate counts. Total uptake of LDL was calculated as the sum of [3H]cholesteryl linoleate, [3H]cholesterol, and [3H]cholesteryl oleate counts divided by the cellular protein amount. The protein amount was determined by the Bradford method using the assay reagent from Bio-Rad. For cholesterol efflux experiments, cells were incubated with 4% CD (as sterol acceptor) in Medium D in the presence of the ACAT inhibitor (2 µM F12511 [GenBank] ) (29) at 37 °C for 10 min. The labeled lipids were extracted and analyzed as described (37). The percent cholesterol efflux was calculated as [3H]cholesterol counts in the medium divided by the sum of [3H]cholesteryl linoleate counts in the cell and [3H]cholesterol counts in the cell and in the medium. In a control experiment, to test the efficacy of CD in removing PM-CHOL, we labeled the PM of intact cells with [3H]cholesterol at 4 °C (by using the [3H]cholesterol/liposome method (45)) and then treated the labeled cells with CD for 10 min at 37 °C. We found that CD removed 80-90% of the total cellular label (results not shown).

Assays to Monitor the Fate of PM-labeled Cholesterol—Prior to the experiment, cells were plated in 6- or 12-well dishes and were cultured for 36 h in Medium D to deplete stored cholesterol within the cell. The PM of intact cells was labeled with [3H]cholesterol by adding ethanolic stock solution of [3H]cholesterol (at 1 µCi/ml) to cells grown in Medium D at 37 °C; the final concentration of ethanol in the growth medium was 0.1%. After labeling for 12 h, the cells were washed and chased at 37 °C for 8 h. Afterward, the radiolabeled lipids were extracted and separated by TLC as described previously (38). The percent esterification was calculated as [3H]cholesteryl oleate counts divided by the sum of [3H]cholesterol and [3H]cholesteryl oleate counts. For cholesterol efflux experiments, after cells were labeled with [3H]cholesterol for 12 h as described above, and they were washed and chased in Medium D with ACAT inhibitor added (2 µM F12511 [GenBank] ) at 37 °C for 6 h and then incubated with 4% CD in Medium D with ACAT inhibitor added at 37 °C for 10 min. The percent cholesterol efflux was calculated as [3H]cholesterol counts in the medium divided by the sum of [3H]cholesterol counts in the cell and in the medium.

Percoll Gradient Analysis—The fractionation method was performed as described previously (3). Cells from one 150-mm dish were scraped into the homogenization buffer (0.25 M sucrose, 1 mM EDTA, 20 mM Tris, pH 7.4) and homogenized with 15 strokes using the stainless steel tissue grinder. To increase recovery, the pellet was resuspended in buffer and homogenized a second time. The combined post-nuclear supernatant from cells was loaded onto 11% Percoll and centrifuged (20,000 x g, 40 min) using Beckman model 70.1 Ti rotor. 10 fractions were collected from the top. More than 80% of the PM marker (Na+/K+-ATPase) was concentrated in fractions 1 and 3, whereas more than 80% of the late endosomal/lysosomal markers (Lamp1/Lamp2 and LysoTracker) was concentrated in fractions 9 and 10. The same fractionation method was used to analyze subcellular distribution of [3H]cholesterol and cholesterol mass after cells were labeled with [3H]acetate for 12-24 h. To analyze the cholesterol content after Percoll gradient centrifugation, the lipids present in each fraction were extracted with chloroform/methanol (2:1); the extracted lipid fractions were dried under N2; the [3H]cholesterol in each fraction was isolated and analyzed using the method of silica gel TLC (solvent system, petroleum ether/ether/acetic acid, 90:10:1) and scintillation counted according to the procedure previously employed (38, 24). For measuring cholesterol mass, aliquots from each Percoll fraction were loaded onto the 96-well plate and processed with a Wako cholesterol assay kit that measures free cholesterol only, according to the instruction manual.


Figure 1
View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 1.
A and B, time course study on the effect of inhibiting endo-CHOL synthesis on efflux of LDL-derived CHOL and on hydrolysis of [3H]CL in WT CHO cells. WT CHO cells were plated in 12-well dishes and grown in Medium D for 36 h (Med. D). For Med. S-2h, or -10h, or -16h samples, the cells were grown in Medium S instead of Medium D for the last 2, 6, or 16 h. Afterward, the cells were pulse-labeled with 30 µ g of [3H]CL-LDL in Medium D or in Medium S for 30 min at 37 °C, washed, and chased in Medium D or in Medium S for 1 h at 37°C. The cholesterol efflux measurement was performed by treating cells with 4% CD in Medium D or in Medium S for 10 min at 37 °C. The cellular cholesterol efflux and percent hydrolysis of [3H]CL-LDL was analyzed according to the procedures described previously (3). Error bars indicate sizes of 1 S.E. Results are representative of two independent experiments. C, effect of inhibiting endo-CHOL synthesis on cellular NPC1 and NPC2 protein levels. In parallel with the pulse and chase experiment described above, after incubation in Medium D for 36 h (lane 1), or in Medium D for 20 h, followed by Medium S for 16 h (lane 2), cells were lysed with 1% Nonidet P-40. The lysates were analyzed for NPC1 or NPC2 by Western blotting, using rabbit anti-hamster NPC1 polyclonal antibodies DM105 (top bands; 0.8 µg of IgG/ml), or rabbit anti-NPC2 polyclonal antisera (middle bands; 1:2000 dilution), or mouse anti-beta-actin (bottom bands; 1-50,000 dilution) as indicated. 400, 50, and 50 µg of the cell lysates were used for Western blot analyses of NPC1, NPC2, and beta-actin, respectively. The results were analyzed by densitometry and were reported by using values in cells grown in Medium D as 100%. Results are representative of two independent experiments.

 
Fluorescence Microscopy—Cells were grown on glass coverslips placed in 6-well plates or in 60-mm dishes and processed for fluorescence microscopy studies. For DiI-LDL labeling, cells were pre-chilled on ice and incubated with 30 µg/ml DiI-LDL in Medium D at 18 °C for 3 h. Cells were washed with cold PBS containing 1% bovine serum albumin and then three times with cold PBS, followed by chase in Medium D at 37 °C for the indicated times. Coverslips were kept at 4 °C until microscopic processing. The construct encoding mouse NPC1 protein fused with GFP was introduced to the cells by transient transfection using the method described previously (33). For LysoTracker labeling, LysoTracker Red DND 99 was added to the cells at final concentration of 50 nM in phenolfree Dulbecco's modified Eagle's medium at 37 °C for 90 min. During this period, the cells were maintained in a humidified incubator with 5% CO2. For immunostaining, cells were washed three times with PBS, fixed with 4% paraformaldehyde for 10 min at room temperature, washed three times again, and either permeabilized with methanol (chilled at -20 °C) for 1 min or with 0.2% saponin in PBS at room temperature for 10 min. When permeabilization by saponin was used, 0.1% saponin was included in all the buffers except in the washing buffer used during the last step. After three more washes, the cells were incubated with the blocking solution (10% goat serum in PBS) for 30 min at room temperature and then incubated with anti-Lam2 antibody (at 200-fold dilution) present in the blocking solution for 1 h. Cells were then washed with PBS three times, treated with various secondary Alexa Fluor IgGs, and then washed three more times. The coverslips were mounted with a drop of ProLong Anti-Fade media onto the glass slides before image processing. The samples were viewed and photographed in a Leica (Bannockburn, IL) TCS SP Laser scanning confocal microscope. The images were constructed and analyzed by Leica Confocal Software as described below.

Image Analysis—For each sample, quantification of staining was performed in 6-10 photographed confocal images, each image containing 10-20 cells. The entire cell surface of each cell on the DIC image was outlined, and the mean intensity of the fluorescent signal within each cell was calculated at a certain relative value using Leica confocal software. For analyzing the fluorescence signals in the perinuclear region versus the peripheral region, the entire cell surface and the surface of the nucleus of each cell were outlined on the DIC images. The signals located in areas within the top 1/3 toward the nucleus are considered as the signal in the perinuclear region, those covering the other 2/3 are considered as the signal in the peripheral region.


Figure 2
View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 2.
Effect of inhibiting endo-CHOL synthesis on trafficking of LDL-CHOL and PM-labeled cholesterol in various cells derived from CHO cells. WT, 25RA, and CT43 cells were plated in 12-well dishes and incubated in Medium D for 36 h. For Med. S samples, the cells were grown in Medium S instead of Medium D for the last 12 h. A-C, cells were pulsed with 30 µg/ml [3H]CL-LDL in Medium D or in Medium S at 18 °C for 5 h, washed, and chased in Medium D or Medium S. A, hydrolysis of LDL-derived cholesteryl ester. Cells were chased for 1-2 h as indicated before the hydrolysis was measured. B, reesterification of LDL-CHOL. Cells were chased for6h. C, efflux of LDL-CHOL to the PM. Cells were chased for 1-2 h as indicated and then treated with 4% CD at 37 °C for 10 min. D and E, cells were labeled with [3H]cholesterol at 37 °C for 12 h. D, esterification of PM-labeled cholesterol. E, % efflux of PM-labeled cholesterol. Details of various assay procedures are described under "Experimental Procedures." Values in A-E are the averages of duplicate dishes, and results are representative of two independent experiments, except for the results in C, which are representative of three independent experiments. Error bars indicate sizes of 1 S.E. The lovastatin and mevalonate treatment did not significantly affect the total uptake of LDL in cells (data not shown).

 
Assay to Monitor Late Endosomal Motility—The assay employed was essentially the same as described in Lebrand et al. (13). Cells were labeled with LysoTracker Red DND 99 according to the method described above, then viewed under the Zeiss LSM confocal microscope system to record time-serial images of the LysoTracker stained vesicles, at 1-s intervals for 25 s. For each cell type under each condition, 10 images were taken per cell; a total of 300 vesicles was measured and grouped into three distance sections as follows: (a) d <0.75 µm; (b) d between 0.75 and 1.5 µm; (c) d >1.5 µm. Other technical parameters used for the video microscopy were as follows: Plan-Apochromat x63/1.4 oil DIC, wavelength, 543 nm; scan mode, plan, time series; scan zoom, 3.5 pinhole, 56 µm (equal to 0.5 µm optical depth); average, 4 lines.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Characteristics of Various Specialized CHO Cell Lines Employed in This Study—We used WT CHO cells, 25RA cells, and CT43 cells for most of the experiments reported in this study. Previous work has shown that in terms of cellular cholesterol homeostasis, the WT CHO cells behave similar to human fibroblasts, although the 25RA cells behave similar to human macrophages (46, 47). The CT43 cells are derived from the 25RA cells and have served as a CHO cell model for the human mutant NPC1 cells. In some experiments, we also employed M19, LEX1, and LEX2 cells. M19 cells are mutant cells derived from the WT CHO cells and are severely deficient in endo-CHOL biosynthesis (39). Thus, M19 cells behave similar to lovastatin-treated WT cells. The LEX1 and LEX2 cells are also derived from the WT CHO cells. LEX1 cells contain a defect in producing mature lysosomes; they fail to transport the apoB in LDL and lysosomal marker proteins from the late endosomes to the lysosomes. LEX2 cells contain a mutation in the gene encoding NADH-dependent sterol dehydrogenase-like (NSDHL), an enzyme in the late stage of the cholesterol biosynthesis pathway (43). Various intermediate sterols, including lanosterol and 4,4-dimethylsterols, were shown to accumulate in the LEX2 cells (48). Stable transfectants of LEX2 cells, called LEX2LIB3 cells, express the wild-type NSDHL gene, and display normal cholesterol biosynthesis activity (48).

The Effect of Blocking endo-CHOL Synthesis on the Fates of LDL-derived Cholesterol and PM-labeled Cholesterol—To test the effect of blocking endo-CHOL synthesis, we first incubated the WT cells grown in Medium S (Medium D plus lovastatin and mevalonate) for various periods up to 16 h and compared them with cells grown in Medium D only, in terms of efflux of LDL-CHOL, hydrolysis of [3H]CL, and cellular NPC1/NPC2 protein contents. The results suggest that blocking endo-CHOL synthesis in WT CHO cells for 2 h or longer produced significant reduction in the efflux of LDL-CHOL (Fig. 1A) without significant reduction in the hydrolysis of [3H]CL (Fig. 1B) or in the cellular NPC1/NPC2 protein content levels (Fig. 1C).


Figure 3
View larger version (43K):
[in this window]
[in a new window]
  		FIGURE 3.
Trafficking of LDL-CHOL in LEX1 and LEX2 mutants. A-D, WT, LEX1, and LEX2 cells were pulsed with 30 µg/ml [3H]CL-LDL in Medium D at 18 °C for 5 h, washed, and chased at 37 °C for various times as indicated. A, total uptake of [3H]CL-LDL. Right after the pulse, total 3H counts present in the cells were measured per µg of cellular protein. Values are the averages of triplicate dishes and are representative of three independent experiments. B, hydrolysis of [3H]cholesteryl ester in LDL. Results are representative of four independent experiments. C, reesterification of LDL-derived [3H]cholesterol. Results are representative of two independent experiments. D, movement of LDL-derived [3H]cholesterol to the PM for efflux. Values in B-D are the averages of duplicate dishes. Results are representative of four independent experiments. E and F, WT, LEX1, LEX2, and LEX2LIB3 cells were grown and processed for the pulse-chase experiment with [3H]CL-LDL as described above. The chase times were 1, 2, or 8 has indicated. E, hydrolysis of LDL-derived cholesteryl esters. F, movement of LDL-derived [3H]cholesterol to the PM for efflux. Values are averages of duplicated dishes. Results are representative of two independent experiments. Error bars indicate sizes of 1 S.E.

 
We next incubated WT, 25RA, and CT43 cells grown in Medium S for 12 h, and we compared them with cells grown in Medium D only and performed the pulse-chase experiments with 30 µg/ml [3H]CL-LDL. The results suggest that blocking endo-CHOL biosynthesis does not inhibit the cholesteryl ester hydrolysis in any of the cells examined (Fig. 2A). In contrast, blocking endo-CHOL biosynthesis confers dramatic reduction on the reesterification of LDL-CHOL in WT cells and 25RA cells (Fig. 2B, 1st 4 bars). The result of the LDL-CHOL efflux study shows that blocking endo-CHOL biosynthesis moderately decreases the movement of LDL-CHOL to the PM in WT and 25RA cells (Fig. 2C, 1st 4 bars at 1-h chase time and 1st 4 bars at 2-h chase time). We have shown previously that, relative to 25RA cells, CT43 cells are defective in reesterification of LDL-CHOL and in the movement of LDL-CHOL to the PM (38). Blocking endo-CHOL biosynthesis caused a further decrease in the reesterification and in the percent efflux of LDL-CHOL in CT43 cells (Fig. 2, B and C, last two bars). Along with the results shown in Fig. 1C, these results suggest that the effect of blocking endo-CHOL synthesis on LDL-CHOL movement is independent of NPC1 action. In results not shown, we found that blocking endo-CHOL synthesis did not significantly alter the total uptake of [3H]CL-LDL in WT, 25RA, or CT43 cells (data not shown). The above results suggest that blocking endo-CHOL synthesis in WT cells or in 25RA cells interferes with the normal trafficking of LDL-CHOL in a manner that mimics the trafficking defect of LDL-CHOL seen in the mutant NPC1 cells. We have shown previously that the internalization of PM-labeled CHOL to the ER for esterification partially depends on the NPC1 present in the late endosomes (38, 47). Thus, we set out to test the possibility that blocking endo-CHOL biosynthesis may also inhibit the internalization of PM-labeled CHOL in WT, 25RA, and CT43 cells. The results suggest that in cells depleted with endo-CHOL, the esterification of PM-CHOL was greatly reduced (Fig. 2D, 1st 4 bars), whereas the percent efflux of PM-labeled CHOL toward CD (as the cholesterol acceptor in medium) was significantly increased in WT and 25RA cells (Fig. 2E, 1st 4 bars). Additional results show that the CT43 cells exhibit greater CHOL efflux than the 25RA cells; treating CT43 cells with lovastatin/mevalonate caused a modest further increase in sterol efflux (Fig. 2E, last 2 bars). These results further support the notion that the effect of blocking endo-CHOL synthesis on LDL-CHOL movement is independent of NPC1 action. Together, these results suggest that blocking endo-CHOL synthesis in WT and 25RA cells interferes with the trafficking of LDL-CHOL and PM-labeled CHOL but in a manner independent of NPC1 action. Close examination of the results presented in Fig. 2 reveals that, in general, the magnitude of changes caused by endo-CHOL depletion is smaller in 25RA cells than in WT cells. When grown under steady state, 25RA cells exhibit a higher sterol synthesis rate and take up more LDL from the growth medium, causing these cells to contain much more cholesterol than WT cells (30). The higher cellular cholesterol content in 25RA cells is expected to diminish/neutralize the effect created by blocking endo-CHOL synthesis.


Figure 4
View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 4.
The effect of inhibiting endo-CHOL synthesis on the cellular distribution of cholesterol mass and on newly synthesized sterols derived from [3H]acetate. A, to analyze [3H]CHOL from [3H]acetate WT and 25RA cells were plated in 100-mm dishes and grown in Medium A for 24 h and then switched to Medium D for 36 h. Afterward, cells were treated with [3H]acetate in Medium D for 24 h or with [3H]acetate in Medium D for 7 h followed by Medium S for 17 h. The [3H]acetate was used at 20 µl/4 ml of medium/dish. Cells were then harvested, homogenized, and fractionated with 11% Percoll gradient. Each Percoll fraction was subjected to lipid analysis for [3H]cholesterol (reported as dpm per fraction) as described under "Experimental Procedures." The result shown is one of two separate experiments with similar results. B, to analyze CHOL mass, WT and 25RA cells were plated and grown in Medium D for 36 h in the same manner described above. Afterward, the cells were grown either in Medium D for 24 h or in Medium D for 7 h followed by Medium S for 17 h. Cells were then harvested, homogenized, and fractionated with 11% Percoll gradient. Each Percoll fraction was subjected to lipid analysis for cholesterol mass (reported as µg per fraction) as described under "Experimental Procedures." The result shown is one of two separate experiments with similar results.

 
The Effect of Blocking endo-CHOL Synthesis Versus the Effect of Accumulating Biosynthetic Precursor Sterols in Influencing the Fate of [3H]CL-LDL—To examine the specificity of the effect of blocking endo-CHOL synthesis, we compared the uptake, hydrolysis, percent reesterification, and percent efflux to CD of [3H]CL-LDL in WT cells and LEX1 and LEX2 mutant cells. The result showed that the total uptake of LDL is slightly higher in WT cells than in LEX1 or LEX2 cells, but the difference is less than 30% (Fig. 3A). The LEX1 cells only show a slight defect in CL hydrolysis but only during early time points (Fig. 3B). They also show a slight defect in the efflux of LDL-CHOL from the PM during earlier time points (Fig. 3D). The reesterification rate of LDL-CHOL is actually higher in LEX1 cells than that in WT cells (Fig. 3C). The LEX1 cells contain normal late endosomes, but do not produce mature lysosomes, and are seriously defective in lysosomal degradation of the apoB protein moiety in LDL (41). This result suggests that upon reaching the late endosomes, the LDL-CHOL is transported from the late endosomes to the ER and/or to the PM without the need for the mature lysosomes, i.e. the lysosomes do not play a substantial role in the endocytic transport of LDL-CHOL. Results of parallel experiments revealed that in the LEX2 mutant cells, the hydrolysis of cholesteryl esters in LDL was seriously defective (Fig. 3B). The subsequent transport of [3H]LDL-CHOL to the ER for reesterification, and to the PM for efflux, was also seriously defective in these cells (Fig. 3, C and D). LEX2 cells lack functional NSDHL, a key late enzyme in the cholesterol biosynthetic pathway. In a separate experiment, we compared the hydrolysis and the percent efflux of [3H]CL-LDL in WT, LEX1, LEX2, and LEX2LIB3 (which express a functional gene for NSDHL) cells. The results (Fig. 3, E and F) show that the defects in [3H]CL hydrolysis and in [3H]LDL-CHOL transport to the PM are completely corrected in the LEX2LIB3 cells. Previously, it was shown that when grown in Medium D, the LEX2 cells accumulate biosynthetic precursor sterols and that this defect is corrected in the LEX2LIB3 cells (48). Taken together, the results in Figs. 2 and 3 suggest that blocking endo-CHOL synthesis affects the trafficking of LDL-derived CHOL at the late endosomal stage without affecting the hydrolysis of the [3H]CL in LDL, whereas the accumulation of biosynthetic precursor sterols severely affects the hydrolysis of the [3H]CL in LDL.

The Effect of Blocking endo-CHOL Synthesis on the Cholesterol Content of Various Cellular Organelles—The findings described above suggest that blocking endo-CHOL synthesis in cells significantly affects the ability of the late endosomes to distribute LDL-CHOL. We suspect that blocking endo-CHOL synthesis may act by depleting the cholesterol content in late endosomes/lysosomes. To examine this possibility, we fed the WT and 25RA cells with [3H]acetate (the obligatory precursor for biosynthetic cholesterol) for 24 h. During the last 17 h of the labeling period, the cells were treated with or without lovastatin and mevalonate. Afterward, we prepared the cell homogenates, separated them into 10 fractions by Percoll gradient centrifugation, and then examined the [3H]CHOL in these fractions. Despite limited clear separations for various subcellular organelles, the Percoll fractionation procedure enriches the PM and early endosomes as the light-density fractions (fractions 1-3), the late endosomes/lysosomes as the heavy-density fractions (fractions 8-10), and other organelles (Golgi, ER, etc.) as intermediate-density fractions; this method has been employed as a biochemical means to monitor the fate of LDL-CHOL and labeled CHOL biosynthesized de novo (3, 22, 24, 38). In a separate experiment, to measure cholesterol by mass, we performed the same set of experiments but with cells that had not been exposed to [3H]acetate. The results showed that when the [3H]CHOL (biosynthesized de novo) was measured, blocking endo-CHOL synthesis for the last 17 h caused a significant decrease in the amount of [3H]CHOL present in each of the 10 fractions (Fig. 4A); similar results were obtained when either WT or 25RA cells were used as the cell source. When the cholesterol mass was measured, the results show that blocking endo-CHOL synthesis did not cause an extensive decrease in the total cholesterol content in any of the fractions in WT cells or in 25RA cells (Fig. 4B). Collectively, these results suggest that, in 17 h, endo-CHOL has been distributed to various subcellular organelles; however, the absolute amount of endo-CHOL biosynthesized within 17 h represent small fractions of the overall cholesterol contents in these organelles.

The Fate of DiI-LDL and [3H]CL-LDL in Cells Lacking endo-CHOL Synthesis, as Monitored by Percoll Gradient Centrifugation and Fluorescence Microscopy—Previous work shows that in mutant NPC1 cells, LDL-CHOL accumulates in the aberrant late endosomes/lysosomes. This abnormality was demonstrated by performing Percoll gradient centrifugation analysis of cell homogenates, after loading cells with LDL. Here we used the same technique to monitor the fate of LDL-CHOL in WT or 25RA cells grown in Medium D or in Medium S. For labeling, we pulsed cells with [3H]CL-LDL for 5 h at 18 °C and chased for 2 h at 37 °C. The results show that in both WT and 25RA cells grown in Medium S, the amount of [3H]cholesterol is slightly decreased in the light fractions (fractions 1-3) and is increased in the heavy fractions (fractions 8-10) (Fig. 5). Because the differences seen between the Medium D grown cells and the Medium S grown cells are not large, we performed the twotailed Student's t test and obtained the following p values: for 25RA cell fractions 1-3, 0.03; for 25RA cell fractions 8-10, 0.05; for WT cell fractions 1-3, 0.01; and for WT cell fractions 8-10, 0.03. We consider a p value of 0.05 or less to be significant. Thus, this analysis shows that the differences seen between the values in Medium D and Medium S are statistically significant. The same finding was obtained in a separate experiment, when the WT and 25RA cells were pulsed under the same condition but chased at 37 °C for 1 h only (data not shown). These results suggest that in lovastatin-treated WT or 25RA cells, the exit of LDL-CHOL from the late endosomes is partially delayed.

DiI-LDLs are LDLs labeled with DiI, which is a lipophilic, membrane-impermeant fluorescent dye (1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine). Previous work showed that DiI-LDLs undergo the same endocytic, degradative process as normal, unlabeled LDLs; afterward, DiI remain trapped within the subcellular organelles that deposited/degraded the DiI-LDL (49). To visualize the trafficking of LDL in intact cells by microscopic means, we labeled 25RA cells grown in Medium D or in Medium S at 18 °C with DiI-LDL, chased the cells at 37 °C for 0, 30, or 120 min, and observed and recorded them under fluorescence microscopy. DiI-LDL initially showed the peripheral distribution at 0 min of chase, suggesting that it may accumulate in the pre-lysosomal compartment at 18 °C (Fig. 6A); at 30 min of chase, much of the fluorescence became perinuclear (Fig. 6B). The relative signal intensities were analyzed by performing image analysis and are tabulated in the right panels of Fig. 6. At the 0- and 30-min chase times, the fluorescence intensities between cells under the Medium D and S conditions were similar. The difference became greater when cells were chased for 60 min (data not shown) or for 120 min (Fig. 6C). This result suggests that the endocytic processing of DiI-LDL is sluggish in cells deprived of endo-CHOL synthesis. These results together with the result shown in Fig. 5 support the concept that endo-CHOL synthesis plays important role(s) in maintaining proper functions of the late endosomes/lysosomes.


Figure 5
View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 5.
Effect of inhibiting endo-CHOL synthesis on cellular distribution of LDL-derived [3H]cholesterol. After growing in either Medium D or Medium S, WT and 25RA cells were pulse-labeled with [3H]CL-LDL for 5 h at 18 °C and chased for 2 h at 37°C.The cell homogenates were prepared and subjected to Percoll gradient analysis. [3H]Cholesterol in each Percoll fraction was analyzed according to the procedures described under "Experimental Procedures." To control variation in total 3H counts recovered from different samples, the values reported within each cell type were normalized such that the sum of counts in cellular cholesterol and cholesteryl linoleate in each sample was the same. A, distribution of [3H]cholesterol in WT cells. B, distribution of [3H]cholesterol in 25RA cells. Results shown are representative of two independent experiments. In results not shown here, the majority of [3H]cholesteryl linoleate that remained unhydrolyzed was located in the light fractions 1-3 in both cell lines.

 
Localization of the Niemann-Pick Type C1 Protein and Distribution of Late Endosomes/Lysosomes in Intact Cells Lacking endo-CHOL Synthesis—The NPC1 protein is involved in transporting cholesterol (and perhaps other lipids) from the late endosomes/lysosomes. It is possible that blocking endo-CHOL synthesis may cause the mislocalization(s) of the NPC1 protein from the late endosomes/lysosomes. To test this hypothesis, we expressed the NPC1-GFP fusion protein (NPC1-GFP) by transient transfection in various cell lines as indicated, then fixed and immunostained these cells with an antibody against the late endosomal/lysosomal marker Lamp-2 protein, and viewed the fixed cells under confocal microscopy. Previous work showed that the NPC1-GFP fusion protein introduced to various mammalian cells is biologically active and displays a late endosomes/lysosomes localization pattern (7, 33). Fig. 7A shows the fluorescence images of 25RA cells grown in either Medium D or Medium S or those of WT and M19 cells grown in Medium D. M19 cells are mutant cells severely deficient in endo-CHOL biosynthesis. Thus, M19 cells behave similar to WT cells deprived of endo-CHOL synthesis. The results show that the NPC1-GFP signals extensively colocalize with the Lamp-2 signals (more than 80%) in all of these cells examined. Thus, in cells deprived of endo-CHOL synthesis, the NPC1-GFP remains mainly in the late endosomes/lysosomes, We did note that in the 25RA and WT cells grown in Medium D, both the NPC1-GFP and the Lamp-2 signals mainly localized in the perinuclear region, which is characteristic of the normal cellular distribution pattern of the late endosomes/lysosomes. In contrast, in 25RA cells grown in Medium S, a significant percentage of the NPC1-GFP/Lamp2 signals were shifted to the peripheral region. Similarly, in M19 cells grown in Medium D, the majority of the NPC1-GFP/Lamp2 signal was found to be at the peripheral region, in contrast to the perinuclear distribution found in WT cells grown in the same medium. The perinuclear/peripheral distribution of the Lamp-2 signal, in various cells under Medium D or Medium S conditions, are measured semiquantitatively and are presented in Fig. 7B. The results show that deprivation of endo-CHOL synthesis alters the cellular distribution of the late endosomes/lysosomes from a mainly perinuclear pattern to a mainly peripheral pattern. In results not shown, we stained live cells with the fluorescent dye LysoTracker, which specifically stains late endosomes and lysosomes, to monitor the effect of blocking endo-CHOL synthesis on cellular distribution of the late endosomes/lysosomes, and we have obtained the same results as shown in Fig. 7.


Figure 6
View larger version (73K):
[in this window]
[in a new window]
  		FIGURE 6.
Effect of inhibiting endo-CHOL synthesis on intensity of DiI in DiI-LDL. 25RA cells were grown in Medium D for 24 h and then in Medium D (left images) or Medium S (middle images) for 12 h. Cells were labeled with 30 µg/ml DiI-LDL for 3 h at 18°C and chased at 37 °C in the same medium for 0 (A), 30 (B), or 120 (C) min at 37 °C. The samples were then viewed under a confocal laser scanning microscope. The graphs to the right of each set of images indicate the mean fluorescence intensity value in each cell, using the method described under "Experimental Procedures" under "Image Analysis." For each sample, at least 80 cells covered in more than five fluorescence images were analyzed.

 


Figure 7
View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 7.
Effect of inhibiting endo-CHOL synthesis on localization pattern of NPC1 and Lamp-2. A, 25RA (top and 2nd rows), WT (3rd row), and M19 (bottom row) cells transiently transfected with NPC1-GFP, grown in Medium D (top, 3rd and bottom rows) for 40 h or in Medium S for the last 16 h (2nd row). Afterward, cells were fixed, immunostained with anti-Lamp2 antibody and the secondary anti-mouse Alexa 568 IgGs, and then viewed under a confocal laser scanning microscope. Control experiment showed that with the Lamp2 antibody the secondary fluorescence IgG alone did not give any fluorescent signal (data not shown). NPC1-GFP signals (far left column) and Lamp-2 staining signals (2nd column from left) were merged to produce the image shown in the far right column. DIC images are shown in the 2nd column from right. Note that not all cells are positive for NPC1-GFP expression. B, distribution of signal in perinuclear versus peripheral regions of cells grown in Medium D or Medium S. The top graph quantifies the distribution of the LAMP-2 signal in 25RA cells grown in Medium D or in Medium S. The bottom graph quantifies the distribution of the signal in WT and M19 cells grown in Medium D. For each sample, at least 100 cells, covered by more than six fluorescence images, were analyzed. The method for analyzing the signals in the peripheral versus the perinuclear regions was as described under "Experimental Procedures." The analysis of the NPC1-GFP signal distribution in the cells shown in A yielded very similar results as the LAMP-2 signal distribution (results not shown).

 
We next performed a time course study to monitor the change in late endo/lysosomal localization patterns in WT cells after adding lovastatin/mevalonate. The result (Fig. 8A) shows that adding lovastatin/mevalonate for 2 h or longer produces significant alterations in the late endo/lysosomal localization pattern, in a time-dependent manner. We also performed a time course study on the effect of adding LDL to revert the abnormal late endo/lysosomal localization pattern caused by lovastatin/mevalonate. The result (Fig. 8B) shows that adding LDL for 2 h or longer significantly reverts the abnormal late endo/lysosomal localization pattern, in a time-dependent manner. Together, these results support the interpretation that the effect of lovastatin/mevalonate on late endo/lysosomal function occurs within a couple of hours. Because adding LDL can reverse the effect of lovastatin/mevalonate, the effect of lovastatin/mevalonate is to deplete endo-CHOL synthesis and not to deplete other mevalonate-derived nonsterol metabolite(s). Earlier, we have shown that adding lovastatin/mevalonate significantly reduces the ability of the cells to mediate the efflux of LDL-derived CHOL (Fig. 1). We tested if adding LDL or adding cholesterol for longer times (4 h) can neutralize the effect of lovastatin/mevalonate. The result (Fig. 9) shows that cells grown in Medium S for 16 h exhibit much lower efflux of LDL-CHOL than cells grown in Medium D. Incubation of Medium S-grown cells with LDL or with cholesterol for 4 h partially but significantly restored the ability of these cells in efflux of LDL-CHOL. These results further support the interpretation that the effect of adding lovastatin/mevalonate is mainly to deplete endo-CHOL.


Figure 8
View larger version (40K):
[in this window]
[in a new window]
  		FIGURE 8.
A, time course study on the effect of lovastatin/mevalonate in altering the late endo/lysosomal localization pattern. The WT CHO cells were plated in 6-well dishes, grown in Medium D for 36 h, and then treated with or without lovastatin and mevalonate for 0, 2, 6, or 10 h as indicated. The antibodies against Lamp-2 were used to monitor the distribution of late endo/lysosomes as described in Fig. 6. The results shown are typical of two independent experiments. B, time course study on the effect of adding LDL on reversing the abnormal late endo/lysosomal localization pattern in endo-CHOL-depleted CHO cells. WT cells grown in Medium D were treated with lovastatin and mevalonate for 12 h. Cntl. indicates no treatment. LDL (30 µg/ml) was added for 2, 4, or6has indicated. The late endo/lysosomal localization patterns were monitored by using antibodies against Lamp-2. The results shown are typical of two separate experiments.

 
Motility of the Late Endosomes/Lysosomes in Cells Deprived of endo-CHOL Synthesis—In NPC-like cells with abnormal cholesterol accumulation, the late endosomes exhibit a peripheral location pattern and become relatively immobile (13). Because we have shown that cells deprived of endo-CHOL synthesis exhibit a peripheral late endosomes/lysosomes location pattern, the mobility of the late endosomes/lysosomes in these cells may be reduced. To test this possibility, we stained live WT cells grown under various conditions with LysoTracker, and we monitored the stained particles under time-lapse video microscopy. As expected, numerous LysoTracker-stained vesicles and tubules were present, and they exhibited linear, long distance, bi-directional, and saltatory motion between the cell periphery and the perinuclear region. The movement patterns of the LysoTracker-stained elements that we observed were very similar to what had been described previously as the movement patterns of the late endocytic compartment in HeLa cells by Lebrand et al. (13). In experiments not shown, we labeled the late endosomal compartment by expressing the NPC1-GFP in WT cells, and we observed essentially the same movement patterns as those of the LysoTracker-labeled vesicles and tubules (results not shown). We used the method described by Lebrand et al. (13) to estimate the motility of the LysoTracker-stained particles; the distances between the initial position (Fig. 10A marked in green) and the final position (marked in red) of each stained vesicle over a total time period of 25 s were recorded using the SLM 5 Image Browser; the representative images are shown in Fig. 10A. We quantitated the labeled vesicular particles that traveled more than 1.5 µm in 25 s in each cell and treated them as the mobile elements. The results are shown in Fig. 10B, right section. We also recorded those particles that exhibited Brownian-type motion only (i.e. those that remained confined within 0.75 µm of their initial position after 25 s). The results are shown in Fig. 10B, left section. For those particles that traveled between 0.75 and 1.5 µm, it is difficult to determine whether they are due to long distance, bidirectional movement, or due to Brownian-type motion (13). They are quantitated separately and presented as the middle section in Fig. 10B. The changes of numbers in the slow moving particles in response to cellular cholesterol content are less reliable, because of the large and nonmobile background values. The quantitations of these slower moving particles (Fig. 10B, left section and middle section) are also recorded. The results shown in the right section of Fig. 10B, reporting the fast moving particles, demonstrate that cells grown in Medium D contained higher numbers of mobile endosomal elements than those grown in Medium A (Medium A contains 10% fetal bovine serum and is rich in cholesterol bound to lipoproteins); this number was considerably decreased when the cells were grown in Medium S. Additional results showed that the inhibitory effect by lovastatin/mevalonate is reversible, because adding LDL to these cells caused them to increase the number of mobile elements in a time-dependent manner. In experiments not shown, similar observations were made when 25RA cells were used to perform the same type of experiments, although the magnitude of the changes observed in the 25RA cells was relatively smaller than that observed in the WT cells. Because the differences in mobility observed were not large, we performed statistical analyses of the data, using one-way analysis of variance. For simplicity, we combined Medium S plus LDL for the 2-h data and the 12-h data as a single group. The results show that for the <0.75-µm vesicles, the p value for the differences seen between Media A, D, S, and S plus LDL grown cells is below 10-10; for the 0.75-1.5 µm vesicles, the p value is below 10-5; for the >1.5 µm vesicles, the p value is below 10-9. Thus, for the short, intermediate, and long distance moving vesicles, the differences in mobility observed between Media A, D, S, and S plus LDL grown cells are all statistically significant.


Figure 9
View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 9.
Effect of adding LDL or adding cholesterol on efflux of LDL-derived CHOL in lovastatin/mevalonate-treated cells. WT CHO cells were grown in Medium D for 32 h, then were grown in Medium D for 16 h (Med. D), or in Medium S for 12 h, followed by4hof incubation in Medium S without cholesterol (Med. S), or with 30 µg/ml LDL, or with 30 µg/ml cholesterol added from stock ethanolic solution (cholesterol). The media used for the 4-h incubation period all contained 0.6% ethanol. Afterward, the cells were pulse-labeled with 30 µ g of [3H]CL-LDL in for 30 min at 37 °C, washed, and chased for 1 h at 37 °C, followed by efflux measurement with 4% CD for 10 min at 37 °C. The compositions of media used for the pulse-chase experiment and for the CD-mediated cholesterol efflux experiment were the same as the ones used before the pulse-chase experiment. The percent cholesterol efflux and percent hydrolysis of [3H]CL were analyzed according to the procedures described previously (3). Error bars indicate sizes of 1 S.E. Results are representative of two independent experiments.

 
Rab proteins, a family of small GTPases involved in various membrane trafficking events, in part control the endosomal motility (34, 50). In mutant NPC1 cells, overexpressing the wild-type Rab9 causes significant dissipation of the abnormal cholesterol accumulation (34, 50). It is possible that overexpressing Rab9 may increase the endosomal motility in cells deprived of endo-CHOL synthesis. To test this possibility, we overexpressed the Rab9-YFP fusion protein by transient transfection in WT cells and then estimated the number of mobile endo/lysosomal particles in cells deprived of endo-CHOL synthesis. The results (Fig. 10C, left panel) show that overexpressing Rab9-YFP does not rescue the inhibitory effect of endo-CHOL deprivation on endosomal motility. The result of the control experiment shows that overexpressing Rab9-YFP in the mutant NPC1 cells (i.e. CT43 cells) does increase the endosomal mobility in these cells grown under cholesterol-loaded conditions (Fig. 10C, right panel).We performed statistical analyses of the data shown in Fig. 10C by using Student's t test. The results show that for the WT cells, the mobility difference with or without Rab9 overexpression is statistically insignificant (the p values are 0.16 for the d <0.75-µm, 0.72 for the 0.75-1.5-µm, and 0.06 for the d >1.5-µm vesicles). In contrast, for the CT43 cells, the mobility difference with or without Rab9 is statistically significant (p values are 0.004 for the d <0.75-µm, 0.02 for the 0.75-1.5-µm, and 0.003 for the d >1.5-µm vesicles).


Figure 10
View larger version (44K):
[in this window]
[in a new window]
  		FIGURE 10.
Effect of inhibiting endo-CHOL synthesis on endosomal motility. A and B, WT cells were plated at 105 cells per well, grown in Medium A for 24 h on 8-well chambered cover glass, and then grown under each of the following five conditions as indicated: A) Medium A for 60 h; B) Medium D for 60 h; C) Medium D for 48 h followed by Medium S for 12 h. D) Cells were grown under condition 3, and LDL (30 µg/ml) was then added and cells were incubated for 2 more h. E) Cells were grown under condition 3, and LDL (30 µg/ml) was then added, and cells were incubated for 12 h. Afterward, all the cells were labeled with LysoTracker Red DND 99, and the late endosomal motility in cells was measured according to the method described under "Experimental Procedures." The movements of LysoTracker-stained vesicles were grouped into three distance (d) sections as follows: (a) d <0.75 µm; (b) d between 0.75 and 1.5 µm; (c) d >1.5 µm. Representative images are shown in A. The initial positions of the mobile elements are shown in green; their positions after 25 s are shown in red; the immobile elements (aggregated as large vacuoles) are shown in yellow. Boxes indicate the travel paths of selected elements in 25 s. Numbers of vesicles in each distance section were presented as percentage of total vesicles measured; the results were tabulated as three separate sections in B. Results shown are representative of two separate experiments. C, the effect of overexpressing Rab9-YFP in CT43 cells grown in medium A and in WT cells grown in Medium S. WT and CT43 cells were grown in Medium S or Medium A, respectively, on 8-well chambered cover glass for 2 days and then were transfected with Rab9-YFP (indicated as Rab9(+)) or were mock-transfected (indicated as Rab9(-)). For WT cells, 24 h after transfection, cells were grown in Medium D for 36 h, switched to Medium S for 12 h, and then labeled with LysoTracker. For CT43 cells, 24 h after transfection, cells were grown in Medium A for 2 days and then labeled with LysoTracker. The method used for motility study was the same as described in A and B. Results shown are representative of two separate experiments.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Late endosomes are important organelles involved in various membrane trafficking events. Previous studies have demonstrated effects of cholesterol at various stages of endocytosis (43, 51-56). However, these studies did not specifically demonstrate whether depleting cholesterol content would affect the motility and cholesterol trafficking activities of the late endosomes. Previous studies have demonstrated that newly synthesized endo-CHOL is rapidly transported to the caveolae/lipid raft microdomain of the PM within 10-20 min (18-21). At the PM, endo-CHOL may recycle rapidly (within minutes) between the PM and the recycling endosomes (23). In mutant NPC1 cells, 8 h or longer after its initial synthesis, a certain portion of endo-CHOL is significantly trapped within the late endosomes; the degree of entrapment occurs in a cell type-dependent manner (47). These studies implicate that endo-CHOL moves to the late endosomal compartment within 8 h after its synthesis. In this work, we show that depleting endogenous cholesterol synthesis for 2-3 h causes the late endo/lysosomes to begin to malfunction. Feeding cells with LDL can rescue the malfunction of the late endo/ly-sosomes caused by endo-CHOL depletion. Thus, based on functional criteria, within 2-3 h after its biosynthesis, endo-CHOL reaches the late endo/lysosomal compartment and plays important role(s) in controlling the motility and its cholesterol trafficking activities. In Fig. 11, we draw a model to highlight the new information regarding the trafficking route of endo-CHOL, contrasting the trafficking route of LDL-CHOL in mammalian cells.

Our results imply that a small but significant reduction in endosomal motility can cause them to mislocalize within the cells. How can a small change seen in endosomal motility significantly impact their functions? The endosomal motility measurement was done in 25 s. In this period, only 10% of the late endo/lysosomes are mobile; the rest are not mobile and only exhibit Brownian motions. Within a few minutes, all of the late endosomes are engaged in long distance, bidirectional movements (13, 14). The kinetic experiments described in this work suggest the following scenario: the decrease in endosomal motility alters the localization pattern of the late endosomes (from being mostly perinuclear to being mostly peripheral) and adversely impacts the functions of the late endo/lysosomes in terms of their cholesterol trafficking activities. This interpretation is consistent with the previous results by Lebrand et al. (13), who showed that abnormal cholesterol loading in the late endosomes/lysosomes of NPC-like cells causes a small but significant decrease in endosomal motility and mislocalization. Lebrand et al. (13) proposed that diminishing the late endosomal motility is the major cause for slowing down the ability of the late endosomes in membrane trafficking. In this work, we show that depleting the cellular cholesterol content can also cause a small but significant decrease in endosomal motility and in intracellular cholesterol trafficking activities. Thus, our current results support the concept that late endosomal motility plays a key role in controlling endosome-mediated cholesterol trafficking events.


Figure 11
View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 11.
Model describing the early trafficking route of newly synthesized endo-CHOL, contrasting the trafficking route of LDL-CHOL. Light yellow circles represent cholesterol molecules. This model is an extension and revision of the earlier models drawn previously (3, 24). See Introduction and "Discussion" for details. Abbreviations used in the figure are as follows: ACAT1, acyl-coenzyme A:cholesterol acyltransferase 1; AL, acid lipase; CEH, cholesteryl ester hydrolase; EE, early endosomes; ERC, endocytic recycling compartment; and LE, late endosomes, Dotted lines represent cholesterol trafficking routes not yet established.

 
There are two cholesterol-related causes for reducing the motility of the late endosomes in cells. The first cause is the accumulation of endosomal LDL-CHOL. This can occur through mutations in NPC1 or NPC2, through Lamp1/Lamp2 deficiency, or by treating cells with various drugs (8). Late endosomes contain Rab7 and Rab9. Rab7 interacts more with earlier endosomes and lysosomes; Rab9 interacts more with the transGolgi (15). Cholesterol accumulation in late endosomes leads to the inhibition of Rab7, which in turn reduces the motility of the late endosomes (13); overexpressing Rab9 can overcome the cholesterol accumulation defect in mutant NPC1 cells (34, 50). A second cholesterol-related cause of reduced endosomal motility is endo-CHOL deficiency, as demonstrated in this study. We show that overexpressing the Rab9-YFP does not overcome the reduced endosomal motility caused by endo-CHOL deficiency. Therefore, the effect of endo-CHOL deficiency on endosomal motility may not be related to the function of Rab9. We also show that depleting endo-CHOL in CT43 cells, i.e. cells lacking a functional NPC1, causes further decrease in cholesterol trafficking activities in these cells (Fig. 2). Thus, the effect of endo-CHOL depletion on endosomal motility is probably unrelated to NPC1. Hao et al. (56) have shown that cellular cholesterol content modulates the membrane properties of the late endosomes. Thus, it is possible that endo-CHOL may be required to maintain the proper lipid composition and/or the shape of the limiting membranes of the late endosomes, such that the late endosomes can interact properly with the microtubules, to participate in various membrane trafficking activities. Other possibilities cannot be excluded at present.

This work shows that in cells lacking endo-CHOL synthesis, LDL-CHOL transiently accumulates in the late endosomes/lysosomes. However, incubating the endo-CHOL-depleted cells with LDL for 4 h can rescue the abnormality of the late endo/lysosomes. We rationalize these findings based on the fact that the initial fates and the trafficking routes for LDL-CHOL and endo-CHOL differ from each other. Within 2-3 h after synthesis, endo-CHOL may constitute a small but important cholesterol pool that may rapidly travel through certain membrane microdomain(s) within the endosomal system; this microdomain is not immediately accessible to LDL-CHOL. This interpretation is supported by the fact that in cells depleted with endo-CHOL synthesis, the pool of newly synthesized cholesterol becomes markedly deficient in various cellular organelles, although their total cholesterol pool does not significantly decrease (Fig. 4). The late endo/lysosomes lacking endo-CHOL are functionally deficient in distributing/sorting LDL-CHOL and become relatively immobile. The impairment in late endosomal motility can be rescued by adding LDL, but only in a time-dependent manner (Figs. 8B, 9, and 10), suggesting that with time the LDL-CHOL can eventually reach the membrane microdomain deficient in endo-CHOL.

These observations suggest that endo-CHOL and LDL-CHOL may exist as two different, nonequilibrating pools within the same late endosomes. This hypothesis is consistent with the fact that late endosomes are multivesicular. In vitro studies showed that upon repeated freezing and thawing of the purified late endosomes, the limiting membranes can be separated from the internal membranes and exhibit distinct protein and lipid compositions (57). In the future, it would be interesting to examine whether these membrane fractions differ in their cholesterol contents. Because blocking endo-CHOL synthesis leads to a significant decrease in the endo-CHOL pool in various cellular fractions, endo-CHOL may also affect the functional/structural integrity of other endosomal compartment(s). These possibilities can also be explored in the future.

We also compared the fate of [3H]CL-LDL in WT cells and LEX1 cells, and we showed that late endosomes, but not lysosomes, play important roles in the trafficking and the distribution of LDL-CHOL. Other results showed that although the endosomal cholesteryl ester hydrolysis step is normal in cells lacking endo-CHOL synthesis, this step is severely defective in LEX2 cells that accumulate biosynthetic precursor sterols (Fig. 3). In NPC1 cells, the accumulation of cholesterol does not significantly inhibit the hydrolysis of [3H]cholesteryl esters in LDL (22, 38). Thus, the accumulation of biosynthetic precursor sterols in endocytic vesicles may cause undesirable effects in a way that is distinct from the effect caused by accumulation of cholesterol. This interpretation is consistent with the work of Heese-Peck et al. (54) who showed that in budding yeast sterols with different structural types affect the endocytic pathway in different manners.

Although we have only used cells derived from CHO cells for this study, we believe that our findings will be relevant to other cell types, because various mammalian cells continue to synthesize endo-CHOL despite the fact that they also receive LDL externally (58). Our findings may be most relevant to neuronal and glial cells in the brain, because cells in the central nervous system receive cholesterol mainly from de novo synthesis and not from LDL (44).


   FOOTNOTES
 
* This work was supported in part by National Institutes of Health Grant HL36709 (to T.-Y. C.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 These authors contributed equally to this work. Back

2 Present address: Gene Expression Laboratory, The Salk Institute for Biological Studies and Howard Hughes Medical Institute, La Jolla, CA 92037. Back

3 Supported by a postdoctoral fellowship from the National Niemann-Pick Foundation. Present address: Dept. of Environmental Health Sciences, Chubu University, Aichi 487-8501, Japan. Back

4 To whom correspondence should be addressed. Tel.: 603-650-1622; Fax: 603-650-1128; E-mail: Ta.Yuan.Chang{at}dartmouth.edu.

5 The abbreviations used are: LDL, low density lipoprotein; ACAT, acyl-coenzyme A:cholesterol transferase; CD, cyclodextrin; CHO, Chinese hamster ovary; CL, cholesteryl linoleate; [3H]CL-LDL, [3H]cholesteryl linoleate-labeled LDL; endo-CHOL, endogenously synthesized cholesterol; ER, endoplasmic reticulum; GFP, green fluorescent protein; LDL-CHOL, cholesterol liberated from LDL; MVB, multivesicular body; NPC1, Niemann-Pick type C1; NSDHL, NADPH sterol dehydrogenase-like protein; PBS, phosphate-buffered saline; PM, plasma membrane; SCAP, SREBP cleavage-activating protein; SREBP, sterol regulatory element-binding protein; TGN, transGolgi network; YFP, yellow fluorescent protein; HMG, hydroxymethylglutaryl; WT, wild type; PBS, phosphate-buffered saline; DiI, DiIC18(3); DIC, differential interference contrast. Back


   ACKNOWLEDGMENTS
 
We thank members of the Chang laboratory, especially Dr. Patrick Reid, for helpful discussions. We thank Dr. Alice Givan, Ken Orndorff, and Ann Lavanway for instructions in using the fluorescence microscopy and time-lapse video microscopy systems. We also thank Helina Josephson for careful editing of the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bloch, K. (1992) Steroids 57, 378-383[CrossRef][Medline] [Order article via Infotrieve]
  2. Brown, M. S., and Goldstein, J. L. (1986) Science 232, 34-47[Free Full Text]
  3. Sugii, S., Reid, P. C., Ohgami, N., Du, H., and Chang, T. Y. (2003) J. Biol. Chem. 278, 27180-27189[Abstract/Free Full Text]
  4. Wojtanik, K. M., and Liscum, L. (2003) J. Biol. Chem. 278, 14850-14856[Abstract/Free Full Text]
  5. Patterson, M. C., Vanier, M. T., Suzuki, K., Morris, J. A., Carstea, E., Neufeld, E. B., Blanchette-Mackie, J. E., and Pentchev, P. G. (2001) in The Metabolic and Molecular Bases of Inherited Disease (Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D., eds) Vol. III, 8th Ed., pp. 3611-3633, McGraw-Hill Inc., New York
  6. Ko, D. C., Binkley, J., Sidow, A., and Scott, M. P. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 2518-2525[Abstract/Free Full Text]
  7. Ohgami, N., Ko, D. C., Thomas, M., Scott, M. P., Chang, C. C., and Chang, T. Y. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 12473-12478[Abstract/Free Full Text]
  8. Chang, T. Y., Reid, P. C., Sugii, S., Ohgami, N., Cruz, J. C., and Chang, C. C. Y. (2005) J. Biol. Chem. 280, 20917-20920[Free Full Text]
  9. Liscum, L. (2000) Traffic 1, 218-225[CrossRef][Medline] [Order article via Infotrieve]
  10. Liscum, L., and Faust, J. R. (1989) J. Biol. Chem. 264, 11796-11806[Abstract/Free Full Text]
  11. Frolov, A., Srivastava, K., Daphna-Iken, D., Traub, L. M., Schaffer, J. E., and Ory, D. S. (2001) J. Biol. Chem. 276, 46414-46421[Abstract/Free Full Text]
  12. Eskelinen, E. L., Schmidt, C. K., Neu, S., Willenborg, M., Fuertes, G., Salvador, N., Tanaka, Y., Lullmann-Rauch, R., Hartmann, D., Heeren, J., von Figura, K., Knecht, E., and Saftig, P. (2004) Mol. Biol. Cell 15, 3132-3145[Abstract/Free Full Text]
  13. Lebrand, C., Corti, M., Goodson, H., Cosson, P., Cavalli, V., Mayran, N., Faure, J., and Gruenberg, J. (2002) EMBO J. 21, 1289-1300[CrossRef][Medline] [Order article via Infotrieve]
  14. Seabra, M. C., and Coudrier, E. (2004) Traffic 5, 393-396[CrossRef][Medline] [Order article via Infotrieve]
  15. Pfeffer, S. R. (2001) Trends Cell Biol. 11, 487-491[CrossRef][Medline] [Order article via Infotrieve]
  16. Choudhury, A., Sharma, D. K., Marks, D. L., and Pagano, R. E. (2004) Mol. Biol. Cell 15, 4500-4511[Abstract/Free Full Text]
  17. Gibbons, G. F., Mitropoulos, K. A., and Myant, N. B. (1982) Biochemistry of Cholesterol, Elsevier/North-Holland Biomedical Press, Amsterdam
  18. Urbani, L., and Simoni, R. D. (1990) J. Biol. Chem. 265, 1919-1923[Abstract/Free Full Text]
  19. Smart, E. J., Ying, Y., Donzell, W. C., and Anderson, R. G. W. (1996) J. Biol. Chem. 271, 29427-29435[Abstract/Free Full Text]
  20. Uittenbogaard, A., Ying, Y., and Smart, E. J. (1998) J. Biol. Chem. 273, 6525-6532[Abstract/Free Full Text]
  21. Heino, S., Lusa, S., Somerharju, P., Ehnholm, C., Olkkonen, V. M., and Ikonen, E. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 8375-8380[Abstract/Free Full Text]
  22. Liscum, L., Ruggiero, R. M., and Faust, J. R. (1989) J. Cell Biol. 108, 1625-1636[Abstract/Free Full Text]
  23. Hao, M., Lin, S. X., Karylowski, O. J., Wustner, D., McGraw, T. E., and Maxfield, F. R. (2002) J. Biol. Chem. 277, 609-617[Abstract/Free Full Text]
  24. Cruz, J. C., and Chang, T. Y. (2000) J. Biol. Chem. 275, 41309-41316[Abstract/Free Full Text]
  25. Lange, Y., Ye, J., Rigney, M., and Steck, T. (2000) J. Biol. Chem. 275, 17468-17475[Abstract/Free Full Text]
  26. Alberts, A. W., Chen, J., Kuron, G., Hunt, V., Huff, J., Hoffman, C., Rothrock, J., Lopez, M., Joshua, H., Harris, E., Patchett, A., Monaghan, R., Currie, S., Stapley, E., Alberts-Schonberg, G., Hensens, O., Hirshfield, J., Hoogsteen, K., Liesch, J., and Springer, J. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 3957-3961[Abstract/Free Full Text]
  27. Goldstein, J. L., and Brown, M. S. (1990) Nature 343, 425-430[CrossRef][Medline] [Order article via Infotrieve]
  28. Chin, J., and Chang, T. Y. (1981) J. Biol. Chem. 256, 6304-6310[Abstract/Free Full Text]
  29. Chang, C. C. Y., Sakashita, N., Ornvold, K., Lee, O., Chang, E. T., Dong, R., Lin, S., Lee, C. Y., Strom, S. C., Kashyap, R., Fung, J. J., Farese, R. V., Jr., Patoiseau, J. F., Delhon, A., and Chang, T. Y. (2000) J. Biol. Chem. 275, 28083-28092[Abstract/Free Full Text]
  30. Cadigan, K. M., Heider, J. G., and Chang, T. Y. (1988) J. Biol. Chem. 263, 274-282[Abstract/Free Full Text]
  31. Faust, J. R., Goldstein, J. L., and Brown, M. S. (1977) J. Biol. Chem. 252, 4861-4871[Free Full Text]
  32. Lougheed, M., Moore, E. D. W., Scriven, D. R. L., and Steinbrecher, U. P. (1999) Arterioscler. Thromb. Vasc. Biol. 19, 1881-1890[Abstract/Free Full Text]
  33. Sugii, S., Reid, P. C., Ohgami, N., Shimada, Y., Maue, R. A., Ninomiya, H., Ohno-Iwashita, Y., and Chang, T. Y. (2003) J. Lipid Res. 44, 1033-1041[Abstract/Free Full Text]
  34. Walter, M., Davies, J. P., and Ioannou, Y. A. (2003) J. Lipid Res. 44, 243-253[Abstract/Free Full Text]
  35. Chang, T. Y., and Limanek, J. S. (1980) J. Biol. Chem. 255, 7787-7795[Free Full Text]
  36. Hua, X., Nohturfft, A., Goldstein, J. L., and Brown, M. S. (1996) Cell 87, 415-426[CrossRef][Medline] [Order article via Infotrieve]
  37. Cadigan, K. M., Spillane, D. M., and Chang, T. Y. (1990) J. Cell Biol. 110, 295-308[Abstract/Free Full Text]
  38. Cruz, J. C., Sugii, S., Yu, C., and Chang, T. Y. (2000) J. Biol. Chem. 275, 4013-4021[Abstract/Free Full Text]
  39. Hasan, M. T., Chang, C. C. Y., and Chang, T. Y. (1994) Somatic Cell Mol. Genet. 20, 183-194[CrossRef][Medline] [Order article via Infotrieve]
  40. Rawson, R. B., Zelenski, N. G., Nijhawan, D., Ye, J., Sakai, J., Hasan, M. T., Chang, T. Y., Brown, M. S., and Goldstein, J. L. (1997) Mol. Cell 1, 47-57[CrossRef][Medline] [Order article via Infotrieve]
  41. Ohashi, M., Miwako, I., Nakamura, K., Yamamoto, A., Murata, M., Ohnishi, S., and Nagayama, K. (1999) J. Cell Sci. 112, 1125-1138[Abstract]
  42. Ohashi, M., Miwako, I., Yamamoto, A., and Nagayama, K. (2000) J. Cell Sci. 113, 2187-2205[Abstract]
  43. Miwako, I., Yamamoto, A., Kitamura, T., Nagayama, K., and Ohashi, M. (2001) J. Cell Sci. 114, 1765-1776[Abstract]
  44. Dietschy, J. M., and Turley, S. D. (2004) J. Lipid Res. 45, 1375-1397[Abstract/Free Full Text]
  45. Spillane, D. M., Reagan, J. W. J., Kennedy, N. J., Schneider, D. L., and Chang, T. Y. (1995) Biochim. Biophys. Acta 1254, 283-294[Medline] [Order article via Infotrieve]
  46. Klansek, J. J., Warner, G. J., Johnson, W. J., and Glick, J. M. (1996) J. Biol. Chem. 271, 4923-4929[Abstract/Free Full Text]
  47. Reid, P. C., Sugii, S., and Chang, T. Y. (2003) J. Lipid Res. 44, 1010-1019[Abstract/Free Full Text]
  48. Ohashi, M., Mizushima, N., Kabeya, Y., and Yoshimori, T. (2003) J. Biol. Chem. 278, 36819-36829[Abstract/Free Full Text]
  49. Pitas, R. E., Innerarity, T. L., Weinstein, J. N., and Mahley, R. W. (1981) Arteriosclerosis 1, 177-185[Abstract/Free Full Text]
  50. Choudhury, A., Dominguez, M., Puri, V., Sharma, D. K., Narita, K., Wheatley, C. L., Marks, D. L., and Pagano, R. E. (2002) J. Clin. Investig. 109, 1541-1550[CrossRef][Medline] [Order article via Infotrieve]
  51. Mayor, S., Sabharanjak, S., and Maxfield, F. R. (1998) EMBO J. 17, 4626-4638[CrossRef][Medline] [Order article via Infotrieve]
  52. Grimmer, S., Iversen, T.-G., van Deurs, B., and Sandvig, K. (2000) Mol. Biol. Cell 11, 4205-4216[Abstract/Free Full Text]
  53. Shogomori, H., and Futerman, A. H. (2001) J. Neurochem. 78, 991-999[CrossRef][Medline] [Order article via Infotrieve]
  54. Heese-Peck, A., Pichler, H., Zanolari, B., Watanabe, R., Daum, G., and Riezman, H. (2002) Mol. Biol. Cell 13, 2664-2680[Abstract/Free Full Text]
  55. Mayran, N., Parton, R. G., and Gruenberg, J. (2003) EMBO J. 22, 3242-3253[CrossRef][Medline] [Order article via Infotrieve]
  56. Hao, M., Mukherjee, S., Sun, Y., and Maxfield, F. R. (2004) J. Biol. Chem. 279, 14171-14178[Abstract/Free Full Text]
  57. Kobayashi, T., Beuchat, M.-H., Chevallier, J., Makino, A., Mayran, N., Escola, J.-M., Lebrand, C., Cosson, P., Kobayashi, T., and Gruenberg, J. (2002) J. Biol. Chem. 277, 32157-32164[Abstract/Free Full Text]
  58. Dietschy, J. M., Turley, S. D., and Spady, D. K. (1993) J. Lipid Res. 34, 1637-1659[Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 JCBHome page
N. Rocha, C. Kuijl, R. van der Kant, L. Janssen, D. Houben, H. Janssen, W. Zwart, and J. Neefjes
Cholesterol sensor ORP1L contacts the ER protein VAP to control Rab7-RILP-p150Glued and late endosome positioning
J. Cell Biol., June 29, 2009; 185(7): 1209 - 1225.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
J. Wright, M. M. Morales, J. Sousa-Menzes, D. Ornellas, J. Sipes, Y. Cui, I. Cui, P. Hulamm, V. Cebotaru, L. Cebotaru, et al.
Transcriptional adaptation to Clcn5 knockout in proximal tubules of mouse kidney
Physiol Genomics, May 1, 2008; 33(3): 341 - 354.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Yamauchi, P. C. Reid, J. B. Sperry, K. Furukawa, M. Takeya, C. C. Y. Chang, and T.-Y. Chang
Plasma Membrane Rafts Complete Cholesterol Synthesis by Participating in Retrograde Movement of Precursor Sterols
J. Biol. Chem., November 30, 2007; 282(48): 34994 - 35004.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/32/23191    most recent
M603215200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugii, S.
Right arrow Articles by Chang, T.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugii, S.
Right arrow Articles by Chang, T.-Y.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement