|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 281, Issue 33, 23456-23463, August 18, 2006
Differential Stability of Thymidylate Synthase 3'-Untranslated Region Polymorphic Variants Regulated by AUF1* 1![]() ![]() ![]() ![]() ![]()
From the
Received for publication, January 11, 2006 , and in revised form, June 16, 2006.
A 6-nucleotide insertion (I)/deletion (D) polymorphism in the 3'-untranslated region of the thymidylate synthase gene was shown to influence mRNA stability, but the molecular basis of this effect has not been elucidated. Here, studies of both endogenous and ectopically expressed thymidylate synthase alleles revealed that the mRNA-binding, decay-promoting protein AUF1 has higher affinity for allele D mRNA. AUF1 overexpression preferentially suppressed D allele mRNA levels, whereas AUF1 silencing selectively elevated D allele mRNA levels. Our results illustrate the functional consequences of ribonucleoprotein associations involving a polymorphic RNA sequence and uncover a novel mechanism of action for non-coding RNA polymorphisms.
Post-transcriptional gene regulatory processes, including altered mRNA turnover, have emerged as key mechanisms controlling gene expression in physiologic and pathologic situations (1). These control mechanisms involve the association of trans factors, including RNA-binding proteins (RBPs)2 and noncoding RNA, with cis sequences present on the mRNA (2, 3). An important subset of regulatory ribonucleoprotein (RNP) associations relies on the presence of cis RNA sequences that are uracil (U)- or adenine (A)-rich (also known as AREs), present in the 5'- or 3'-untranslated regions (UTRs) of the mRNA. Indeed, many ARE-bearing mRNAs encode proteins involved in immune function, proliferation, differentiation, development, the stress response, and malignant transformation (4, 5). A number of ARE-binding RBPs that influence mRNA stability have been described, including RBPs that stabilize target mRNAs, such as the Hu proteins (6), destabilize target mRNAs, including BRF1, KSRP, and TTP (79), or have a dual function, such as NF90 and AUF1 (1012).
The thymidylate synthase (TS) mRNA has AREs in its 3'-UTR. A key enzyme in the de novo synthesis of thymidylate, TS has been a major target protein for chemotherapeutic intervention for decades (13). Given its involvement in folate and homocysteine synthesis, TS is also a critical gene in embryonic development (14). The regulation of TS expression occurs at multiple levels, including regulated transcription and translation (15, 16). A polymorphism consisting of the deletion (D)/insertion (I) of a 6-bp stretch (TTAAAG) in the TS 3'-UTR was recently shown to appear with a frequency for the D allele of In a recent study, the D allele showed decreased mRNA stability in vitro compared with the I allele. Associated with this finding, colorectal tumors from D allele carriers had lower intratumoral TS mRNA levels (23). Here, we investigated the mechanisms governing the expression of D and I alleles. An analysis of RBPs that might confer differential expression to the polymorphic TS variants revealed that AUF1 preferentially bound the D allele and thereby lowered its steady-state levels, whereas it displayed significantly lower affinity for the I allele, whose levels were comparatively elevated. This report demonstrates the differential stability of mRNAs resulting from RNP associations of naturally occurring polymorphic sequences.
Cell Culture, Transfections, and RNA InterferenceHuman colorectal carcinoma RKO cells were cultured in minimal essential medium. All transfections were carried out using Lipofectamine 2000 (Invitrogen) using plasmid vectors to silence AUF1 (pSILENCER-AUF15) (24) and to express AUF1 isoforms (10) and pGL3-TS 3'-UTR D or I alleles (pLuc(D); pLuc(I)) (23); pcDNA3.1 was transfected as a control. Small interfering RNAs (siRNA) targeting HuR and a control siRNA were previously reported (24). A plasmid vector to overexpress HuR (pHuR-TAP) and the corresponding control vector (pTAP) have also been reported (25). Cells were harvested 48 h after transfection and used for further analysis. PCR AnalysesConventional PCR was performed after reverse transcription (RT) of total RNA isolated from RKO, HeLa, and HepG2 cells employing primers that were previously described (17); PCR products were resolved by electrophoresis in ethidium bromide-stained 3% agarose gels. For quantitative PCR (qPCR) analysis, reverse-transcribed RNA (using SSII-RT and either random hexamers or oligo(dT); Invitrogen) was used in PCR amplification reactions using SYBR Green PCR master mix (Applied Biosystems). For the quantification of endogenous TS (BC_002567) alleles, allele-specific antisense primers (GCAACATATAAAACAACTATAAA for D, GCAACATATAAAACAACTATAAC for I) and a common sense primer (GTGCATTTCAATCCCACGTACTTA) were used; the annealing temperature was set at 57 °C. The resulting PCR fragments were verified by sequencing. The levels of expressed luciferase chimeric constructs pLuc(D) and pLuc(I) were measured using primers TCAAAGAGGCGAACTGTGTG and GGTGTTGGAGCAAGATGGAT. The data were normalized to GAPDH mRNA as described (24).
To measure the half-life of chimeric TS alleles, cells were treated with 4 µg/ml actinomycin D to block de novo transcription, RNA was collected at the times indicated, and RT-qPCR was performed to measure the levels of Luc(D) and Luc(I) mRNAs. These values were normalized to the amount of GAPDH mRNA in each sample and represented as the percentage of mRNA levels present at time 0, before adding actinomycin D. Using a semi-logarithmic scale, mRNA half-life was calculated as the time required for a given transcript to be reduced to one-half (50%, horizontal dashed line in Figs. 4B and 5C) of its initial abundance.
Western BlottingWhole-cell lysates were size fractionated by SDS-PAGE and transferred onto polyvinylidene difluoride membranes. Monoclonal antibodies recognizing HuR, hnRNPC1/C2, and Biotin PulldownFor in vitro synthesis of biotinylated transcripts, cDNA was used as template for PCR reactions whereby the T7 RNA polymerase promoter sequence was added to the 5'-end of all fragments. For biotin pulldown analysis, forward oligomers contained the T7 RNA polymerase promoter sequence (CCAAGCTTCTAATACGACTCACTATAGGGAGA (T7)). Primers used for the amplification of sequences 9811283 of GAPDH (NM_002046 [GenBank] ) were (T7) CCTCAACGACCACTTTGTCA (forward); GGTTGAGCACAGGGTACTTTATT (reverse). Primers used for the amplification of sequences 10101504 (1510) of TS (BC_002567) were (T7) GGTGCTTTCAAAGGAGCTTG (forward); CGAATGCAGAACACTTCTTTATTATAG (reverse). Primers used for the preparation of partial 3'-UTR transcripts were (T7) GGGTGCTTTCAAAGGAGCTT and CAGATTTTTGACCTAGTTCCTTTTTC for transcript 1, (T7) TCAGTTATTAATTTTTAAGGATGTTGC and CCTCAGCATTGTCAGATACCC for transcript 2, (T7) TGAGGAGAATGAAATGTATGTGC and TGGTGTTACTCAGCTCCCTCA for transcript 3, and (T7) CTCAAATCTGAGGGAGCTGAG and CGAATGCAGAACACTTCTTTATTATAG for transcripts 4D and 4I. Biotinylated RNAs were synthesized using the MaxiScript T7 kit (Ambion). For biotin pulldown analysis, whole-cell lysates (40 µg each, prepared as described) (24) were incubated with purified biotinylated transcripts for 1 h at 25°C. Complexes were isolated with paramagnetic streptavidin-conjugated Dynabeads (Dynal), and bound proteins in the pulldown material were analyzed by Western blotting.
ImmunoprecipitationFor immunoprecipitation of endogenous RNA-protein complexes from cytoplasmic extracts (400 µg), lysates were incubated (1 h, 4 °C) with Protein A-Sepharose beads (Sigma) that had been precoated with 30 µg of IgG1 (BD Biosciences), antibodies recognizing AUF1 (Upstate%20Biotechnology">Upstate Biotechnology), NF90 (BD Biosciences), HuR or hnRNP C1/C2 (Santa Cruz Biotechnology). Beads were washed and pulldown material processed as described (24). RNA was extracted in the presence of Glycoblue (Ambion) and subsequently used for RT-qPCR analysis.
AUF1 Preferentially Associates with TS Polymorphic Allele DA 6-bp D/I polymorphism at the distal end of the TS mRNA 3'-UTR (Fig. 1A) was shown previously to influence the rate of mRNA decay, with the D allele mRNA displaying a significantly shorter half-life than the I allele mRNA (23). A recent screen revealed representative cell types of each polymorphic group, D/D, D/I, I/I; the human colorectal carcinoma cell line RKO was heterozygous for the polymorphism and was thus chosen for further analysis (Fig. 1B). In RKO cells, the relative basal levels of allele D mRNA, measured by RT followed by qPCR, were 63% of the levels of allele I mRNA (Fig. 1C). To identify RBPs preferentially binding either of the allelic forms, biotinylated RNAs spanning the entire TS 3'-UTR with or without the insertion (I and D, respectively) were used in pulldown assays followed by detection of associated RBPs by Western blot analysis (Fig. 2A and "Experimental Procedures"). As shown, several RBPs exhibited binding to both the D and I alleles, including AUF1, NF90, HuR, and hnRNP C1/C2. However, only the mRNA decay-promoting AUF1 displayed preferential affinity for one allele (D) relative to the other (Fig. 2A). Binding was low or undetectable in reactions using a negative control biotinylated RNA comprising the GAPDH 3'-UTR (Fig. 2A). To define the regions implicated in these RNP associations, a series of biotinylated transcripts spanning the 3'-UTR were prepared and tested in biotin pulldown assays. As shown (Fig. 2B), AUF1 predominantly associated with transcript 4 (containing the polymorphism), but it bound the D allelic transcript (4D) more robustly than it bound the I allelic transcript (4I). NF90 preferentially associated with transcript 2, whereas the HuR RNP complexed with transcripts 2 and 3 at levels that were only slightly above background. Interestingly, fragment 3, which had elevated AU content, was not a strongly preferred target of these RBPs. Despite the general affinity of AUF1 for RNAs with elevated AU residues, TS 3'-UTR fragment 4 is not particularly adenine-rich, similar to what was seen with another target region within the cyclin D1 mRNA (26).
These RNP complexes were verified in RKO cells by performing immunoprecipitation reactions to isolate endogenous RBPs bound to endogenous TS mRNA alleles. As detected using allele-specific PCR amplification reactions, AUF1 associated preferentially with the D allele mRNA (Fig. 2C), whereas NF90 and HuR did not exhibit a preference for either allelic mRNA. Binding of hnRNP C1/C2 to the TS D and I mRNAs was very low, as evidenced by the fact that the levels of these mRNAs were comparable with the levels of control IgG immunoprecipitation reactions (Fig. 2C). Together, these data indicate that AUF1, NF90, and HuR can bind the TS mRNA but only AUF1 displays strong and preferential binding to the D allele mRNA relative to the I allele mRNA.
AUF1 Overexpression Preferentially Decreases Allele D mRNA Steady-state LevelsAUF1 is expressed in four isoforms (p45, p42, p40, and p37) arising from an alternate splicing of a common pre-mRNA. AUF1 was shown to promote mRNA decay, a process that has been linked to the targeting of AUF1 to the proteasome and the exosome (27, 28). Accordingly, we hypothesized that modulation of AUF1 levels might selectively affect the levels of the D allele mRNA. To test this possibility, we first overexpressed each AUF1 isoform in RKO cells (Fig. 3A) and subsequently evaluated the allelic expression in each transfection group. As shown, the endogenous D allele mRNA was less abundant than the I allele mRNA in control (V) populations (Fig. 3B). Following transfection of AUF1 isoforms, expression of the I allele mRNA decreased modestly, whereas D allele mRNA levels decreased markedly to
To ascertain whether these effects relied on the association of AUF1 with the TS 3'-UTR, we employed expression vectors in which the luciferase coding region was linked to the 3'-UTR of each allelic variant. Following transfection of RKO cells with pLuc(D) and pLuc(I) constructs (see "Experimental Procedures"), the basal expression levels of each chimeric transcript (Luc(D) and Luc(I), respectively) were monitored by RT-qPCR. As shown in Fig. 4A, Luc(D) RNA levels were
To assess the effect of AUF1 on the levels of the chimeric transcripts, pLuc(D) and pLuc(I) were cotransfected with isoform-specific AUF1 expression vectors, and the levels of chimeric luciferase transcript were measured. As shown, these interventions modestly changed the levels of the I allele but reduced much more robustly the levels of D allele (Fig. 4C). Similar to what was observed with the endogenous D and I allele mRNAs, Luc(D) and Luc(I) mRNAs were elevated when HuR was overexpressed, but there was no selective increase of one allele relative to the other (Fig. 4D). Taken together, the results obtained after HuR overexpression indicate that HuR can also influence TS mRNA expression levels, an effect that could be elicited directly, through binding of HuR to the TS mRNA. However, a more plausible explanation is that the effects of HuR on TS mRNA expression are indirect, because binding of HuR to the TS mRNA is modest (Fig. 2) and HuR overexpression globally increases cell proliferation, a situation in which TS expression can increase via enhanced transcription (29). These findings further support the notion that the 3'-UTR D allele polymorphism selectively decreases mRNA stability and AUF1 influences this process.
AUF1 Silencing Preferentially Increases Allele D mRNA Levels and StabilityTo further investigate the influence of AUF1 on the expression of each TS allele, AUF1 levels were knocked down by using a vector that expressed a hairpin RNA (shRNA) targeting all AUF1 isoforms (Fig. 5A and "Experimental Procedures"). The shRNA-mediated knock down of AUF1 caused a reduction of cell proliferation, and consequently the endogenous TS mRNA levels (both alleles) decreased significantly (not shown). Because the down-regulation of endogenous TS mRNA in the growth-inhibited cells likely had a significant transcriptional component, we focused instead on the influence of silencing AUF1 on the ectopically expressed Luc(D) and Luc(I) alleles, which continued to be transcribed despite the growth inhibition. Co-transfection experiments carried out with plasmid pLuc(D) or pLuc(I) vectors revealed a striking 30-fold increase in Luc(D) expression after AUF1 silencing, compared with only a 5-fold increase for Luc(I) (Fig. 5B). To test the hypothesis that mRNA stability contributed to these differences, the half-lives of Luc(D) and Luc(I) mRNAs were measured in cells expressing normal AUF1 levels (V) or after silencing (AUF1 shRNA). Using actinomycin D treatment to measure half-life (as described in Fig. 4B), the short half-life of Luc(D) mRNA in control cells was found to increase >3-fold after AUF1 silencing (from 2 to The specificity of AUF1 silencing upon the stability of each TS allele mRNA was assessed by silencing a different RBP. HuR levels were reduced by RNA interference, and the relative abundance of the D and I alleles was measured. Silencing HuR (Fig. 5D) reduced the abundance of both D and I allelic variants, but their relative levels remained constant (Luc(D) was 69% of Luc(I) in the control siRNA group; Luc(D) was 74% of Luc(I) in the HuR siRNA group), indicating no preferential effect on either allele variant. As mentioned above, HuR may form endogenous RNP complexes with the TS mRNA and thereby regulate TS transcript levels; more likely, HuR promotes cell proliferation via its influence on other cell cycle regulatory proteins (30) and the actively dividing cells have elevated TS gene transcription (29).
ImplicationsOur data reveal that a 6-bp D/I polymorphic region within the TS 3'-UTR influences its association with the decay-promoting RBP AUF1. Consequently, the preferred target, D allele mRNA, is less stable, whereas I allele mRNA has a longer half-life. The usefulness of TS genetic variants is emerging as an effective means of identifying individuals at risk for a particular disease, its course, complications, and outcome. In addition, it provides valuable information on the most effective and safest treatment protocols. Thus far, the mechanisms of action of three such TS genetic variants have been elucidated: TS gene amplification, a 28-bp tandem repeat polymorphism, and a G
Although the D allele mRNA was previously shown to be less stable (23), this is the first study on its underlying mechanism of action and to identify the decay-promoting AUF1 as a regulatory factor for TS. Along with the transcriptional and translational regulation of TS expression (15, 29) and the influence of an antisense transcript (16), the control of TS allele levels by AUF1 described here adds an important level of complexity to the mechanisms of TS expression. Numerous reports have described polymorphisms, either single-nucleotide polymorphisms or deletion/insertions, within 3'-UTR AREs of other genes (e.g. the 1784 TGTG deletion/insertion polymorphism in NRAMP1, the 1188 A
* This work was supported by the Intramural Research Program of the NIA, National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 To whom correspondence should be addressed: Box 12, LCMB, NIA-IRP, National Institutes of Health, 5600 Nathan Shock Dr., Baltimore, MD 21224. Tel.: 410-558-8264; Fax: 410-558-8386; E-mail: pullmannru{at}nih.gov.
2 The abbreviations used are: RBP, RNA-binding protein; RNP, ribonucleoprotein; ARE, AU-rich element; UTR, untranslated region; TS, thymidylate synthase; D, deletion; I, insertion; siRNA, small interfering RNA; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qPCR, quantitative PCR; shRNA, short hairpin RNA.
We thank our colleagues K. Mazan-Mamczarz, H. H. Kim, and S. Galban for assistance and advice.
This article has been cited by other articles:
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||