Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M604155200 on June 5, 2006

J. Biol. Chem., Vol. 281, Issue 33, 23740-23747, August 18, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/33/23740    most recent
M604155200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roepke, T. K.
Right arrow Articles by Abbott, G. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roepke, T. K.
Right arrow Articles by Abbott, G. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The KCNE2 Potassium Channel Ancillary Subunit Is Essential for Gastric Acid Secretion*

Torsten K. Roepke{ddagger}§, Arun Anantharam, Philipp Kirchhoff||**, Stephanie M. Busque**, Jeffrey B. Young{ddagger}, John P. Geibel||**, Daniel J. Lerner{ddagger}{ddagger}, and Geoffrey W. Abbott{ddagger}§1

From the {ddagger}Greenberg Division of Cardiology, Department of Medicine, §Department of Pharmacology, and Neuroscience Graduate Program, Cornell University, Weill Medical College, New York, New York 10021, Departments of ||Surgery and **Cellular and Molecular Physiology, Yale University School of Medicine, New Haven, Connecticut 06520, and {ddagger}{ddagger}FoxHollow Technologies, Redwood City, California 94063

Received for publication, May 1, 2006 , and in revised form, May 31, 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Genes in the KCNE family encode single transmembrane domain ancillary subunits that co-assemble with voltage-gated potassium (Kv) channel {alpha} subunits to alter their function. KCNE2 (also known as MiRP1) is expressed in the heart, is associated with human cardiac arrhythmia, and modulates cardiac Kv {alpha} subunits hERG and KCNQ1 in vitro. KCNE2 and KCNQ1 are also expressed in parietal cells, leading to speculation they form a native channel complex there. Here, we disrupted the murine kcne2 gene and found that kcne2 (-/-) mice have a severe gastric phenotype with profoundly reduced parietal cell proton secretion, abnormal parietal cell morphology, achlorhydria, hypergastrinemia, and striking gastric glandular hyperplasia arising from an increase in the number of non-acid secretory cells. KCNQ1 exhibited abnormal distribution in gastric glands from kcne2 (-/-) mice, with increased expression in non-acid secretory cells. Parietal cells from kcne2 (+/-) mice exhibited normal architecture but reduced proton secretion, and kcne2 (+/-) mice were hypochlorhydric, indicating a gene-dose effect and a primary defect in gastric acid secretion. These data demonstrate that KCNE2 is essential for gastric acid secretion, the first genetic evidence that a member of the KCNE gene family is required for normal gastrointestinal function.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Voltage-gated potassium (Kv)2 channels repolarize excitable cells by opening in response to membrane depolarization to permit K+ ion efflux. In addition to the 40 known genes that encode the pore-forming ({alpha}) subunits of Kv channels (1), a range of Kv channel ancillary subunits form heteromeric complexes with Kv {alpha} subunits to alter their functional properties, thus increasing native Kv current diversity. One family of ancillary subunits, the MinK-related peptides (MiRPs, encoded by KCNE genes), contributes five known members to the human genome. MiRPs are single transmembrane domain subunits that co-assemble with Kv {alpha} subunits, altering their gating, conductance, regulation, and pharmacology (2).

The MiRP1 protein, encoded by the KCNE2 gene, is now more commonly referred to as KCNE2, and this nomenclature is used here to avoid confusion. KCNE2 regulates hERG potassium channels, and KCNE2-hERG complexes are thought, at least in part, to generate the cardiac IKr current, the major repolarizing force in human ventricles (3). Mutations in KCNE2 are associated with a form of inherited long QT syndrome, LQT6 (3-5). Further, relatively common polymorphisms in KCNE2 are associated with acquired (drug-induced) long QT syndrome, and some KCNE2 variants increase susceptibility to drug block of the IKr channel complex (3, 6).

Aside from interacting with hERG, KCNE2 has been found to modulate other Kv {alpha} subunits in heterologous co-expression studies, including KCNQ1 (also known as Kv7.1) (7), Kv3.1, Kv3.2 (8), and Kv4.2 (9). Effects of KCNE2 on KCNQ1 are particularly dramatic: KCNE2 converts KCNQ1 to a voltage-independent "leak" channel that retains K+ selectivity but is constitutively active regardless of membrane potential (7). In addition to its role in human heart, KCNQ1 is required for normal gastric acid secretion (10) and is proposed to provide a K+ ion efflux in parietal cells located in the gastric glands of the stomach to balance K+ ion influx through the gastric H+/K+-ATPase (11, 12). KCNE2, like KCNQ1, is expressed in parietal cells, leading to the suggestion that KCNE2 might co-assemble with KCNQ1 in parietal cells (10, 13). Aside from heart and stomach, KCNE2 has also been detected in kidney, lung, bladder, brain, spinal cord, and skeletal muscle (2).

Thus, KCNE2 has the potential to play diverse roles in different tissues with a range of {alpha} subunit partners. Here, we disrupted the murine kcne2 gene to identify its roles in mammalian physiology. The results demonstrate for the first time that KCNE2 is required for gastric acid secretion and also the first genetic evidence of a role for any of the KCNE proteins in the gastrointestinal tract. These findings have implications for the physiology, pharmacology, and pharmacogenetics of the mammalian gastrointestinal tract and potentially for treatment of pathophysiologic conditions such as gastro-esophageal reflux disease and peptic ulcers.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Targeted Disruption of Kcne2Kcne2 was disrupted in RF8 129/SvJae murine embryonic stem (ES) cells by homologous recombination using standard techniques (14). A 3.2-kb 3'-genomic DNA fragment, beginning 29 nucleotides downstream of the kcne2 stop codon, was amplified by PCR from SV129J (ES) cell DNA using the following primers: forward, 5'-CCGTCTCAATTGGACAGGGTGCTTCTGCTGCC-3' and reverse, 5'-ATGTGTCAATTGAGCAGACTAAGCAGAAAGACTCTAAAGGG-3'.A 3.3-kb 5'-genomic DNA fragment, ending with the nucleotide prior to the start codon, was amplified by PCR from SV129J ES cell DNA using the following primers: forward, 5'-AGCCTTTGCTGTCTGTTGTAGGC-3' and reverse 5'-AGTGACTCTAGCTAGTGCCCAGG-3'. The 3'- and 5'-fragments were sequentially subcloned into the Mfe1 and the SalI-ClaI sites of the pNTK-loxP vector (15). Homologous recombination of the targeting vector replaces the entire open reading frame of kcne2 (Fig. 1A). Homologous recombination of the targeting vector in ES cells was confirmed by Southern blotting using 3'- and 5'-probes outside the recombined region. The primer sequences for amplifying the probes were 5'-probe (giving 324-bp probe): forward, 5'-AGCCTTTGCTGTCTGTTGTAGGC-3' and reverse, 5'-AGTGACTCTAGCTAGTGCCCAGG-3';3'-probe (giving 375-bp probe): forward, 5'-CCAGTATCAACTTCAACCAAAGC-3' and reverse, 5'-TTGTGCTAACAAGAGAATATCACG-3' (Fig. 1A). Correctly targeted ES cells were aggregated with C57BL/6 mouse blastocysts and implanted into C57BL/6 female mice to generate chimeric progeny. The chimeric progeny were bred to C57BL/6 mice to generate 50:50 129/SvJae:C57BL/6 progeny, which in turn were interbred to generate the mice used in this study. All mice functionally characterized in this study were 10-15 weeks of age, from F2 and F3 generations. All mice were housed, experimented on, and euthanized according to Cornell University Institutional Animal Care and Use Committee guidelines.

Reverse Transcription PCR and Western Blot Analysis—Total RNA was extracted from the stomachs of ~12-week-old kcne2 (+/+) and (-/-) littermates, DNase cleaned, and reverse transcribed. A portion of the kcne2 gene was amplified using the following primers (5' to 3'): CCCAGACACTGGAGGATGCC (sense) and ACTGTGAACCCCGTCGCCCC (antisense), giving a PCR product of 340 bp from kcne2 (+/+) mice and no signal from kcne2 (-/-) mice. For detection of KCNE2 protein, membrane fractions from stomachs extracted from adult kcne2 (-/-) and (+/+) littermates were prepared using modifications of previously reported protocols (16, 17) and analyzed using Western blotting with polyclonal anti-KCNE2 antibody (Sigma-Aldrich) and horseradish peroxidase-conjugated goat anti-rabbit IgG (Bio-Rad Laboratories) for visualization with fluorography.

Electron Microscopy and Histology—For electron microscopy, mid-stomach tissue from kcne2 (+/+), (+/-), and (-/-) mice (2/gender/genotype) was washed, fixed, stained, and dehydrated and then infiltrated and embedded in Spurr's resin. Sections were cut, contrasted with lead citrate, and viewed on a JSM 100 CX-II electron microscope (JEOL USA Inc., Peabody, MA) operated at 80 kV. Images were recorded on Kodak 4489 Electron Image film and then digitized on an Epson Expression 1600 Pro scanner at 900 dpi. For histology, kcne2 (+/+), (+/-), and (-/-) mice (2/gender/genotype) were sacrificed using CO2 asphyxiation. Stomachs were removed, fixed in 10% neutral buffered formalin, processed by routine methods, and embedded in paraffin wax. Sections (5 µm) were placed on super frost (positively charged) slides, stained with hematoxylin and eosin, and evaluated with an Olympus BX45 light microscope (New York/New Jersey Scientific, Inc., Middlebush, NJ). Stomach sections were also stained with periodic acid-Schiff for demonstration of mucin.

Immunohistochemistry—Immunohistochemical detection was performed with a Discovery XT System (Ventana Medical Systems) using slides prepared from stomach sections as for histology. For single labeling with diaminobenzidine detection a 30-min blocking step was employed, using 10% normal goat serum (Vector Laboratories; catalog number S-1000) and 2% bovine serum albumin (KCNQ1) or MOM Blocking reagent (Vector Laboratories; catalog number MKB-2213) (H+/K+-ATPase beta-subunit) followed by avidin and biotin incubation for 4-8 min each. Incubation with the primary antibodies (KCNQ1, Chemicon catalog number AB5932; 1 mg/ml; H+/K+-ATPase beta-subunit, Affinity Bioreagents catalog number MA3-923; 0.5 mg/ml) was carried out for 3 h at room temperature followed by 60 min of incubation with: for KCNQ1, biotinylated anti-rabbit antibody at 1:200 dilution (Vectastain ABC kit (rabbit IgG) catalog number PK-6101) or for H+/K+-ATPase beta-subunit, biotinylated anti-mouse IgG (H+L) secondary antibody at 1:250 dilution (Vector MOM basic kit catalog number BMK-2202). Diaminobenzidine detection kit containing Blocker D, Copper D, Inhibitor D, streptavidin-horseradish peroxidase D and diaminobenzidine D (Ventana Medical Systems) was used according to the manufacturer's instructions. Slides were viewed with a Nikon Eclipse E600 microscope and photographed using a RT Color Camera and SPOT software (Diagnostic Instruments, Inc.).

Whole Stomach and Parietal Cell pH Measurements—Studies were conducted on gastric tissue from 3-month-old kcne2 (+/+), (+/-), and (-/-) mice using methods described previously (18, 19). Briefly, for whole stomach measurements, stomachs were ligated ex vivo at the esophageal and duodenal junctures and excised, infused with 0.3-0.5 ml of non-buffered, isotonic saline, and then incubated at 37 °C for 1 h in oxygenated HEPES-buffered Ringer's solution (pH 7.4) with or without 100 µM histamine (Sigma-Aldrich) before measuring pH of the aspirated stomach contents. For parietal cell measurements, individual gastric glands were hand dissected and loaded with the pH-sensitive dye 2',7-bis(2-carbocyethyl)-5-(and 6) carboxyfluoresceinacetomethylester (BCECF) (Invitrogen). Proton extrusion by individual parietal cells was monitored by observing recovery of intracellular pH (pHi) in the presence of 100 µM histamine or 100 µM carbachol (Sigma-Aldrich) after acidification using the NH4Cl prepulse technique (20).

Serum Gastrin Measurements—Mice were euthanized by carbon dioxide asphyxiation. Whole blood was collected postmortem by cardiac puncture following euthanasia. Following coagulation of the remaining whole blood at room temperature for 30 min, the clotted blood was centrifuged at 3000 rpm for 5-10 min at 4 °C. Aliquots of serum were submitted to a commercial reference laboratory (Clinical Pathology Laboratory at Animal Medical Center, New York, NY) for determination of biochemical parameters. Serum gastrin levels were determined by AniLytics, Inc. (Gaithersburg, MD) using a double antibody radioimmunoassay (Diagnostic Products Corp., Los Angeles, CA).


Figure 1
View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 1.
Generation and genotyping of kcne2 (+/-) and (-/-) mice. A, targeting vector designed to disrupt exon 1 of the murine kcne2 locus with a neomycin resistance cassette. LoxP sites for Cre-recombinase removal surround the neomycin resistance cassette. Regions between dashed lines are recombined during homologous recombination. B, genotyping of progeny from kcne2 (+/-) x (+/-) matings by Southern blotting. Tail genomic DNA was digested with BglII and hybridized to a radiolabeled probe complementary to sequence within a 323-nucleotide region upstream of the kcne2 coding region. This 5'-probe binds to an 8.1-kb restriction fragment from the wild-type locus and a 4.2-kb restriction fragment from the targeted locus. C, left gel, product generated by PCR using kcne2-specific primers from a cDNA library generated from reverse transcription PCR of stomach mRNA from kcne2 (+/+) or (-/-) mice as indicated above the lanes. Numbers to the left indicate migration distance of DNA ladder markers on agarose gel. Right gel, negative controls using mRNA as in the left gel but omitting reverse transcriptase in the reverse transcription PCR step to demonstrate lack of genomic DNA contamination and positive control using KCNE2 cDNA (right lane). D, Western blots of stomach membrane preparations from kcne2 (+/+) and (-/-) mice using anti-KCNE2 polyclonal antibody (right lanes). Antibody specificity was confirmed using lysates from non-transfected Chinese hamster ovary cells and Chinese hamster ovary cells transfected with human KCNE2 cDNA (left lanes). Migration distance of molecular mass marker is shown on the left (in kDa).

 
Statistical Analyses—Numerical data were analyzed with EXCEL software (Microsoft) using one-way analysis of variance with statistical significance set at p < 0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Disruption of the kcne2 Gene—To determine physiological roles of KCNE2 we disrupted the kcne2 gene by homologous recombination in murine ES cells to create kcne2 (-/-) mice in a 50:50 C57BL/6:129/SVJae genetic background (Fig. 1, A and B). kcne2 transcript and its protein product KCNE2 are expressed in stomach tissue of wild-type mice but absent from that of kcne2 (-/-) mice (Fig. 1, C and D). kcne2 (+/-) matings generated offspring with the expected Mendelian frequencies, kcne2 (+/+), 25%; kcne2 (+/-), 46%; kcne2 (-/-), 29% (n = 114), indicating that KCNE2 is not required for embryo viability in the 50:50 C57BL/6:129/SVJae genetic background.

kcne2 (-/-) Mice Exhibit Increased Stomach Mass Due to Marked Glandular Hyperplasia—kcne2 (+/-) and (-/-) mice had normal outward appearance, and body weights of 12-15-week kcne2 (+/+), (+/-), and (-/-) mice were similar: male, 26.8 ± 0.8 g, 26.1 ± 0.4 g, 25.8 ± 0.8 g, respectively; female, 20.6 ± 1.3 g, 20.3 ± 0.5 g, 21.0 ± 0.4 g, respectively (n = 6-14; no significant difference between groups). In contrast, internal examination revealed that kcne2 (-/-) mice had markedly enlarged stomachs (Fig. 2A). In particular, the kcne2 (-/-) stomachs exhibited unusually prominent rugal folds and marked hyperplasia of the glandular stomach compared with kcne2 (+/+) and (+/-) mice, with no apparent differences in the non-glandular stomach (Fig. 2B). Stomachs from kcne2 (-/-) mice had a 4-fold greater mass (0.5 ± 0.04 g) than those of kcne2 (+/+) (0.13 ± 0.03 g) or (+/-) mice (0.13 ± 0.03 g) (p < 0.001, n = 3-5; Fig. 2C).

kcne2 (+/-) and (-/-) Mice Have Impaired Gastric Acid Secretion—Given the markedly abnormal appearance of the stomach in kcne2 (-/-) mice, we measured the pH in ex vivo stomachs to ascertain whether kcne2 is required for normal gastric acid secretion. The stomachs from kcne2 (+/+) mice had a mean basal pH of 3.9 ± 0.1, which was significantly reduced to pH 2.8 ± 0.2 when stimulated with 100 µM histamine (p < 0.01). In contrast, the mean luminal pH in stomachs from kcne2 (-/-) mice was strikingly more alkaline under basal conditions (pH 6.5 ± 0.2) and was not significantly altered by histamine (pH 6.6 ± 0.2). Importantly, the mean luminal pH in kcne2 (+/-) mice was intermediate between the two (basal, pH 4.6 ± 0.2) and was significantly shifted by histamine stimulation (pH 3.8 ± 0.2, p < 0.05) (Fig. 3; n = 5-8 stomachs/group). These data demonstrate that disruption of the kcne2 gene impairs gastric acid secretion and that the effect of kcne2 on gastric acid secretion is gene-dose dependent.

kcne2 (-/-) Mice Have a Primary Defect in Gastric Acid Secretion—Gastrin, produced by G-cells in the antrum of the stomach, is a peptide hormone that stimulates parietal cell acid secretion. Impaired gastrin production can result in reduced gastric acid secretion (21). To determine whether the hypochlorhydria in kcne2 (+/-) and achlorhydria in kcne2 (-/-) mice were due to a defect in gastrin production or release, we compared serum gastrin levels in kcne2 (+/+), (+/-), and (-/-) mice. Gastrin levels were markedly elevated in kcne2 (-/-) mice: 421 and 213 pg/ml in the two knock-out mice evaluated compared with 93 and 33 pg/ml for two wild-type littermates and 45 and 28 pg/ml for two kcne2 (+/-) mice in this study. Previous reports indicated that normal murine gastrin levels are in the range of 32-67 pg/ml (12, 22). These data demonstrated that achlorhydria in kcne2 (-/-) mice and hypochlorhydria in kcne2 (+/-) mice were not due to a secondary defect in gastrin production or release. The results suggested that kcne2 disruption causes a primary defect in parietal cell acid secretion.


Figure 2
View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 2.
kcne2 (-/-) mice have enlarged stomachs. A, exemplar photographs of whole stomachs isolated from kcne2 (+/+) and (-/-) mice as indicated; scale bars, 1 cm. B, exemplar photographs of the internal face of stomachs isolated from kcne2 (+/+) and (-/-) mice as indicated; scale bars, 1 cm. C, mean stomach mass of whole stomachs isolated from kcne2 (+/+), (+/-), and (-/-) mice (n = 3-5/group; error bars indicate S.E.). *, p < 0.001.

 
kcne2 (-/-) Mice Have Gastric Glandular Hyperplasia, Confined to Non-acid Secretory Cells—Histological examination demonstrated that kcne2 (-/-) mice exhibit significant diffuse gastric glandular hyperplasia characterized by lengthening of both the fundus and neck portions of the stomach. These hyperplastic gastric glands were lined primarily with tall, columnar cells exhibiting unusually abundant cytoplasm that was pale blue when stained with hematoxylin and eosin (Fig. 4A) and magenta when stained with periodic acid-Schiff (Fig. 4B), indicating these columnar cells were mucous neck and/or chief cells. In contrast, the gastric glands of kcne2 (+/+) and (+/-) mice displayed no hyperplasia and were of normal size (Fig. 4A). In addition, there were mild to moderate numbers of neutrophils scattered within the lamina propria basally, the submucosa, and the muscularis in all kcne2 (-/-) stomachs studied (n = 4) but in none of the stomachs from wild-type or heterozygous mice (Fig. 4A).


Figure 3
View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 3.
kcne2 (-/-) mice are achlorhydric. pH values for ex vivo whole stomach preparations from kcne2 (+/+), (+/-), and (-/-) mice incubated in HEPES-buffered Ringer solution either non-stimulated ("basal"; n = 5-8/group) or stimulated with 100 µM histamine (n = 5-8/group) as indicated. *, p < 0.05; **, p < 0.01.

 
H+/K+-ATPase beta-subunit expression is an established marker of parietal cells in gastric glands (23). Using specific antibodies, we found characteristic H+/K+-ATPase beta-subunit distribution confined largely to cells in the upper and middle neck region of gastric glands from both kcne2 (+/+) and (-/-) mice (Fig. 5, A and B). Cell counts of H+/K+-ATPase beta-subunit positive versus negative cells revealed no significant difference in the mean number of H+/K+-ATPase beta-subunit positive cells per gastric gland cross-section between kcne2 (+/+) (13.8 ± 0.3) and kcne2 (-/-) mice (12.2 ± 0.5) (p > 0.05; n = 50 glands/genotype). However, total cells per gland cross-section in kcne2 (-/-) mice (62.9 ± 0.9) were approximately double that of kcne2 (+/+) mice (28.8 ± 0.4) (p < 0.001; n = 50 glands/phenotype). Thus, gastric gland hyperplasia in kcne2 (-/-) mice was confined to cells lacking the H+/K+-ATPase beta-subunit, suggesting hyperplasia only of non-acid secretory cell types.

KCNQ1 Expression Is Up-regulated in kcne2 (-/-) Mice KCNQ1 was previously suggested as a putative partner for KCNE2 in parietal cells (10, 13). In gastric glands, KCNQ1 is expressed predominantly in parietal cells of wild-type mice but reportedly exhibits lower level expression in non-parietal cell types such as mucous-producing cells (10). Here, using antibodies raised against KCNQ1 {alpha} subunit, we found KCNQ1 distribution in the stomach corpus of kcne2 (+/+) mice similar to that previously reported, with a region of high expression in parietal cells confined largely to a band in the upper and middle neck region of gastric glands and weaker expression in the fundus and surface cells of gastric glands. In contrast, in kcne2 (-/-) mice, KCNQ1 was highly expressed more uniformly throughout the gastric gland in parietal and non-parietal cells, from the fundus through to the surface cells (Fig. 5, C and D). Quantification of this redistribution by cell counting (n = 25 glands/genotype) indicated that the stronger KCNQ1 labeling was detected in a mean of 11.4 ± 0.4 cells per gastric gland in kcne2 (+/+) mice compared with a mean of 21.6 ± 0.7 cells per gastric gland in kcne2 (-/-) mice, a 2-fold increase in the latter. This altered KCNQ1 distribution was suggestive of compensatory remodeling in response to the absence of kcne2.


Figure 4
View larger version (109K):
[in this window]
[in a new window]
 
FIGURE 4.
kcne2 (-/-) mice exhibit gastric hyperplasia. A, exemplar sections of stomach fundi isolated from kcne2 (+/+) and (-/-) mice as indicated and stained with hematoxylin and eosin. Note that the kcne2 (-/-) section is shown both at a similar scale to that of wild type for comparison (upper panels) and at an expanded scale (lower panel) to allow visualization of the entire stomach lining. Asterisk indicates one area of neutrophil infiltration. Scale bars are in the upper right of each panel. B, exemplar sections of stomach fundi isolated from kcne2 (+/+) and (-/-) mice as indicated and stained with periodic acid-Schiff (magenta). Scales are similar for each panel (shown in upper right of each panel).

 
kcne2 (-/-) Mice Exhibit Abnormal Parietal Cell Morphology—Electron micrographs of the corpus region of the stomach showed highly abnormal parietal cell morphology in the absence of kcne2; in particular, the intracellular canaliculi of kcne2 (-/-) parietal cells were much larger than those in wild-type parietal cells, leading to abnormal distribution of mitochondria in kcne2 (-/-) parietal cells, in which they were confined to the cell periphery. Parietal cells from kcne2 (+/-) mice, however, appeared structurally normal (Fig. 6A). Chief cells in kcne2 (-/-) mice displayed no obvious differences from those of their wild-type littermates (Fig. 6B). These data demonstrate that KCNE2 is required for normal parietal cell morphology. It is noteworthy that although kcne2 (+/-) mice have impaired gastric acid secretion, their parietal cell morphology and glandular architecture are normal. This strongly suggests that KCNE2 has an important role in gastric acid secretion.

KCNE2 Is Required for Parietal Cell Acid Secretion—Stimulation of parietal cell histamine H2 receptors or muscarinic M3 receptors triggers parietal cell proton release. To determine whether KCNE2 is required for agonist-triggered parietal cell proton release, we measured intracellular pH recovery in individual parietal cells in freshly isolated gastric glands after activation of H2 receptors with histamine (100 µM) or of muscarinic M3 receptors with carbachol (100 µM). The resting pH in parietal cells was similar in all three genotypes: 7.25 ± 0.03 in kcne2 (+/+), 7.28 ± 0.04 in kcne2 (+/-), and 7.26 ± 0.03 in kcne2 (-/-) (n = 70-150 cells from 3-5 mice/group). After an NH4Cl prepulse to acid load the cells and stimulation with either carbachol or histamine (100 µM), kcne2 (-/-) parietal cells had greatly suppressed rates of proton secretion: a mean {Delta}pH/minute of ~0.01 units compared with ~0.1 units in kcne2 (+/+) cells (p < 0.01). kcne2 (+/-) cells had an intermediate mean proton secretion rate of 0.05 pH units (p < 0.05) (Fig. 7, A and B; n = 70-150 cells from 3-5 mice/group). These results demonstrate that KCNE2 is required for normal proton extrusion by parietal cells in vitro.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Gastric acidification is required for normal digestion and nutrient absorption in humans as well as for the sterilization of fluids and the prevention of bacterial overgrowth (24). The molecular regulation of parietal cell acid secretion is incompletely understood. The gastric H+/K+-ATPase is primarily responsible for acidification of the stomach lumen (11), and the 1:1 exchange of H+ ions for K+ ions by the H+/K+-ATPase requires a continuous supply of K+ from the luminal side (25). To avoid rapid depletion of K+ in the stomach lumen along with a reduction of acid secretion, a K+ recycling path at the apical surface is required.


Figure 5
View larger version (113K):
[in this window]
[in a new window]
 
FIGURE 5.
Immunostaining of H+/K+-ATPase beta-subunit and KCNQ1 in gastric glands. A, exemplar sections of stomach fundi isolated from kcne2 (+/+) and (-/-) mice as indicated and stained with anti-H+/K+-ATPase beta-subunit antibody (brown). Scale bars as indicated. Red arrowhead, fundic region; black arrowhead, surface cells. B, higher magnification of sections in panel A. Scale bars as indicated. C, exemplar sections of stomach fundi isolated from kcne2 (+/+) and (-/-) mice as indicated and stained with anti-KCNQ1 antibody (brown). Scale bars as indicated. Red arrowhead, fundic region; black arrowhead, surface cells. D, higher magnification of sections in panel C. Scale bars as indicated.

 
Previous reports have provided genetic evidence that KCNQ1 is required for this K+ recycling mechanism (12, 26), although a range of candidate potassium channels have been proposed and some or all of them may be involved in this process (27). Inward rectifier potassium channels Kir2.1, Kir4.1, Kir4.2, and Kir7.1 are expressed in gastric mucosa, with Kir2.1 reportedly showing the highest expression (28, 29). Kir2.1 colocalizes with H+/K+-ATPase in parietal cells and shows increased current when stimulated with lowered pH and protein kinase A (29). Kir4.1, but not Kir4.2 or Kir7.1, is also expressed in parietal cells, where it reportedly localizes to the apical membrane (28). Furthermore, Ba2+ ion, a nonspecific blocker of inward rectifier channels, suppresses proton secretion from parietal cells (28). Although genetic disruption of either KCNQ1 or KCNE2 leads to achlorhydria due to a profound loss of parietal cell proton secretion, suggestive of a dominant role for KCNE2-KCNQ1 complexes in gastric acidification, it is possible that other potassium-selective channel types also contribute. Kir2.1 knock-out mice are not reported to exhibit a gastric defect, but they exhibit cleft palate and prolonged cardiac action potentials and die shortly after birth (30).

Recent studies incorporating heterologous characterization, native immunocolocalization, and pharmacological experiments and microarray analysis have suggested the possibility that KCNQ1 co-assembles with KCNE2 in parietal cells to form a complex important for gastric acid secretion (10, 13, 31-33). However, in the absence of native KCNE2-KCNQ1 co-immunoprecipitation or genetic evidence for the role of KCNE2 in parietal cells, firm conclusions regarding the necessity of KCNE2 in these complexes have been lacking. The present data provide, for the first time, genetic and native functional evidence that KCNE2 is essential for gastric acid secretion.

Three conclusions can be drawn from our genetic data. First, the finding that kcne2 disruption drastically reduces carbacholor histamine-stimulated gastric acidification suggests that homomeric KCNQ1 channels are not sufficient for gastric acid secretion. Second, kcne2 (+/-) mice exhibited hypochlorhydria but unlike kcne2 (-/-) mice did not show either abnormal parietal cell morphology or significant gastric hyperplasia. This suggests that KCNE2 contributes directly to the K+ recycling required for proton secretion, as parietal cells from kcne2 (+/-) mice have normal architecture but reduced ability to secrete acid. Previous work provided genetic evidence that KCNQ1 is required for normal gastric acid secretion and that KCNE2 is expressed in parietal cells (12, 13, 31-33). Together, these results suggest that KCNE2-KCNQ1 channel complexes form a potassium leak channel that constitutes an important K+ ion recycling pathway required for parietal cell acid secretion. Third, other kcne family proteins are expressed in the gastrointestinal tract, including KCNE1 (MinK) and KCNE3 (MiRP2) (31), which also converts KCNQ1 into a voltage-independent leak channel (34). In fact, KCNQ1 is a particularly promiscuous partner for the KCNE gene family, with all five known KCNE peptides found to interact with KCNQ1 with various functional outcomes (2). Our data suggest that there is no redundancy of function in this instance: that neither KCNE3 nor any other ancillary subunits can adequately compensate for loss of KCNE2 in parietal cells.


Figure 6
View larger version (77K):
[in this window]
[in a new window]
 
FIGURE 6.
kcne2 (-/-) mice exhibit abnormal parietal cell morphology. A, exemplar electron micrographs showing parietal cells from kcne2 (+/+), (+/-), and (-/-) mice as indicated. Asterisks indicate canaliculi, which are highly distended in the case of kcne2 (-/-) mice. Mitochondria, labeled m, are pushed to the periphery of the cell in kcne2 (-/-) mice. Scale bars (top right), 2 µm. B, exemplar electron micrographs showing chief cells from kcne2 (+/+) and (-/-) mice. Asterisks indicate secretory vesicles, which are similar in the cells from either genotype. Scale bars (top right), 2 µm.

 


Figure 7
View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 7.
kcne2 (-/-) mice exhibit severely impaired parietal cell acid secretion. A, exemplar traces for intracellular pH recovery (proton extrusion) in vitro for proton-loaded individual parietal cells from kcne2 (+/+) (dashed black line), (+/-) (dotted gray line), or (-/-) (solid red line) mice as indicated. Solid bars at the top indicate administration of solutions containing or lacking Na+ or NH4Cl. Cells were stimulated with 100 µM histamine throughout. pH recovery occurred during the 0Na phase in parietal cells from kcne2 (+/+) and (+/-) mice, but not kcne2 (-/-) mice. B, mean rates of pHi recovery from parietal cells as in panel A stimulated with 100 µM carbachol or histamine as indicated; genotype also as indicated (n = 70-150 cells/group from 3-5 mice/group). Error bars indicate S.E. *, p < 0.001; **, p < 0.0001.

 
Striking morphological changes in gastric glands were apparent in kcne2 (-/-) mice. Glandular hyperplasia was observed, confined to non-parietal cells and in particular mucous-producing cells as evidenced by periodic acid-Schiff staining and lack of H+/K+-ATPase beta-subunit staining. Although parietal cells were not reduced in number, those in kcne2 (-/-) cells showed abnormal morphology with highly vacuolated secretory canaliculi. This type of hyperplasia was previously observed in KCNQ1-deficient mice (12) and in H+/K+-ATPase beta-subunit-deficient mice (35). In the latter, this hyperplasia was found to result from secondary hypergastrinemia because H+/K+-ATPase beta-subunit/gastrin double knock-out mice did not display gastric hyperplasia (35). Thus, non-acid secretory cell hyperplasia in kcne2 (-/-) mice may also result from secondary hypergastrinemia. Unexpectedly, kcne2 (-/-) knock out also resulted in a form of compensatory remodeling in which KCNQ1, the probable parietal cell partner of KCNE2, was expressed at atypically high levels in non-parietal cells and across the length of gastric glands. This remodeling was not, however, sufficient to restore gastric acidification to kcne2 (-/-) mice, underlining the necessity for KCNE2 in proton secretion, most likely via its conversion of KCNQ1 to a constitutively active channel. In some diseased heart models, KCNE2 itself is up-regulated, causing altered ionic currents without changes in the expression levels of its putative {alpha} subunit partners (36). Our finding that loss of KCNE2 can alter KCNQ1 expression and distribution presents a novel form of remodeling, and further studies will be undertaken to elucidate the underlying molecular mechanisms and their possible roles in normal gastric physiology.

The role of KCNE2 in gastric acid secretion raises the possibility that genetic variants in the human KCNE2 gene might associate with hypochlorhydria. Importantly, our data demonstrate that KCNE2 has a gene-dose-dependent effect on parietal cell acid secretion. This indicates that single KCNE2 gene mutations could affect gastric acid secretion in heterozygous human subjects, potentially resulting in complications such as reduced absorption of ferric iron and other minerals (24) and vitamin B12 (37) and a range of orally ingested therapeutic drugs such as dipyridamole (38) and atazanavir (39).

Because the pharmacology of KCNE2-KCNQ1 complexes is markedly different from that of homomeric KCNQ1 channels and from that of KCNE1-KCNQ1 or KCNE3-KCNQ1 channels (13), the identification of KCNE2 as an ancillary subunit required for a parietal cell K+ ion-recycling channel will potentially allow specific pharmacological targeting of the KCNE2-KCNQ1 complex for hypersecretory disease states, with avoidance of effects on other KCNQ1-bearing channels such as cardiac IKs, which is generated by KCNE1-KCNQ1 complexes (40, 41) and has different pharmacology than KCNE2-KCNQ1 channels.

In summary, data derived from this first characterization of kcne2 knock-out mice support an important role for KCNE2 in mammalian gastric acid secretion. Further studies of kcne2 (-/-) mice are now intended to explore the potential roles of KCNE2 in other tissues in which it is expressed, including the heart and the brain.


    FOOTNOTES
 
* This work was supported by American Heart Association Grant 0235069N (to G. W. A.), National Institutes of Health Grants R01 HL079275 and RO3 DC07060 (to G. W. A.) and R01 DK50230 (to J. G.), and Swiss National Science Foundation Grant PBZHB-110427 (to P. K.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Starr 463, Greenberg Division of Cardiology, Weill Medical College of Cornell University, 520 E. 70th St., New York, NY 10021. Tel.: 212-746-6275; Fax: 212-746-7984; E-mail: gwa2001{at}med.cornell.edu.

2 The abbreviations used are: Kv channel, voltage-gated potassium channel; MiRP, MinK-related peptide; ES, embryonic stem. Back


    ACKNOWLEDGMENTS
 
We thank Leona Cohen-Gould, Director of the Electron Microscopy and Histology Core Facility at Weill Cornell Medical College, for technical assistance and Dr. Robert Farese for providing RF8 ES cells, and Dr. Peter Goldstein for critical reading of the manuscript.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gutman, G. A., Chandy, K. G., Grissmer, S., Lazdunski, M., McKinnon, D., Pardo, L. A., Robertson, G. A., Rudy, B., Sanguinetti, M. C., Stuhmer, W., and Wang, X. (2005) Pharmacol. Rev. 57, 473-508[Free Full Text]
  2. McCrossan, Z. A., and Abbott, G. W. (2004) Neuropharmacology 47, 787-821[CrossRef][Medline] [Order article via Infotrieve]
  3. Abbott, G. W., Sesti, F., Splawski, I., Buck, M. E., Lehmann, M. H., Timothy, K. W., Keating, M. T., and Goldstein, S. A. (1999) Cell 97, 175-187[CrossRef][Medline] [Order article via Infotrieve]
  4. Curran, M. E., Splawski, I., Timothy, K. W., Vincent, G. M., Green, E. D., and Keating, M. T. (1995) Cell 80, 795-803[CrossRef][Medline] [Order article via Infotrieve]
  5. Isbrandt, D., Friederich, P., Solth, A., Haverkamp, W., Ebneth, A., Borggrefe, M., Funke, H., Sauter, K., Breithardt, G., Pongs, O., and Schulze-Bahr, E. (2002) J. Mol. Med. 80, 524-532[CrossRef][Medline] [Order article via Infotrieve]
  6. Sesti, F., Abbott, G. W., Wei, J., Murray, K. T., Saksena, S., Schwartz, P. J., Priori, S. G., Roden, D. M., George, A. L., Jr., and Goldstein, S. A. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 10613-10618[Abstract/Free Full Text]
  7. Tinel, N., Diochot, S., Borsotto, M., Lazdunski, M., and Barhanin, J. (2000) EMBO J. 19, 6326-6330[CrossRef][Medline] [Order article via Infotrieve]
  8. Lewis, A., McCrossan, Z. A., and Abbott, G. W. (2004) J. Biol. Chem. 279, 7884-7892[Abstract/Free Full Text]
  9. Zhang, M., Jiang, M., and Tseng, G. N. (2001) Circ. Res. 88, 1012-1019[Abstract/Free Full Text]
  10. Grahammer, F., Herling, A. W., Lang, H. J., Schmitt-Graff, A., Wittekindt, O. H., Nitschke, R., Bleich, M., Barhanin, J., and Warth, R. (2001) Gastroenterology 120, 1363-1371[CrossRef][Medline] [Order article via Infotrieve]
  11. Spenney, J. G. (1983) J. Clin. Gastroenterol. 5, Suppl. 1, 7-15[Medline] [Order article via Infotrieve]
  12. Lee, M. P., Ravenel, J. D., Hu, R. J., Lustig, L. R., Tomaselli, G., Berger, R. D., Brandenburg, S. A., Litzi, T. J., Bunton, T. E., Limb, C., Francis, H., Gorelikow, M., Gu, H., Washington, K., Argani, P., Goldenring, J. R., Coffey, R. J., and Feinberg, A. P. (2000) J. Clin. Investig. 106, 1447-1455[Medline] [Order article via Infotrieve]
  13. Heitzmann, D., Grahammer, F., von Hahn, T., Schmitt-Graff, A., Romeo, E., Nitschke, R., Gerlach, U., Lang, H. J., Verrey, F., Barhanin, J., and Warth, R. (2004) J. Physiol. 561, 547-557[Abstract/Free Full Text]
  14. Nagy, A., Gertenstein, M., Vintersten, K., and Behringer, R. (2003) Manipulating the Mouse Embryo: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Press, Cold Spring Harbor, New York
  15. Francis, S. A., Shen, X., Young, J. B., Kaul, P., and Lerner, D. J. (2006) Blood 107, 1627-1635[Abstract/Free Full Text]
  16. Barry, D. M., Trimmer, J. S., Merlie, J. P., and Nerbonne, J. M. (1995) Circ. Res. 77, 361-369[Abstract/Free Full Text]
  17. McCrossan, Z. A., Lewis, A., Panaghie, G., Jordan, P. N., Christini, D. J., Lerner, D. J., and Abbott, G. W. (2003) J. Neurosci. 23, 8077-8091[Abstract/Free Full Text]
  18. Wang, W. H., Henderson, R. M., Geibel, J., White, S., and Giebisch, G. (1989) J. Membr. Biol. 111, 277-289[CrossRef][Medline] [Order article via Infotrieve]
  19. Geibel, J., Giebisch, G., and Boron, W. F. (1989) Am. J. Physiol. 257, F790-F797[Medline] [Order article via Infotrieve]
  20. Roos, A., and Boron, W. F. (1981) Physiol. Rev. 61, 296-434[Free Full Text]
  21. Friis-Hansen, L., Sundler, F., Li, Y., Gillespie, P., Saunders, T., Greenson, J., Owyang, C., Rehfeld, J., and Samuelson, L. (1998) Am. J. Physiol. 274, G561-G568[Medline] [Order article via Infotrieve]
  22. Watson, S. A., and Smith, A. M. (2001) Cancer Res. 61, 625-631[Abstract/Free Full Text]
  23. Karvar, S., Yao, X., Crothers, J. M., Jr., Liu, Y., and Forte, J. G. (2002) J. Biol. Chem. 277, 50030-50035[Abstract/Free Full Text]
  24. Champagne, E. T. (1989) Adv. Exp. Med. Biol. 249, 173-184[Medline] [Order article via Infotrieve]
  25. Geibel, J. P. (2005) World J. Gastroenterol. 11, 5259-5265[Medline] [Order article via Infotrieve]
  26. Vallon, V., Grahammer, F., Volkl, H., Sandu, C. D., Richter, K., Rexhepaj, R., Gerlach, U., Rong, Q., Pfeifer, K., and Lang, F. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 17864-17869[Abstract/Free Full Text]
  27. Waldegger, S. (2003) Pflugers Arch. 446, 143-147[Medline] [Order article via Infotrieve]
  28. Fujita, A., Horio, Y., Higashi, K., Mouri, T., Hata, F., Takeguchi, N., and Kurachi, Y. (2002) J. Physiol. 540, 85-92[Abstract/Free Full Text]
  29. Malinowska, D. H., Sherry, A. M., Tewari, K. P., and Cuppoletti, J. (2004) Am. J. Physiol. 286, C495-C506[CrossRef]
  30. Zaritsky, J. J., Redell, J. B., Tempel, B. L., and Schwarz, T. L. (2001) J. Physiol. 533, 697-710[Abstract/Free Full Text]
  31. Dedek, K., and Waldegger, S. (2001) Pflugers Arch. 442, 896-902[CrossRef][Medline] [Order article via Infotrieve]
  32. Lambrecht, N. W., Yakubov, I., Scott, D., and Sachs, G. (2005) Physiol. Genomics 21, 81-91[Abstract/Free Full Text]
  33. Jain, R. N., Brunkan, C. S., Chew, C. S., and Samuelson, L. C. (2006) Physiol. Genomics 24, 124-132[Abstract/Free Full Text]
  34. Schroeder, B. C., Waldegger, S., Fehr, S., Bleich, M., Warth, R., Greger, R., and Jentsch, T. J. (2000) Nature 403, 196-199[CrossRef][Medline] [Order article via Infotrieve]
  35. Franic, T. V., Judd, L. M., Robinson, D., Barrett, S. P., Scarff, K. L., Gleeson, P. A., Samuelson, L. C., and Van Driel, I. R. (2001) Am. J. Physiol. 281, G1502-G1511
  36. Jiang, M., Zhang, M., Tang, D. G., Clemo, H. F., Liu, J., Holwitt, D., Kasirajan, V., Pond, A. L., Wettwer, E., and Tseng, G. N. (2004) Circulation 109, 1783-1788[Abstract/Free Full Text]
  37. Goodman, K. I., and Salt, W. B., II (1990) Postgrad. Med. 88, 147-150, 153-148[Medline] [Order article via Infotrieve]
  38. Derendorf, H., VanderMaelen, C. P., Brickl, R. S., MacGregor, T. R., and Eisert, W. (2005) J. Clin. Pharmacol. 45, 845-850[Abstract/Free Full Text]
  39. Ray, J. E., Marriott, D., Bloch, M. T., and McLachlan, A. J. (2005) Br. J. Clin. Pharmacol. 60, 291-299[CrossRef][Medline] [Order article via Infotrieve]
  40. Barhanin, J., Lesage, F., Guillemare, E., Fink, M., Lazdunski, M., and Romey, G. (1996) Nature 384, 78-80[CrossRef][Medline] [Order article via Infotrieve]
  41. Sanguinetti, M. C., Curran, M. E., Zou, A., Shen, J., Spector, P. S., Atkinson, D. L., and Keating, M. T. (1996) Nature 384, 80-83[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
FASEB J.Home page
T. K. Roepke, A. Kontogeorgis, C. Ovanez, X. Xu, J. B. Young, K. Purtell, P. A. Goldstein, D. J. Christini, N. S. Peters, F. G. Akar, et al.
Targeted deletion of kcne2 impairs ventricular repolarization via disruption of IK,slow1 and Ito,f
FASEB J, October 1, 2008; 22(10): 3648 - 3660.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. J. Morin and W. R. Kobertz
Tethering Chemistry and K+ Channels
J. Biol. Chem., September 12, 2008; 283(37): 25105 - 25109.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
D. Heitzmann and R. Warth
Physiology and Pathophysiology of Potassium Channels in Gastrointestinal Epithelia
Physiol Rev, July 1, 2008; 88(3): 1119 - 1182.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
E. Gordon, G. Panaghie, L. Deng, K. J. Bee, T. K. Roepke, T. Krogh-Madsen, D. J. Christini, H. Ostrer, C. T. Basson, W. Chung, et al.
A KCNE2 mutation in a patient with cardiac arrhythmia induced by auditory stimuli and serum electrolyte imbalance
Cardiovasc Res, January 1, 2008; 77(1): 98 - 106.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
D. Heitzmann and R. Warth
No Potassium, No Acid: K+ Channels and Gastric Acid Secretion
Physiology, October 1, 2007; 22(5): 335 - 341.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
B. L. vanTol, S. Missan, J. Crack, S. Moser, W. H. Baldridge, P. Linsdell, and E. A. Cowley
Contribution of KCNQ1 to the regulatory volume decrease in the human mammary epithelial cell line MCF-7
Am J Physiol Cell Physiol, September 1, 2007; 293(3): C1010 - C1019.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. H. Park and F. Sesti
An Arrhythmia Susceptibility Gene in Caenorhabditis elegans
J. Biol. Chem., July 6, 2007; 282(27): 19799 - 19807.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. M. Sidani, P. Kirchhoff, T. Socrates, L. Stelter, E. Ferreira, C. Caputo, K. E. Roberts, R. L. Bell, M. E. Egan, and J. P. Geibel
{Delta}F508 Mutation Results in Impaired Gastric Acid Secretion
J. Biol. Chem., March 2, 2007; 282(9): 6068 - 6074.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
G. Panaghie and G. W. Abbott
The Role of S4 Charges in Voltage-dependent and Voltage-independent KCNQ1 Potassium Channel Complexes
J. Gen. Physiol., January 29, 2007; 129(2): 121 - 133.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. Thomas, M. J. Killeen, I. S. Gurung, P. Hakim, R. Balasubramaniam, C. A. Goddard, A. A. Grace, and C. L.-H. Huang
Mechanisms of ventricular arrhythmogenesis in mice following targeted disruption of KCNE1 modelling long QT syndrome 5
J. Physiol., January 1, 2007; 578(1): 99 - 114.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/33/23740    most recent
M604155200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roepke, T. K.
Right arrow Articles by Abbott, G. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roepke, T. K.
Right arrow Articles by Abbott, G. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement