Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M601813200 on June 8, 2006

J. Biol. Chem., Vol. 281, Issue 33, 23932-23944, August 18, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/33/23932    most recent
M601813200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tao, J.
Right arrow Articles by Malbon, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tao, J.
Right arrow Articles by Malbon, C. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Regulation of AKAP-Membrane Interactions by Calcium*

Jiangchuan Tao{ddagger}, Elena Shumay{ddagger}, Stuart McLaughlin§, Hsien-yu Wang§, and Craig C. Malbon{ddagger}1

From the Departments of {ddagger}Pharmacology and §Physiology and Biophysics, School of Medicine, Heath Sciences Center, State University of New York, Stony Brook, New York 11794-8651

Received for publication, February 24, 2006 , and in revised form, June 7, 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The AKAP gravin is a scaffold for protein kinases, phosphatases, and adaptor molecules obligate for resensitization and recycling of beta2-adrenergic receptors. Gravin binds to the receptor through well characterized protein-protein interactions. These interactions are facilitated ~1000-fold when gravin is anchored to the cytoplasmic leaflet of the plasma membrane. Although the N-terminal region (~550 residues) is highly negatively charged and probably natively unfolded, it could anchor gravin to the inner leaflet through hydrophobic insertion of its N-terminal myristate and electrostatic binding of three short positively charged domains (PCDs). Loss of the site of N-myristoylation was found to affect neither AKAP macro-scopic localization nor AKAP function. Synthetic peptides corresponding to PCD1-3 bound in vitro to unilamellar phospholipid vesicles with high affinity, a binding reversed by calmodulin in the presence of Ca2+. In vivo gravin localization is regulated by intracellular Ca2+, a function mapping to the N terminus of the protein harboring PCD1, PCD2, and PCD3. Mutation of any two PCDs eliminates membrane association of the non-myristoylated gravin, the sensitivity to Ca2+/calmodulin, and the ability of this scaffold to catalyze receptor resensitization and recycling.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
A-kinase anchoring proteins (AKAP)2 are scaffolds essential for cell signaling (1). Gravin (a.k.a. AKAP250, AKAP12, SSeCKS) is a large AKAP with multivalency for cAMP-dependent kinase (PKA) and C (PKC), phosphoprotein phosphatases (such as PP2B), adaptor molecules, as well as for the G protein-coupled beta2-adrenergic receptor (beta2AR) (2). Gravin interacts with the beta2AR through a conserved receptor-binding domain (RBD) and is essential for resensitization and recycling of beta2AR following agonist-induced desensitization/internalization (3). Gravin has four regions that could help anchor it to cell membrane (4), i.e. a putative N-myristoylation site (5) and three small, positively charged basic domains (PCD) (6). The three PCDs in gravin are reminiscent of the basic/hydrophobic clusters in the effector domain of the myristoylated alanine-rich C kinase substrate (MARCKS) (7), the juxtamembrane region of ErbB (8), the C-terminal region of the NMDA receptor (9), and N-terminal region of AKAP79 (10, 11). Although not identical or homologous in sequence, these basic/hydrophobic regions in the other proteins (e.g. MARCKS) are all capable of binding to membranes and Ca2+/CaM with significant affinity.

We explore herein how the myristate and three N-terminal PCDs contribute to membrane binding, and thus to the function of gravin. Why is membrane binding important? It localizes gravin to the plasma membrane, where it experiences ~1000-fold higher effective concentration of membrane bound beta2AR because of the well established "local concentration" or "reduction of dimensionality" effect (12). Membrane binding could be important for function, as it is for many other signaling molecules such as Src, protein kinase C (PKC), etc. Using an N-terminal-tagged gravin that cannot be myristoylated, we show that two PCDs are required for functioning of gravin in resensitization and recycling. We also show membrane binding, and thus function, can be reversed by Ca2+/CaM, which binds to each of the PCD with a sufficient affinity to compete with the membrane and cause translocation of gravin from membrane to cytoplasm.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
HA Tag and CFP Fusion Proteins—The HA-tagged fusion proteins of gravin, N-terminal-truncated HA-gravin, and C-terminal-truncated HA-gravin mutants were constructed as previously described (3) and inserted into an expression vector. To generate HA-tagged short, positively charged calmodulin-binding domains (PCD), the sense primers contained 5'-NheI site, and nucleotides encoding the HA tag (YPYDVPDYALV) followed by nucleotides corresponding to 171-177 (for PCD1) and amino acids 297-303 (for PCD2), and amino acids 510-516 (for PCD3). The antisense primers that were synthesized corresponded to amino acids 191-197 (for PCD1) and amino acids 314-320 (for PCD2), and amino acids 531-537 (for PCD3) of human gravin, with the addition of a BamH1 restriction site, following the stop code. The PCR products were cloned into pcDNA3 (Invitrogen) between NheI and BamHI restriction sites.

To generate HA tag gravin in which PCD1 and PCD2 regions were deleted (Gravin {Delta}PCD1,2), the sense primer contained a 5'-NheI site and nucleotides encoding the HA tag (YPYDVP-DYALV) in the front of the N terminus of gravin. The antisense primer corresponding to the sequence of gravin from 488-510 followed by ACC1 site (CCGGTCGACAATATCATTAGCCTGGGACTCAG). For the second fragment, the sense primer contain the ACC1 site corresponding to the sequence of gravin (CCGGTCGACACAGAAGAAGACGGAAAGGC), the anti-sense primer contain a BamHI site corresponding to the sequence of gravin (AGCAAGGATCCCGTCTGTCCCCGTCTC). The PCR products were cloned into pcDNA3 (Invitrogen) between NheI and BamHI sites to generate a mutant form of gravin in which PCD1 and PCD2 are deleted. A similar approach was employed to delete the other pairs of PCDs in gravin. Briefly, to generate HA-tagged gravin with deletions of PCD1 and PCD3, primers were designed to delete amino acids 172-190. A restriction enzyme cutting site XhoI was inserted to delete PCD1. For the deletions of PCD3, amino acids 510-536, a restriction enzyme cutting site EcoRI was introduced by PCR. To generate HA-tagged gravin in which PCD2 and PCD3 are deleted, primers were designed to delete amino acids 296-317 by engineering a restriction enzyme cutting site XhoI to delete PCD2, followed by use of primers to delete PCD3, amino acids 510-536, to introduce a restriction enzyme cutting site EcoRI by PCR. The glycine-to-alanine substitution mutant G2A of gravin-GFP was engineered by standard protocol for PCR-mediated mutagenesis. All of the polymerase chain reactions were performed using Pfu polymerase (Stratagene). The identity of the amplified sequences was confirmed by direct DNA sequencing.

Gravin-CFP and gravin {Delta}PCD1,2-CFP were constructed in a technical manner very similar to that employed for HA-tagged gravin and HA-tagged gravin {Delta}PCD1,2, except that the vector used in this case was CFP-N1 (Clontech) and the C-terminal of gravin (lacking a stop code) was followed by the CFP moiety as a fusion protein. PCD1-CFP and PCD2-CFP were generated similar to that employed for HA-PCD1 and HA-PCD2, except that CFP-N1 (Clontech) was used as vector and the C-terminal of each peptide (without stop code) were followed by CFP moiety to create a fusion protein. All of the polymerase chain reactions were performed using Pfu polymerase (Stratagene). The identity of the amplified sequences was confirmed by direct DNA sequencing.

Cell Culture—Human epidermoid carcinoma cells (A431) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (HyClone, Logan, UT), penicillin (60 µg/ml), and streptomycin (100 µg/ml) and grown in a humidified atmosphere of 5% CO2 and 95% air at 37 °C.

Expression of HA- and Fluorophore-tagged Mutant and Wild-type Versions of Gravin—A431 cells were transfected with expression vectors harboring either gravin-GFP or a truncated version of gravin-CFP using Lipofectamine® (Invitrogen), according to the manufacturer's protocol. The viable clones were selected in the presence of 400 µg/ml of the neomycin analogue G418. Resistant colonies were subcloned and screened for GFP or CFP fusion protein expression by fluorescence microscopy. Cells transfected with HA-tagged gravin were selected in 200 µg/ml of the hygromycin and screened for expression of an HA-tagged fusion protein by SDS-PAGE of whole cell lysates followed by immunoblotting, using anti-HA antibodies.

Calmodulin Binding Assay—HA-tagged gravin and HA-tagged truncated gravin, or the HA-tagged, suspected CaM-binding regions were expressed in A431 cells by transient transfection. Cells were harvested and lysed in a lysis buffer (50 mM Tris-HCl, pH 7.5, 2 mM CaCl2, 150 mM NaCl, 1% Triton X-100, 0.5% Nonidet-40, 5 µg/ml aprotinin, 5 µg/ml leupeptin, 100 µg/ml bacitracin, 100 µg/ml benzamidine). Cell lysates were subject to filtration though a column packed with Sepharose-4B to which CaM was covalently attached. The column chromatography was performed according to the instruction of the manufacturer (Amersham Biosciences). Proteins and/or peptides retained by the immobilized CaM were eluted from the matrix by stripping the Ca2+ from the matrix using a 50 mM Tris-HCl, pH 7.5, 150 mM NaCl buffer containing 2 mM EDTA. The eluted proteins were dialyzed against 10 mM Tris-HCl, pH 7.5 buffer and the resultant-dialyzed proteins were concentrated by a vacuum centrifugation. The purified proteins were subjected to SDS-PAGE on 10-20% acrylamide gels and the separated proteins were transferred electrophoretically from the gel to the nitrocellulose membrane. The HA-tagged proteins and/or peptides were stained in the blots by making use of an anti-HA antibody. The immune complexes were detected using a horseradish peroxidase-conjugated secondary antibody, in combination with the chemiluminescence reagent, and a brief autoradiography of Kodak X-Omat film.

Binding of PCD Synthetic Peptides to Vesicles and to Calmodulin—Peptides corresponding to the three PCDs shown in Fig. 2 were synthesized with a Cys residue added to the N terminus; the ends were blocked with acetyl and amide groups. The peptides were labeled with radioactive N-[3H]ethylmaleimide (NEM) as described previously (7, 13), the labeled peptide purified by HPLC, and the purity checked by mass spectroscopy. We measured the binding of these [3H]NEM-labeled peptides to sucrose-loaded PC/PS 100 nm diameter large unila-mellar vesicles (LUVs) using a centrifugation technique described previously (7, 13). Briefly, sucrose-loaded PC/PS LUVs were mixed with labeled peptide (2-10 nM) and the mixture centrifuged at 100,000 x g for 1 h to spin down the vesicles and bound peptide. The percentage of bound peptide was calculated from the radioactivity of the peptide in both the supernatant and in the pellet using Equation 1. As considered in detail elsewhere (14-16), we describe the nonspecific binding or partitioning of the basic/hydrophobic PCD peptides to phospholipid vesicles using Equation 1,

Formula(Eq.1)

where [P]mem/[P]tot is fraction of peptide bound to membranes, [L]acc is the accessible lipid concentration (one-half the total lipid concentration because we add the peptide to preformed vesicles), and K is the molar partition coefficient. (An identical equation results if one assumes, incorrectly, that the peptide forms a 1:1 complex with a lipid.)

We used a modified version of Equation 1 to describe the effect of Ca2+/CaM on the membrane binding of the PCD peptides, incorporating the assumption that Ca2+/CaM and the membrane compete for the peptide (8) in Equation 2,

Formula(Eq.2)

where KCaCaM is the association constant of the peptide with Ca2+/CaM. Special conditions were required to estimate the binding of the PCD1 peptide to membranes and to calmodulin. It is apparent from Fig. 2 that the PCD1 region has fewer basic (blue) and more hydrophobic (green) residues than either the PCD2 or PCD3 regions. Thus a peptide corresponding to PCD1 will have the greatest tendency to aggregate in solution. Although the PCD1 peptide, gravin (171-187), appeared to dissolve in solution by visual inspection, it clearly formed aggregates because this peptide (unlike the PCD2 and PCD3 peptides) was significantly removed from solution by centrifugation. Thus measurements corresponding to Fig. 3A with PCD1 peptide (not shown), and those shown in Fig. 3C were conducted with 0.01% Triton X-100 added to the solutions to solubilize the peptide. Addition of detergent will decrease the affinity of the peptide for the membrane (and probably Ca2+/CaM), so the affinity values reported in Table 1 for gravin (171-187) should be regarded as underestimates. As a control, we studied the effect of Triton X-100 on the membrane binding of the (apparently soluble) gravin (297-317) peptide. In experiments similar to those illustrated in Fig. 3A with 2:1 PC/PS vesicles, we found that the K value decreased exponentially (binding energy decreased linearly) with the % detergent over the range from 0 to 0.025%. Fortunately, the value extrapolated from the measurements with detergent agreed well with the actual value measured in the absence of detergent for gravin (297-317), suggesting the peptide is present as a monomer in the absence of detergent. The observation that a 2-fold increase in peptide concentration did not affect the value of K is also consistent with the assumption the peptides are binding as monomers to the membrane.


View this table:
[in this window]
[in a new window]
 
TABLE 1
Binding of gravin PCDs to artificial lipid vesicles

Binding of peptides corresponding to the indicated sequences of gravin either to membranes or to Ca2+/CaM. K is the molar partition coefficient for the binding of the peptides to 5:1 PC/PS vesicles, determined from Equation 1 as illustrated in Fig. 3A for gravin(510-536), and similar experiments (not shown) for the other peptides. Gravin-(171-187) binds to 99:1 PC/PIP2 vesicles (K = 1 x 105 M–1) with 10-fold higher affinity than to 5:1 PC/PS vesicles. Other basic peptides exhibit a similar high affinity for polyvalent PIP2 vs monovalent PS (13), as discussed elsewhere (21). KCa/CaM is the affinity of the peptide for Ca2+/CaM determined from Equation 2 (see "Experimental Procedures") using the competition assays illustrated in Fig. 3, B-D. The sequences of the peptides are shown in Fig. 2.

 
Confocal Microscopy—A431 cells stably expressing gravin-GFP, truncated gravin-CFP, or HA-tagged gravin and propagated on glass slides were either left untreated or stimulated with 10 µM isoproterenol for 30 min, 10 µM A23187 [GenBank] for 30 min, or 20 µM BAPTA-AM for 6 h and then washed twice with Hank's balanced salt solution, fixed (2% paraformaldehyde, pH 7.2). For immunostaining studies, cells were permeabilized and stained with anti-HA antigen rabbit antibodies used in combination with anti-rabbit Texas Red antibodies (Molecular Probes). Stained objects were imbedded in ProLong (Molecular Probes) anti-fade reagent. Images were acquired on the Zeiss LCM510 microscope using argon and helium-neon lasers (oilimmersion, x63 objective). Serial sections were acquired as a Z-stack. Z-stacks of images were exported as TIFF files and processed in Adobe Photoshop 5.5.

FPLC Calmodulin Binding Assay—HA-tagged PCD1, -PCD2, and -PCD3 fragments, each were expressed via transient transfection into A431 cells. Cells were harvested and lysed in a lysis buffer (50 mM Tris-HCl, pH 7.5, 2 mM CaCl2, 150 mM NaCl, 1% Triton X-100, 0.5% Nonidet P-40, 5 µg/ml aprotinin, 5 µg/ml leupeptin, 100 µg/ml bacitracin, 100 µg/ml benzamidine). Cell lysates were subjected to column chromatography on CaM-immobilized Sepharose-4B matrix. Bound peptides were eluted from the medium by stripping the matrix of Ca2+ using a gradient of EDTA (0-3 mM). The eluted fractions were collected at 1-ml intervals. The eluted proteins were dialyzed in 10 mM Tris buffer pH 7.4 to remove salt and concentrated in a vacuum centrifugation. The purified proteins were separated by 10-20% SDS-PAGE, transferred electro-phoretically to nitrocellulose blots, and the resolved proteins stained by immunoblotting using anti-HA antigen primary antibodies.

Knockdown Studies of Gravin—Antisense morpholino oligonucleotides (morpholins) were synthesized and purified to cell culture grade (Gene Tools, LLC). Before addition to A431 cells, morpholinos were mixed at a ratio of 1:1 (w/w) with EPEI special delivery solution (Gene Tools, LLC). Cells were treated with morpholinos (5 µg/ml) for 3 days. An additional treatment with morpholinos was performed prior to transfection of the cells with either wild-type or mutant forms of gravin. Following this protocol, cells were analyzed for beta-adrenergic agonist-induced (i.e. isoproterenol, 10 µM) desensitization and recovery (i.e. resensitization) after washout of agonist. The suppression of gravin expression was confirmed by SDS-PAGE of whole cell lysates followed by immunoblotting. Similarly, loading controls were established by immunoblotting of actin. Identical treatment of the cultures with "scrambled" sequence morpholinos (designed by the commercial supplier) were employed as a control.

Protocols for Desensitization and Resensitization of beta2AR—Two days prior to the analysis of agonist-induced desensitization, the A431 cells were seeded in 96-well microtiter plates at a density of 25,000-50,000 cells/well. Routinely cells were serum-starved overnight, prior to analysis. Desensitization was accomplished by pretreating the cells with the beta-adrenergic agonist isoproterenol (10 µM) for 30 min. Under these conditions, subsequent beta-adrenergic stimulation of cyclic AMP accumulation is severely blunted and the number of cell-surface receptors declines precipitously as the receptors are sequestered and internalized (17). Details of the desensitization protocol are described elsewhere (18).

Analysis of beta2AR Internalization and Recovery of beta2AR to the Cell Membrane—The internalization of beta2AR correlates well with the extent of agonist-induced desensitization. Using the binding of a cell-impermeant, radiolabeled antagonist for the determination of cell surface beta2ARs, the functional status of the recovery of internalized beta2AR could be assayed with great accuracy. Cultures of A431 cells were treated with isoproterenol for 30 min (i.e."desensitized") or treated with isoproterenol for 30 min then washed free of agonist for 60 min (i.e."resensitized"). The cells then were washed with ice-cold phosphate-buffered saline and resuspended in DMEM containing 20 mM HEPES (pH 7.4) and the hydrophilic, membrane-impermeant beta2-adrenergic antagonist [3H]CGP-12177 (70 nM). Binding was performed at 4 °C for 6 h. The cells were diluted, collected on GF/C membranes at reduced pressure, and washed rapidly. The radioligand bound to the washed cell mass on the filter represents a direct assay of the cell surface complement of receptors. The amount of bound ligand was quantified by liquid scintillation spectrometry (18, 19).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
N-Myristoylation of Gravin Is Not Required for Function—Human gravin possesses the N-terminal sequence N-MGAGSSTEQR, a well known signal recognition sequence for N-myristoylation (5, 20), a co-translational modification affording weak protein-membrane interactions. Gravin (Mr ~250,000) was engineered either with the hemagglutinin tag (HA-gravin) at the N terminus (effectively precluding N-myristoylation) or as a fusion protein with the enhanced green fluorescent protein at the C terminus (gravin-GFP, Mr ~275,000), and stably expressed in human epidermoid carcinoma A431 cells (Fig. 1A). Confocal microscopy of cells shows HA-tagged gravin and gravin-GFP throughout the cell, except in the nucleus, and prominent at the cell membrane (Fig. 1B). Membrane-associated gravin is labeled with white arrows, whereas the cytosolic gravin is labeled with yellow arrowheads. The macroscopic pattern of localization for gravin was unaffected by the loss of the N-myristoylation (Fig. 1B).


Figure 1
View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 1.
Blockade of gravin N terminus and N-myristoylation does not alter cell membrane localization. A431 cells were transfected with expression vector harboring either gravin tagged at the N terminus with the HA antigen (HA-gravin) or a fusion protein of gravin fused C-terminally with enhanced green fluorescent protein (gravin-GFP). A, whole cell lysates were prepared and subjected to SDS-PAGE, transferred to nitrocellulose, and the blots probed with an antibody against gravin, against the HA antigen, or against the GFP moiety. B, A431 clones stably expressing the gravin-GFP and the HA-tagged gravin were analyzed by confocal microscopy in the unstimulated, basal state. The HA-tagged gravin was stained with anti-HA antibodies and a fluorescent secondary antibody. The results are typical of more than five separate experiments performed on as many separate clones. Gravin or gravin mutants associated with the cell membrane are labeled with white arrows; whereas those found in the cytoplasmic compartment are labeled with yellow arrowheads. C, A431 cells were untreated (Control) or treated with antisense morpholinos against gravin to knock down the expression of endogenous gravin (gravin KD). The antisense morpholino-treated cells were employed as such or transiently transfected with an expression vector harboring a gravin G2A mutant deficient (gravin-GFP (G2A)) or a full-length, wild-type gravin (WT gravin). Cells were desensitized with beta-adrenergic agonist (isoproterenol 10 µM, +Iso) for 30 min and the amount of cell surface-associated beta2AR measured either using the cell impermeant radiolabeled antagonist CGP as a ligand. Following 30 min of agonist treatment, half of the cells were washed free of the isoproterenol (Wash out) and incubated for a 60-min recovery phase of resensitization when the receptors recycle to the cell membrane. Cell surface-associated CGP binding was measured after the 60 min washout and recovery phase. The results, displayed as mean values ± S.E., are of at least three separate experiments performed with as many separate cultures of A431 cells.

 
To test the functional role of N-myristoylation itself on gravin function, we compared the functional capabilities of wild-type (WT) gravin to that of a gravin-GFP (G2A) mutant. To assess function, we first treated cells with isoproterenol (10 µM, 30 min; +ISO) to promote agonist-induced desensitization and internalization of beta2AR (Fig. 1C). Cells made deficient of gravin (knockdown, KD) through treatment with antisense morpholinos fail to display recycling of agonist-stimulated internalized beta2AR (gravin KD), as measured by radioligand binding experiments with the cell-impermeant beta-adrenergic antagonist [3H]CGP-12177 that can only access cell surface beta2AR. At 60-min postwashout of the isoproterenol (W60), knockdown of gravin attenuates the recycling of internalized beta2AR. beta2AR internalized in response to agonist treatment do not recycle in the gravin-KD cells (Fig. 1C). We compared the ability of expression of wild-type (myristoylated) gravin versus that of the G2A mutant of gravin (non-myristoylated) to rescue the recycling of internalized beta2AR in cells in which endogenous gravin was suppressed. Expression of either the wild-type gravin or the G2A gravin mutant reconstituted the ability of the cells to rescue the recycling of the internalized beta2AR. These observations demonstrate that N-myristoylation itself is not required for gravin function. Similarly, gravin tagged on the N terminus with the HA antigen has been shown to function normally (3). Thus wild-type gravin, unlike Src and MARCKS (which use myristate and a single PCD), does not require the myristate for membrane localization and function, although we cannot rule out that N-mysritoylation might facilitate some other subtle albeit important aspect of membrane localization for the AKAP. In view of these data, we adopted the use of the HA-tagged gravin which cannot be myristoylated in some of these studies.


Figure 2
Figure 2
View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 2.
Sequence location and CaM binding potential of three small positively charged domains (PCD1, PCD2, and PCD3) of human gravin. A, the sequence of human gravin was scanned for two motifs, the effector domain of the MARCKS protein and for CaM binding sites. Two other landmarks of gravin are displayed: the AKAP sites that constitute the beta2-adrenergic receptor binding domain; and the binding site for the RII subunit of PKA. These data were obtained using ProSite software. B, full-length HA-tagged, C-terminal and N-terminal truncated gravin mutants were generated for analysis of their ability to bind to CaM immobilized to Sepharose-4B in the presence of Ca2+. Upper panel C, HA-tagged gravin and mutant forms were expressed in A431 cells, whole cell lysates of the cells were subjected to SDS-PAGE, immunoblotted, and stained with anti-HA antibodies. Lower panel C, fragments of gravin that were retained by immobilized CaM matrix, released from the matrix using buffer containing EDTA, subjected to SDS-PAGE, immunoblotted and stained with anti-HA antibodies. The data presented are representative of at least three separate determinations, each performed with separate cell lysates.

 
Identification of Three MARCKS Effector Domain-like Regions in Gravin—We and others have identified three positively charged domains (PCDs) in gravin (4, 6) that are similar to the positively charged "effector domain" of MARCKS (21). These PCDs all contain both basic (blue: Lys, Arg) and hydrophobic (green; Phe, Met, Leu, Val, Cys, Trp) residues, but lack acidic residues: PCD1 (171GFKKVFKFVGFKFTVKK187); PCD2 (297KKFFTQGWAGWRKKTSFRKPK317); and, PCD3 (510KVQGSPLKKLFTSTGLKKLSGKKQKGK536). These PCDs are found in the N terminus of gravin and in the mouse SSeCKS (4) (Fig. 2A). We hypothesize each of these regions can act in a manner similar to the effector domain of MARCKS protein, i.e. bind electrostatically to acidic lipids on the inner leaflet of the plasma membrane and have this binding reversed by Ca2+/CaM (21). Analysis of the N-terminal domain of gravin using the programs PONDR (22) and FOLDINDEX (23) (as well as a simple coloring scheme: red, acidic; blue, basic; green, hydrophobic) suggests the entire region is "natively unfolded" (24). That is, it has a high density of negatively charged residues and a paucity of either basic or hydrophobic residues (except for the three PCDs). This N-terminal region of gravin is similar to the MARCKS protein, which is natively unfolded and is highly negatively charged except for the single basic/hydrophobic effector domain. The three PCD regions of gravin, and the comparable region of AKAP79 (31KASMLCFKRRKKAAKALKPKAG52) (25), all contain both basic and hydrophobic residues, but lack acidic residues. Hence they would be predicted to bind electrostatically to the negatively charged inner leaflet of the plasma membrane and have the potential to bind Ca2+/CaM with biologically significant affinity. Although others have speculated that CaM may bind to sequences common to gravin and AKAP79, the role of Ca2+/CaM in regulation of AKAP-based signaling, localization, and function is not fully understood (4). The working hypothesis is that each of the three PCDs helps anchor gravin to the membrane (6), and that each binds Ca2+/CaM with significant affinity to reverse the membrane binding. PCDs help direct the proteins such as K-Ras4B to the plasma membrane rather than to internal membranes, as the former has a more negative electrostatic surface potential (26, 27).

We first examined HA-gravin and HA-gravin mutants with targeted deletions of the basic putative Ca2+/CaM binding PCDs. The constructs were designed (Fig. 2B), expressed in A431 clones and tested to determine qualitatively if they were capable of binding Ca2+/CaM (Fig. 2C, upper panel). Full-length gravin (1-1782), the N terminus (1-362) harboring PCD1 and PCD2, as well as the larger gravin (1-652) C-terminal truncate harboring PCD1, PCD2, and PCD3 all displayed binding by immobilized CaM-Sepharose 4B (CaM-matrix). The 554-938 region of gravin also displayed the capacity to bind to the CaM-matrix. In silico analysis of the primary sequence of the 554-938 gravin fragment reveals a possible CaM-binding sequence (670-694). Unlike PCD1, PCD2, and PCD3, the 670-694 gravin region does not display the structural character of the effector domain of the MARCKS protein, did not display significant binding to lipid vesicles (not shown), and was not investigated further in this study of domains involved in membrane association of gravin. Gravin fragments PCD1, PCD2, and PCD3 that were retained on the CaM-matrix were released by chelation of buffer Ca2+ with molar excess of EDTA (Fig. 2C, lower panel). The C-terminal region of the AKAP (840-1783), in contrast, failed to bind to the immobilized CaM matrix (Fig. 2C). Similar experiments were performed with the three PCD peptides (minus flanking gravin sequences). Each peptide was successfully expressed in A431 cells and each showed qualitatively the same retention by the CaM matrix and release by exposure to molar excess of EDTA (data not shown). The affinity of these gravin fragments for Ca2+/CaM cannot be readily deduced from these CaM matrix experiments. A more quantitative test of the hypothesis was conducted by studying directly the binding of synthetic PCD peptides of gravin to phospholipid vesicles.

We synthesized radioloabeled peptides corresponding to gravin PCD1, PCD2, and PCD3 and measured their membrane and Ca2+/CaM binding affinities. The inner leaflet of a mammalian plasma membrane typically contains between 15-30% acidic lipid, mainly phosphatidylserine. Thus we measured the equilibrium binding to 5:1 and 2:1 phosphatidylcholine (PC)/phosphatidylserine (PS), large unilamellar vesicles (100 nm diameter, LUVs) using a centrifugation technique (8). The results of the membrane binding assay for PCD3 show that this peptide binds strongly to the PC/PS vesicles (Fig. 3A). The affinity increases with the mol fraction of negatively charged PS in the vesicles: it binds 50-fold more strongly to the 2:1 than to the 5:1 PC/PS vesicles. Similar measurements on vesicles containing 10 and 25% acidic lipid (not shown), when combined with the data in Fig. 3A, reveal the binding affinity increases exponentially with the fraction of acidic lipid in the membrane (binding energy increases linearly with fraction of PS), as expected theoretically for nonspecific electrostatic interactions (15) and observed experimentally for the MARCKS effector domain peptide (28) and other basic/hydrophobic peptides (21). PCD1 and PCD2 each bind with qualitatively similar affinities to 5:1 PC/PS vesicles as does PCD3 (Table 1). In other experiments (not shown), we observed that the affinity of PCD1 to bind PC vesicles that contain only 1% PIP2 was even higher than that for PC/PS vesicles that contain 17% PS (Table 1).

Ca2+/CaM, but not apocalmodulin, binds to the PCD3 peptide with sufficient affinity to prevent its association with the membrane (Fig. 3B). In the absence of calmodulin, we chose conditions such that 90% of the peptide is bound to the vesicles or Kx [lipid] = 10: note that 100 nM Ca2+/CaM removes 50% of the peptide from the membrane, which implies that KCa/CaMx [Ca2+/CaM] = 10 or that the Kd of the Ca2+/CaM peptide complex is ~10 nM. Specifically, the curve is drawn according to Equation 2 (see "Experimental Procedures") with KCa/CaM = 108 M-1. The affinity of all three of the PCD peptides for Ca2+/CaM is very similar (Fig. 3, C and D). The Ca2+/CaM affinities (Kd ~10 nM) for all three peptides (see Table 1) are sufficiently high to be of biological significance, i.e. strong enough to displace the protein from the membrane even though most of the Ca2+/CaM in cells may be bound rather than free in the cytosol (29, 30).


Figure 4
View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 3.
Interactions of synthetic peptides corresponding to gravin PCDs to phospholipid vesicles: analysis of binding and Ca2+/calmodulin sensitivity. A, binding of radiolabeled synthetic peptide of gravin PCD3 (corresponding to residues 510-536) to phospholipid vesicles (LUVs) of 2:1(bullet) and 5:1({blacksquare}) PC/PS composition. The aqueous solutions contain 100 mM KCl, 1 mM MOPS, pH 7. The % peptide bound is determined from a centrifugation assay. The curves through the points illustrate the fit of Equation 1 to the data. The reciprocal of the lipid concentration that binds 50% of the peptide is the molar partition coefficient, K. For the 5:1 PC/PS vesicles K ~104 M-1, as indicated by the dashed line. For the 2:1 PC/PS vesicles, K = 5 x 105 M-1. B, Ca2+/CaM ({circ}), but not apocalmodulin (bullet), binds strongly to PCD3 and can reverse the binding to 2:1 PC/PS vesicles. The % membrane bound peptide is plotted as a function of the concentration of calmodulin in the presence (free [Ca2+] ~20 µM (bullet)) or absence ({circ}) of Ca2+. The solutions contain 100 mM KCl, 1 mM MOPS, pH 7, 100 µM EGTA ± 120 µM CaCl2. The curve illustrates the prediction of Equation 2 with the association constant of the peptide with Ca2+/CaM, KCa/CaM = 108 M-1 (dissociation constant Kd = 10 nM). C and D, Ca2+/CaM reverses membrane binding of PCD1 (panel C) and PCD2 (D) peptides, corresponding to residues 171-187 and 297-317 of gravin, respectively. Binding to PC/PS (5:1) vesicles was measured in either the presence or absence of Ca2+ and increasing concentrations of CaM. The curves represent the best fit of Equation 2 to the data; the calculations take into account the competition between membrane and Ca2+/CaM for the peptide. The association constants of the PCD1 and PCD2 peptides with Ca2+/CaM deduced from these fits are KCa/CaM = 5 x107 M-1 and 2 x 108 M-1, respectively; apparent Kd = 20 and 5 nM, respectively.

 
Intracellular Calcium Regulates Membrane Localization of Gravin—The ability of Ca2+/CaM to neutralize the binding of gravin PCD1, PCD2, and PCD3 peptides to vesicles in vitro prompted study of the effects of changing intracellular concentrations of free Ca2+ on localization of the AKAP gravin. To increase intracellular Ca2+, cells expressing native (i.e. myristoylated) gravin-GFP were treated with the Ca2+ ionophore A23187 [GenBank] in the presence of normal extracellular Ca2+. In the absence of the Ca2+ ionophore, gravin-GFP is observed throughout the cytoplasm (yellow arrowheads) and in abundance at close proximity to the cell membrane (white arrows, Figs. 1B and 4A, left panel). Thirty minutes after ionophore/Ca2+ treatment, cells assumed a more rounded morphology and gravin-GFP was found to redistribute uniformly throughout the cytoplasm (Fig. 4A, center panel). Thus, increasing intracellular concentration of Ca2+ decreases the ability of gravin to localize to the cell membrane. Complementary studies in cells preloaded with the Ca2+-buffering agent BAPTA-AM ester demonstrated gravin localization prominently at the cell membrane (Fig. 4A, right panel).

A 1-362 C-terminally truncated gravin harboring PCD1 and PCD2 (but not PCD3) was fused with the cyan fluorescent protein CFP (1-362 gravin-CFP, Fig. 4B). As noted for gravin, the 1-362 gravin-CFP displays localization to the membrane and to the cytoplasm. Treating cells with Ca2+ ionophore provoked a sharp loss in the amount of cell membrane-associated 1-362 gravin-CFP. Buffering the intracellular Ca2+ with BAPTA, in contrast, increased the amount of 1-362 gravin-CFP associated with the cell membrane, mimicking the Ca2+-dependent localization of the full-length AKAP to the membrane (compare panels A and B, Fig. 4). These results show that two PCDs are sufficient to essentially mimic the membrane binding properties of the wild-type gravin protein, in agreement with independent work (6).

If membrane binding of gravin is required for its interaction with receptor, decreasing the membrane binding by increasing the level of [Ca2+]i should inhibit the ability of gravin to recycle the receptor to the plasma membrane. Thus we tested the effects of increased [Ca2+]i on the ability of cells that were desensitized with isoproterenol (10 µM, 30 min) to display "resensitization" of cyclic AMP accumulation in response to a second stimulus of isoproterenol (10 µM) following a washout of agonist at 30 (W30), 45 (W45), and 60 (W60) min of duration post washout (Fig. 4C, upper panel). In the control cells, the resensitization of the cyclic AMP response to a second stimulus of isoproterenol is ~80% complete within 60 min of washout of the agonist. For the cells treated with the Ca2+ ionophore A23187 [GenBank] , however, the resensitization is largely attenuated. Treatment with the {alpha}1-adrenergic agonist phenylephrine (100 µM), known to increase intracellular concentrations of Ca2+, also attenuates the resensitization of the cyclic AMP response (Fig. 4C, lower panel).

In wild-type A431 cells, beta2AR are internalized within 30 min of treatment with agonist (isoproterenol 10 µM, + ISO). The amount of cell surface beta2AR was established by binding assays using [3H]CGP-12177. The amount of receptor on the cell surface declines sharply because of agonist-induced internalization of the receptor (Fig. 4D). The CGP binding studies comparing either ionophore-treated (A23187 [GenBank] ) or phenylephrine-treated cells to untreated, control cells demonstrate that increases in intracellular [Ca2+]i stimulated by treatment with either Ca2+ ionophore or by stimulating the cells with the {alpha}1-agonist phenylephrine (100 µM) do not affect the amount of agonist-induced internalization of the beta2AR at 30 min post-stimulation with isoproterenol (Fig. 4D, 30 min). The recycling of the internalized receptor to the cell surface observed 60 min following agonist washout, in sharp contrast, was markedly attenuated by increasing intracellular [Ca2+]i with ionophore or by stimulation of the cells with phenylephrine (Fig. 4D, W60).

Gravin Requires Two PCDs to Function in Recycling of beta2-Adrenergic Receptors—The functional role of AKAP's membrane association and of these small, positively charged PCDs was explored. Gravin acts as a "tool box" for a variety of docking proteins, including protein kinases and phosphoprotein phosphatases, that are necessary for normal biology of the beta2AR (2). In cells expressing endogenous gravin, beta2AR are internalized within 30 min of treatment with agonist (isoproterenol 10 µM, + ISO). Binding of the cell-impermeant [3H]CGP-12177 antagonist ligand again was used to quantify the amount of cell surface beta2AR (Fig. 5A). After a washout of agonist and a recovery period, CGP binding in control (Control) cells returns to normal within 60 min, as the beta2ARs are recycled back to the cell membrane. In cells made deficient of gravin by knockdown with antisense morpholinos (gravin-KD), beta-adrenergic agonists stimulate desensitization/internalization of beta2ARs normally (Fig. 5A), whereas resensitization/recycling of the receptor to the membrane is lost (Fig. 5A) (3, 31, 32).

To probe functional roles of PCDs in this AKAP, we deleted pairs of PCDs from HA-tagged gravin, either PCD1 and PCD2 ({Delta}PCD1,2), or PCD2 and PCD3 ({Delta}PCD2,3), or PCD1 and PCD3 ({Delta}PCD1,3). The deletion mutants of gravin were expressed in gravin-KD cells and beta2AR recycling to the cell membrane measured following agonist-induced internalization (Fig. 5, A-C). Depletion in endogenous gravin as well as expression of exogenous gravin were demonstrated by SDS-PAGE of whole cell lysates and subsequent immunoblotting (Fig. 5, A-C). beta2AR internalized in response to agonist recycles to the cell membrane in the control cells expressing endogenous gravin (wild-type, WT; control scrambled sequence morpholino, Control), but not in the cells in which gravin is made deficient (anti-sense morpholinos to gravin, gravin KD). Expression of the HA-tagged gravin{Delta}PCD1,2 in the gravin-KD cells (gravin KD +{Delta}PCD1,2) fails to rescue the inability of the gravin-KD cells to recycle the agonist-treated, internalized receptors back to the cell membrane. Expression of a wild-type gravin in the gravin KD cells (gravin KD + WT gravin), however, enables beta2AR recycling (Fig. 5A). Expression of the deletion mutants HA-tagged gravin({Delta}PCD2,3; Fig. 5B) and HA-tagged gravin({Delta}PCD1,3; Fig. 5C), like the ({Delta}PCD1,2; Fig. 5A) gravin mutant, displayed the same inability to recycle internalized beta2AR, as measured by CGP binding. Thus, the ability of gravin to function in receptor resensitization and recycling is lost when any pair of the PCDs is deleted in non-myristoylated gravin, suggesting that the localization of the gravin scaffold to the inner leaflet of the cell membrane is essential to the role of gravin in receptor recycling.

Confocal microscopy imaging of eGFP-tagged beta2AR confirmed the data obtained with the [3H]CGP-12177 binding (Fig. 6A), i.e. loss of two PCDs virtually abolishes the ability of the gravin to function in receptor recycling. beta2AR-eGFP located in the cell membrane is labeled with white arrows, whereas internalized beta2AR-eGFP is labeled with yellow arrowheads. In gravin-deficient cells, expression of wild-type gravin, but not {Delta}PCD1,2-gravin, rescues the ability of these cells to recycle internalized receptors to the cell membrane. Deletion of a single PCD alone (i.e. {Delta}PCD3) from gravin, in contrast, did not significantly alter the localization or the function of gravin (data not shown). The simplest interpretation is that two positively charges clusters (i.e. PCD1, PCD2, or PCD3) are required in tandem for membrane association and function of the HA-tagged gravin.

Gravin-beta2-Adrenergic Receptor Interactions Require PCDs—The association of gravin and beta2AR can be quantified by pull-down assays. Pull-downs of HA-tagged gravin and HA-tagged {Delta}PCD1,2 gravin were performed and the amount of gravin-associated beta2AR thereby assayed (Fig. 6B). For HA-{Delta}PCD1,2-gravin, the amount of beta2AR associated was ~50% less than that for pull-downs with HA-gravin. Although direct contact sites of gravin for the receptor map to the RBD located C-terminal to PCD1 and PCD2 (3), the presence of PCD1,2 is essential for full scaffold-receptor interactions (Fig. 6B). Thus, for the non-myristoylated gravin, interaction with the plasma membrane-localized GPCR requires at least two of the three PCDs.


Figure 5
View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 4.
Gravin association with the cell membrane and its role in receptor resensitization/recycling are regulated by intracellular concentration of Ca2+. A and B, the full-length gravin (gravin-GFP) and the gravin fragment harboring PCD1 and PCD2, and the PCD3 (1-362-gravin-CFP) N-terminal region of gravin were created as autofluorescent fusion proteins, expressed in A431 cells and examined by confocal microscopy. Cells expressing either gravin-GFP (A) or 1-362-CFP gravin (B) were studied either without treatment (Basal), or after a 30-min treatment with the Ca2+ ionophore A23187 in the presence of normal extracellular Ca2+ to raise intracellular Ca2+ (+A23187), or after a 6-h prior treatment with the Ca2+-buffering agent BAPTA-AM ester to reduce intracellular free Ca2+ concentrations (+BAPTA). Gravin and mutant gravin associated with the cell membrane is decorated with white arrows. Gravin or mutant gravin localized to the cytoplasm is decorated with yellow arrowheads. The results are representative of at least five separate experiments. C and D, cells were challenged with beta-adrenergic agonist (isoproterenol, 10 µM) to provoke agonist-induced desensitization and internalization. The agonist was washed out and the cells were either untreated (Control) or treated to raise intracellular [Ca2+]i using the Ca2+ ionophore A23187 in the presence of normal extracellular [Ca2+] or using the {alpha}1-adrenergic agonist phenylephrine (100 µM). The recovery from agonist-induced desensitization, termed "resensitization," was measured in cells at 30 (W30), 45 (W45), or 60 (W60) min following the washout. Isoproterenol-stimulated cyclic AMP accumulation was measured in these cells and the amount of cyclic AMP accumulation obtained with full recovery set as 100% (C). Parallel experiments were performed in which the amount of beta2AR lost from the cell surface, termed "internalized", in response to agonist-induced treatment was set as 100% (D). The results, displayed as mean values ± S.E., are of at least three separate experiments performed with as many separate cultures of A431 cells.

 


Figure 6
View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 5.
Gravin association with the cell membrane requires two PCDs. A-C, A431 cells were untreated (WT)) or treated with antisense morpholinos to knockdown (KD) the expression of endogenous gravin or treated with a control, scrambled sequence morpholino (Control). The antisense morpholino-treated cells were employed as such (gravin KD) or transiently transfected with an expression vector harboring an HA-tagged gravin mutant deficient of either PCD1, PCD2 ({Delta}PCD1,2, A), PCD2, PCD3 ({Delta}PCD2,3, B), PCD1, PCD3 ({Delta}PCD1,3, C), or an HA-tagged full-length, wild-type gravin (WT gravin). Cells were desensitized with beta-adrenergic agonist (isoproterenol 10 µM, +Iso) for 30 min and the amount of cell surface-associated beta2AR measured using the cell impermeant radiolabeled antagonist CGP as a ligand. Following 30 min of agonist treatment, half of the cells were washed free of the isoproterenol (Wash out) and incubated for a 60-min recovery phase of resensitization (W60), by when the receptors have fully recycled to the cell membrane. Cell surface beta2ARs were quantified at 0 min, at 30 min of stimulation by isoproterenol, or at 60 min following the wash out. CGP binding was measured after the 60 min washout and recovery phase. The results, displayed as mean values ± S.E., are of three separate experiments performed with as many separate cultures of A431 cells (A-C).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
In the current work we explored how gravin PCDs bind lipid vesicles, whether or not Ca2+/calmodulin alters gravin binding to membranes, and how membrane association impacts gravin-mediated beta2ARs resensitization and recycling after agonist-induced desensitization/internalization. Binding of gravin to the receptor under unstimulated conditions would appear too weak to occur unless gravin is bound to the inner leaflet of the cell membrane (Fig. 7). When gravin is bound to the cell membrane, the receptor-gravin interaction would benefit by a ~1000-fold increase in the local concentration of the scaffold with the membrane-embedded beta2AR (Fig. 7A). Agonist binding to the beta2AR activates the stimulatory adenylyl cyclase pathway and the PKA tethered to gravin (3). Activated PKA phosphorylates both the scaffold and receptor, dramatically enhancing their protein-protein interactions (Fig. 7B). Although not required itself for gravin function, myristate may facilitate further the interactions between the membrane and two PCDs required for binding. We cannot rule out the potential importance of the myristate in either membrane anchoring or lateral distribution, although the beta- and {gamma}-isoforms of gravin, lacking N-terminal myristoylation, appear to localize as does gravin (6). Our localization studies with gravin-GFP, compare well with those of gravin-beta-GFP (6). We measured quantitatively the binding affinities of peptides corresponding to each PCD in gravin to phospholipid vesicles and Ca2+/CaM. (As with the basic region of MARCKS, the PCDs in gravin probably bind to membranes with only about half the energy of the PCD peptides because flanking acidic residues in the protein reduce electrostatic interactions.) By functional studies we were able to show that the presence of two PCDs is essential to the ability of the non-myristoylated gravin to provoke beta2AR resensitization/recycling following classical agonist-induced desensitization. As with earlier studies (6), the current study does not reveal how many PCDs are essential to anchor myristoylated isoforms of gravin to the membrane, in enabling beta2AR recycling. Myristate itself does not provide enough energy to anchor a protein to the plasma membrane (14): both Src and MARCKS require a PCD in addition to myristate. Thus, we are confident that at least one, and possibly two, PCD might be required for membrane anchoring of the myristoylated forms of gravin. In this regard, we did demonstrate that Ca2+/CaM produce translocation of native myristoylated gravin from membrane to the cytosol and block beta2AR recycling.


Figure 7
View larger version (72K):
[in this window]
[in a new window]
 
FIGURE 6.
Recycling of beta2AR requires gravin with two intact PCDs. A, A431 cells were untreated (control) or treated with antisense morpholinos to knockdown the expression of endogenous gravin (gravin KD). The antisense morpholino-treated cells were employed as such (gravin KD) or transiently transfected with an expression vector harboring either an HA-tagged gravin mutant deficient of PCD1, PCD2 ({Delta}PCD1,2) or an HA-tagged full-length, wild-type gravin (WT gravin). Cells were desensitized with beta-adrenergic agonist (isoproterenol 10 µM, +Iso) for 30 min and localization of beta2AR-eGFP determined by confocal microscopy. beta2AR-eGFP located in the cell membrane is labeled with white arrows, whereas internalized beta2AR-eGFP is labeled with yellow arrowheads. Full-length and the {Delta}PCD1,2 mutants of HA-tagged gravin were generated as schematic representation of topological organization of the human gravin fragment (Fig. 2). B, to detect beta2-adrenergic receptor-gravin association, we incubated whole cell lysates of A431 cells either expressing HA-tagged full length, wild-type gravin (HA-gravin), or expressing the {Delta}PCD1,2 mutant version of HA-tagged gravin (HA-gravin {Delta}PCD1,2) with antibodies against either the HA tag (anti-HA tag) or the beta2-adrenergic receptor (anti-beta2AR, CM-4) covalently linked to protein A/G-agarose beads. The immune complexes were subjected to SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose, and probed with an antibody specific for either the beta2-adrenergic receptor or the HA tag. The data presented are representative of at least three separate determinations performed on separate occasions. IP, immune precipitation; IB, immunoblotting.

 


Figure 8
View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 7.
Schematic of gravin association with the cell membrane and beta2-adrenergic receptor. A, full-length gravin association with the inner leaflet of the cell membrane in the absence of activation of the beta-adrenergic receptor by agonist. Note that at resting concentrations of intracellular Ca2+ small, positively charged domains PCD1, PCD2, and PCD3 bind avidly to the inner leaflet of the cell membrane rich in PS. Under these conditions, some association of the scaffold with the receptor via the RBD can be measured directly. B, upon stimulation of the cell with an agent such as catecholamine there is an increase in the intracellular concentration of cyclic AMP, activation of PKA and phosphorylation of PKA sites on the receptor and the scaffold in the RBD (3). The increase in intracellular Ca2+ concentrations neutralizes the membrane association of these three domains enabling the binding of CaM, repelling the scaffold from the cell membrane as the phosphorylated receptor and RBD of gravin enhance the interaction of the scaffold harboring PKA, PKC, and the phosphatase PP2B. C, following the transient rise and fall of intracellular Ca2+ levels, the small, positively charged domains drive membrane association of the scaffold again and enable the resensitization (dephosphorylation) and recycling of the receptor as well as dephosphorylation of the AKAP.

 
Elevating intracellular Ca2+ decreases the association of gravin with the cell membrane and blocks the ability of gravin to resensitize and recycle the beta2AR. Responses integrating signals provoked by changes in intracellular concentrations of cyclic nucleotides and free Ca2+ often are triggered in vivo by neurotransmitters such as norepinephrine, operating through both {alpha}1- and beta2-adrenergic receptors. Catecholamines epinephrine and norepinephrine stimulate both beta2-adrenergic receptors (elevating cyclic AMP levels and activating PKA) and {alpha}1-adrenergic receptors (increasing intracellular Ca2+ concentrations transiently). Gravin is shown to be a scaffold integrating signaling via cyclic nucleotides and intracellular Ca2+ concentrations, ultimately favoring trafficking of the scaffold away from the cell membrane during a Ca2+ transient (Fig. 7B), modulating a process that appears essential for receptor recycling (3, 32). The fall of intracellular [Ca2+] (after the Ca2+ transient) would result in a reduction in the neutralization of PCDs by Ca2+/CaM (Fig. 7C), restoring the movement of gravin from the cytoplasmic compartment to the cell membrane. A recent model for NMDA receptor regulation of MAGUK-AKAP79/150-based signaling likewise suggests the operation of a Ca2+-sensitive association of the scaffold with the cell membrane (33, 34). These two studies highlight the central role of short, positively charged domains and Ca2+ in regulating the localization of AKAPs, such as gravin and AKAP79/150, at the cell membrane and provide further information on the broader topic of how multivalent scaffolds like gravin and AKAP79/150 integrate signals emanating from different signaling cascades.

Earlier mutagenic studies of the non-myristoylated beta- and {gamma}-isoforms of AKAP12 suggested that two of the three PCDs in the gravin-{gamma} N-terminal region are necessary for plasma membrane association, as determined by confocal microscopy (6). Deleting any one cluster decreased membrane association modestly, deleting any two clusters decreased membrane association further (6). Substitution of acidic residues for Ser and Thr residues in these basic regions of gravin-{gamma}, mimicking PKC phosphorylation, also reduced apparent association with the membrane (6). The current work extends these earlier findings (6) by an investigation of the membrane binding and role of PCDs in the function of this AKAP scaffold.

For MARCKS, either phosphorylation by PKC or Ca2+/CaM binding to the effector domain stimulates translocation of MARCKS from the plasma membrane to the cytosol (12, 21). The N-terminal region of gravin and the entire MARCKS protein display a highly acidic, apparently unfolded region with one (MARCKS protein) or three (gravin) basic/hydrophobic domains that target the protein to the plasma membrane through electrostatic interactions with acidic lipids. We show (Fig. 3) that Ca2+/CaM can bind with sufficiently high affinity (Kd ~10 nM) to each of the PCDs to release these peptide sequences from the membrane. Similarly, inserting negatively charged residues into PCDs to mimic PKC phosphorylation decrease interactions between PCDs and the cell membrane, producing translocation of AKAP from the membrane to the cytosol (6). In summary, our measurements show the peptides corresponding to the PCD1, PCD2, and PCD3 regions of gravin bind reversibly to phospholipid vesicles, in a Ca2+/CaM-sensitive manner. These biophysical measurements and the confocal microscopy results support our hypothesis that local concentrations of Ca2+ (and thus Ca2+/CaM) can regulate association of the AKAP gravin (via these basic regions) with the inner leaflet of the plasma membrane.

The first 150 residues of AKAP79 include three clusters of basic residues proposed to function as a "polybasic membrane targeting domain" (11). In AKAP79, the sequence 31KASMLCFKRRKKAAKALKPKAG52, also has been directly implicated as a CaM binding domain (25). Previous studies of the regulation of interactions of AKAP79 with protein kinase C, phosphatidylinositol 4,5-bisphosphate, F-actin, and cadherins by protein phosphorylation and by Ca2+/CaM support the tenet that the N-terminal, three PCDs in the membrane targeting domain of this AKAP are negatively regulated by Ca2+/CaM binding (10, 25, 33, 35). Gravin uses three types of interactions to anchor itself to the plasma membrane: (i) the comparatively weak hydrophobic insertion of the N-terminal myristate for some isoforms, (ii) electrostatic interaction of the three PCDs with acidic lipids, and (iii) protein-protein interactions with the GPCR beta2AR. The protein-protein interaction of scaffold with the receptor (i.e. mediated by RBD binding) is dynamic and regulated by protein phosphorylation/dephosphorylation (3). The PCD-membrane interaction is dynamic and regulated by Ca2+/CaM binding to the PCDs. The PCDs in gravin function to increase the local concentration of the AKAP at the cell membrane and thereby enhancing the protein-protein interactions between the scaffold and this GPCR (36). Our observations demonstrate that gravin functions as a scaffold integrating signals from two major pathways, beta2AR/Gs/AC/cyclicAMP and {alpha}1AR/Gq/PLCbeta/Ca2+.


    FOOTNOTES
 
* This work was supported by United States Public Health Service Grants (DK25410 (to C. C. M.), GM024971 (to S. M.), and GM69375 (to H. Y. W.)) from the National Institutes of Health as well as supported by institutional National Research Service Award (T32 DK007521) from the NIDDK, National Institutes of Health (to J. T.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Pharmacology-HSC, SUNY/Stony Brook, Stony Brook, NY 11794-8651. Tel.: 631-444-7873; Fax: 631-444-7696; E-mail: craig{at}pharm.sunysb.edu.

2 The abbreviations used are: AKAP, A-kinase anchoring proteins; PKA, cAMP-dependent protein kinase; PKC, protein kinase C; GFP, green fluorescent protein; NEM, N-ethylmaleimide; MARCKS, myristoylated alanine-rich C kinase substrate; beta2AR, beta2-adrenergic receptor; MOPS, 4-morpholinepro-panesulfonic acid; HA, hemagglutinin; PCD, positively charged domains; CaM, calmodulin; WT, wild type; RBD, receptor binding domain. Back


    ACKNOWLEDGMENTS
 
We thank Gyongyi Hangyas-Milhalyne and Irina Zaitseva for their expert technical support in performing the measurements of peptide binding to lipid vesicles.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wong, W., and Scott, J. D. (2004) Nat. Rev. Mol. Cell Biol. 5, 959-970[CrossRef][Medline] [Order article via Infotrieve]
  2. Malbon, C. C., Tao, J., and Wang, H. Y. (2004) Biochem. J. 379, 1-9[CrossRef][Medline] [Order article via Infotrieve]
  3. Tao, J., Wang, H. Y., and Malbon, C. C. (2003) EMBO J. 22, 6419-6429[CrossRef][Medline] [Order article via Infotrieve]
  4. Gelman, I. H. (2002) Front. Biosci. 7, d1782-d1797[Medline] [Order article via Infotrieve]
  5. Farazi, T. A., Waksman, G., and Gordon, J. I. (2001) J. Biol. Chem. 276, 39501-39504[Free Full Text]
  6. Streb, J. W., and Miano, J. M. (2005) J. Biol. Chem. 280, 28007-28014[Abstract/Free Full Text]
  7. Gambhir, A., Hangyas-Mihalyne, G., Zaitseva, I., Cafiso, D. S., Wang, J., Murray, D., Pentyala, S. N., Smith, S. O., and McLaughlin, S. (2004) Biophys. J. 86, 2188-2207[Medline] [Order article via Infotrieve]
  8. McLaughlin, S., Smith, S. O., Hayman, M. J., and Murray, D. (2005) J. Gen. Physiol. 126, 41-53[Abstract/Free Full Text]
  9. Ehlers, M. D., Zhang, S., Bernhadt, J. P., and Huganir, R. L. (1996) Cell 84, 745-755[CrossRef][Medline] [Order article via Infotrieve]
  10. Dell'Acqua, M. L., Faux, M. C., Thorburn, J., Thorburn, A., and Scott, J. D. (1998) EMBO J. 17, 2246-2260[CrossRef][Medline] [Order article via Infotrieve]
  11. Dodge, K., and Scott, J. D. (2000) FEBS Lett. 476, 58-61[CrossRef][Medline] [Order article via Infotrieve]
  12. McLaughlin, S., and Aderem, A. (1995) Trends Biochem. Sci 20, 272-276[CrossRef][Medline] [Order article via Infotrieve]
  13. Wang, J., Gambhir, A., Hangyas-Mihalyne, G., Murray, D., Golebiewska, U., and McLaughlin, S. (2002) J. Biol. Chem. 277, 34401-34412[Abstract/Free Full Text]
  14. Peitzsch, R. M., and McLaughlin, S. (1993) Biochemistry 32, 10436-10443[CrossRef][Medline] [Order article via Infotrieve]
  15. Arbuzova, A., Wang, L., Wang, J., Hangyas-Mihalyne, G., Murray, D., Honig, B., and McLaughlin, S. (2000) Biochemistry 39, 10330-10339[CrossRef][Medline] [Order article via Infotrieve]
  16. McLaughlin, S., Hangyas-Mihalyne, G., Zaitseva, I., and Golebiewska, U. (2005) Biochem. Soc. Symp. 189-198
  17. Morris, A. J., and Malbon, C. C. (1999) Physiol. Rev. 79, 1373-1430[Abstract/Free Full Text]
  18. Shih, M., Lin, F., Scott, J. D., Wang, H. Y., and Malbon, C. C. (1999) J. Biol. Chem. 274, 1588-1595[Abstract/Free Full Text]
  19. Shih, M., and Malbon, C. C. (1996) J. Biol. Chem. 271, 21478-21483[Abstract/Free Full Text]
  20. Gordon, J. I., Duronio, R. J., Rudnick, D. A., Adams, S. P., and Gokel, G. W. (1991) J. Biol. Chem. 266, 8647-8650[Free Full Text]
  21. McLaughlin, S., and Murray, D. (2005) Nature 438, 605-611[CrossRef][Medline] [Order article via Infotrieve]
  22. Romero, P., Obradovic, Z., and Dunker, A. K. (2004) Appl. Bioinformatics 3, 105-113[CrossRef][Medline] [Order article via Infotrieve]
  23. Prilusky, J., Felder, C. E., Zeev-Ben-Mordehai, T., Rydberg, E. H., Man, O., Beckmann, J. S., Silman, I., and Sussman, J. L. (2005) Bioinformatics 21, 3435-3438[Abstract/Free Full Text]
  24. Wang, H. Y., Tao, J., Shumay, E., and Malbon, C. C. (2006) Eur. J. Cell Biol. 85, 643-650[CrossRef][Medline] [Order article via Infotrieve]
  25. Faux, M. C., and Scott, J. D. (1997) J. Biol. Chem. 272, 17038-17044[Abstract/Free Full Text]
  26. Okeley, N. M., and Gelb, M. H. (2004) J. Biol. Chem. 279, 21833-21840[Abstract/Free Full Text]
  27. Cho, W., and Stahelin, R. V. (2005) Annu. Rev. Biophys. Biomol. Struct. 34, 119-151[CrossRef][Medline] [Order article via Infotrieve]
  28. Rusu, L., Gambhir, A., McLaughlin, S., and Radler, J. (2004) Biophys. J. 87, 1044-1053[CrossRef][Medline] [Order article via Infotrieve]
  29. Persechini, A., and Stemmer, P. M. (2002) Trends Cardiovasc. Med. 12, 32-37[CrossRef][Medline] [Order article via Infotrieve]
  30. Black, D. J., Tran, Q. K., and Persechini, A. (2004) Cell Calcium 35, 415-425[CrossRef][Medline] [Order article via Infotrieve]
  31. Shih, M., and Malbon, C. C. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 12193-12197[Abstract/Free Full Text]
  32. Fan, G., Shumay, E., Wang, H. H., and Malbon, C. C. (2001) J. Biol. Chem. 276, 24005-24014[Abstract/Free Full Text]
  33. Gorski, J. A., Gomez, L. L., Scott, J. D., and Dell'Acqua, M. L. (2005) Mol. Biol. Cell 16, 3574-3590[Abstract/Free Full Text]
  34. Langeberg, L. K., and Scott, J. D. (2005) J. Cell Sci. 118, 3217-3220[Free Full Text]
  35. Gomez, L. L., Alam, S., Smith, K. E., Horne, E., and Dell'Acqua, M. L. (2002) J. Neurosci. 22, 7027-7044[Abstract/Free Full Text]
  36. Cho, W. (2006) Sci. STKE. 2006, e7

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Physiol. Rev.Home page
S. Dai, D. D. Hall, and J. W. Hell
Supramolecular Assemblies and Localized Regulation of Voltage-Gated Ion Channels
Physiol Rev, April 1, 2009; 89(2): 411 - 452.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. E Fiedler, M. Bajpai, and D. W Carr
Identification and Characterization of RHOA-Interacting Proteins in Bovine Spermatozoa
Biol Reprod, January 1, 2008; 78(1): 184 - 192.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Bu and I. H. Gelman
v-Src-mediated Down-regulation of SSeCKS Metastasis Suppressor Gene Promoter by the Recruitment of HDAC1 into a USF1-Sp1-Sp3 Complex
J. Biol. Chem., September 14, 2007; 282(37): 26725 - 26739.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M. Pierre, J. A. Traverso, B. Boisson, S. Domenichini, D. Bouchez, C. Giglione, and T. Meinnel
N-Myristoylation Regulates the SnRK1 Pathway in Arabidopsis
PLANT CELL, September 1, 2007; 19(9): 2804 - 2821.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Tao, H.-y. Wang, and C. C. Malbon
Src Docks to A-kinase Anchoring Protein Gravin, Regulating beta2-Adrenergic Receptor Resensitization and Recycling
J. Biol. Chem., March 2, 2007; 282(9): 6597 - 6608.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/33/23932    most recent
M601813200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tao, J.
Right arrow Articles by Malbon, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tao, J.
Right arrow Articles by Malbon, C. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement