|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 281, Issue 35, 25018-25025, September 1, 2006
Mutations in the FAD Binding Domain Cause Stress-induced Misoxidation of the Endoplasmic Reticulum Oxidoreductase Ero1
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
or the non-covalent interaction of Ero1
with PDI. However, the Gly to Ser mutation abolishes disulfide-dependent PDI-Ero1
heterodimers. Both the Gly to Ser and His to Tyr mutations make Ero1
susceptible to misoxidation and aggregation, particularly during a temperature or redox stress. We conclude that the Ero FAD binding domain is critical for conformational stability, allowing Ero proteins to withstand stress conditions that cause client proteins to misfold. | INTRODUCTION |
|---|
|
|
|---|
F508 mutation of cystic fibrosis transmembrane conductance regulator severely compromises the stability of the nascent polypeptide at the ER, resulting in the eventual degradation of the protein in the cytosol by the proteasome (2). Neurological disorders such as Alzheimer Disease, Huntington Chorea, and Creutzfeldt-Jakob disease all have an ER misfolding or stress component, and in amyloidosis, the cell specific ER environment and folding "signature" can determine whether a protein is appropriately secreted (3).
The ER contains a number of chaperones and folding factors to guide and monitor the status of its client proteins (4). The lectin-like chaperones calnexin and calreticulin oversee glycoprotein folding, in concert with the PDI homolog ERp57 (5). Calnexin and calreticulin work together with glucosidases and UDP-glucose:glycoprotein glucosyltransferase to ensure that only properly folded glycoproteins exit the ER (6). With calnexin and calreticulin present to ensure proper folding of glycoproteins, the hsp70 chaperone BiP (GRP78) and PDI may preferentially fold proteins with no or less accessible glycans (7). Misfolded luminal proteins are usually destroyed by an ER-associated degradation pathway, which involves recognition of an unfolded protein by the lectin-like EDEM protein(s), expulsion from the ER via Sec61 or p97/VCP, and degradation in the cytosol by the ubiquitin-proteasome system (8). If ER-associated degradation is unsuccessful, misfolded proteins in the ER can lead to accumulation of reactive oxygen species and cell death (9).
Protein folding in the ER requires an oxidising environment for the generation of disulfide bonds (10). The redox peptide glutathione is important in buffering the ER (11), regulating the rate of ER protein oxidation (12, 13), and providing reducing equivalents for reductive/isomerization pathways (14). PDI is the major enzyme responsible for ER protein oxidation (15). In Saccharomyces cerevisiae, PDI is maintained in the oxidized state by another protein, the oxidoreductase Ero1p, which is essential for viability (1618). Whereas S. cerevisiae employs one ERO gene, higher organisms have two ERO genes. In mammals, Ero1
is induced by hypoxia (19) and may play a role in ER degradation (20), whereas Ero1
is induced by the unfolded protein response (21), with Ero1
showing high expression levels in selected secretory tissues (22).
Eros donate disulfide bond equivalents asymmetrically to the two redox-active a and a' thioredoxin domains of PDI (23) and in turn receive electrons that are passed on to O2 (24) and probably other electron acceptors including free FAD (25). Eros have two cysteine-rich sites that are important for electron transfer and oxidation (26, 27): an N-terminal CxxxxC site, which transfers oxidising equivalents to PDI, and a C-terminal (Cxx)CxxC motif, which is required for the structural stability of the protein (28) and is tethered by a long range intra-molecular disulfide bond (29). The (Cxx)CxxC motif is in contact with a non-covalently buried FAD molecule, to which electrons are passed en route to the final electron acceptors. The flavin fold found in Ero proteins is novel but is related to that of Erv2p, an alternative oxidoreductase of the yeast ER (30).
The ero1-1 mutation results in temperature-dependent lethality, whereas the ero1-2 mutation results in hypersensitivity to reducing agents (DTT) (16, 17). Single amino acid substitutions in Ero1p cause the ero1-1 and ero1-2 phenotypes. These mutations are G229S (equivalent to Gly252 in Ero1
) and H231Y (equivalent to His254 in Ero1
). Both residues are within the Ero flavin fold, with His231 directly contacting the ribose 5'-phosphate group of the FAD moiety (29). In Ero1p, residues Arg187, Thr189, Trp200, Ser228, His231, and Arg260 form hydrogen bonds or salt bridges with the FAD cofactor and are conserved in Ero1
and -
. The alteration of structure and charge within the flavin fold of the ero1 mutants is therefore likely to lead to loss of function by preventing electron transfer from occurring normally. However, the biochemistry of the FAD binding site mutants has not been fully examined.
Using Ero1
, we show that FAD domain mutants misoxidise during redox or temperature stress. The unusual Ero FAD binding domain therefore has a dual function: to facilitate electron transfer and to confer protein stability. The flavin pocket safeguards protein oxidation pathways, preventing spurious electron transfer at times when client proteins will misfold, misoxidise or aggregate.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
(22) have been described. The mouse monoclonal antibody HA-7 (Sigma), the anti-Myc monoclonal antibody 9B11, and the anti-Myc polyclonal antibody (both Cell Signaling) were commercially available. TransfectionsTransfections with Lipofectamine 2000 (Invitrogen) were performed according to manufacturer's instructions. Subconfluent cells in 6-cm dishes were washed twice with PBS (Invitrogen) and transfected with 1 or 2 µgof DNA for 6 h in the presence of Opti-MEM serum-free medium (Invitrogen). The medium was replaced after 6 h with complete medium and the cells analyzed 24 h post-transfection.
Construction of Ero1
MutantsThe wild-type pcDNA3Ero1
-HA and pcDNA3Ero1
-Myc constructs were a kind gift from Roberto Sitia. The Ero1
C390A-Myc mutant has been described previously (22). Site-directed mutagenesis (QuikChange, Stratagene) was used to create Myc- and HA-tagged G252S and H254Y mutants with the following forward primers: G252S, GAGTCTTCTATAAGCTTATATCGTCACTTCAT GCTAGCATCAATTTAC; H254Y, CTATAAGCTTATATCGGGACTTTATGCTAGCATCAATTTACATCTATG. Each construct was verified by DNA sequencing.
|
PDI or 0.5 µlof
HA (HA-7) or
Myc (9B11) antibodies immobilized on 50 µl of a 20% suspension of Protein A-Sepharose beads, followed by washing twice with lysis buffer. Proteins were transferred to polyvinylidene difluoride membranes (Millipore) at 150 mA for 2 h or 30 V overnight, and the membranes were blocked in 8% milk/PBS-Tween for 1 h or overnight. The primary antibodies were used at 1:5000 (
Myc), 1:2000 (
HA), 1:1000 (
PDI) and 1:50 (
Ero
). After washing four times with PBST, membranes were incubated with secondary antibodies (DAKO) at 1:3000 for 1 h, washed extensively, and visualized by ECL (GE Healthcare/Amersham Biosciences) upon exposure to Biomax Light film (Eastman Kodak Co.). Protein markers were from Bio-Rad. Each blotting experiment was reproduced at least twice. DTT and Temperature TreatmentsTransfected HeLa cells were washed with PBS (Invitrogen) and incubated with complete medium containing 10 mM DTT (Sigma) or buffer only for 15 min at 37 °C. For temperature treatments, transfected HeLa cells were incubated at 24, 37, and 42 °C on water baths for 1 h in complete medium buffered with 10 mM HEPES, pH 7.4 (Invitrogen). Cells were washed and lysed as described above, and post-nuclear supernatants were subjected to analysis by 8% SDS-PAGE.
|
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
G252S and Ero1
H254YWe have previously characterized the human Ero1
protein and shown that Ero1
homodimerises and interacts with PDI by both non-covalent and covalent (disulfide-dependent) interactions (22). Ero1
is functionally equivalent to Ero1p (21), and both Ero1
and Ero1p bind to PDI (31) and homodimerise (32). Since Ero1p and Ero1
also share conserved FAD binding residues (Fig. 1A), we used our knowledge of Ero1
to study the effects of the ero1-1 and ero1-2 mutations on Ero gene products. We undertook site-directed mutagenesis to create tagged Ero1
G252S and Ero1
H254Y mutants. Myc- and HA-tagged human Eros are functional, reside in the ER, and can interact with PDI in the same way as their non-tagged counterparts (21, 22, 28, 33).
We found that biosynthesis of Ero1
was largely unaffected by the G252S and H254Y mutations in the FAD domain (supplemental Fig. 1). However, it was possible that mutations in this region could cause conformational changes resulting in misfolding, particularly since Ero1p seems to expose buried residues during the oxidation cycle (32). To compare the overall conformation of wild-type Ero1
and the mutant proteins, we used a limited proteolysis approach. Partial trypsin digestion has been used to map conformational changes in a number of ER proteins, including polyomavirus (34) and cystic fibrosis transmembrane conductance regulator (35, 36). Thus transfected HeLa cell post-nuclear supernatants were treated with a concentration range of TPCK-trypsin for 30 min on ice. The reaction was quenched with soybean trypsin inhibitor and the lysates were analyzed by reducing SDS-PAGE, Western blotting, and detection with either
Myc or
Ero1
. Since the Myc tag is located at the C terminus of the protein and the
Ero1
epitope is located upstream of the (Cxx)CxxC motif (residues Tyr329 to Leu343), the use of these antibodies can provide some positional information about the fragments.
In each of five experiments, wild-type Ero1
-Myc was digested into two major fragments (Fig. 1). The largest fragment of
55 kDa appeared with 1.25 µg/ml trypsin (fragment A, Fig. 1B, lane 3). This fragment must contain at least the (Cxx)CxxC motif and the C-terminal Myc tag (Fig. 1C, lane 3) and is therefore likely to have lost the N terminus of the protein. The smaller product (fragment B, Fig. 1B, lane 4) was an
45-kDa species that lacked the C-terminal Myc tag (absent from Fig. 1C, lane 4) but is likely to contain the (Cxx)CxxC motif based on size and the presence of the Tyr329Leu343 epitope. Given the sizes of the fragments generated and the clustering of lysine residues in an exposed loop in this region, the results suggest that Ero1
was selectively proteolysed between the two redox-active domains. Furthermore, a trypsin digestion prediction suggests that Ero1p is also likely to be cleaved in this region.
The digestion patterns of the H254Y mutant (Fig. 1, B and C, lanes 58) and the G252S mutant (Fig. 1, B and C, lanes 912) and their overall sensitivity to trypsin were comparable with wild-type Ero1
, suggesting that the gross conformation of each protein was similar. However, there were some differences between the substrates, such as the appearance of a shadow band under the full-length protein in the mutant digestions probed with
Myc (Fig. 1C, lanes 7, 8, 11, and 12) and the lower abundance of fragment B in the G252S digestions (Fig. 1B, lane 12). The H254Y and, in particular, G252S mutation may have localized effects upon Ero structure and folding. However, given the overall similarity of the digestion product sizes, we conclude that gross conformational change and increased lysine exposure is unlikely to result from point mutations in the FAD binding site under normal steady state conditions.
Differences in the Covalent and Non-covalent Interactions of Ero1
G252S and Ero1
H254Y with PDIHaving shown that the G252S and H254Y mutations did not cause extreme structural changes, we investigated the PDI binding properties of the mutants. Previously, we have shown that wild-type Ero1
and Ero1
both form intermolecular disulfide bonds with PDI (covalent interactions) and both co-immunoprecipitate with PDI (representing a combination of covalent and non-covalent interactions) (22, 28). Upon non-reducing SDS-PAGE, Ero1
resolves as a monomer and as a collection of disulfide-bonded forms that include PDI-Ero1
and Ero1
-Ero1
complexes (22).
Thus HeLa cells were transfected with either G252S (Fig. 2A) or H254Y (Fig. 2B), and the post-nuclear supernatants were analyzed by reducing and non-reducing SDS-PAGE. Under non-reducing conditions, G252S ran as a monomeric population (OX) and as a collection of trapped disulfide-bonded species (Fig. 2A, lane 1), which disappeared upon reduction of the samples with DTT (Fig. 2A, lane 3). Note the background band that was also present in the mock transfectant (Fig. 2A, lanes 2 and 4). G252S specifically co-immunoprecipitated with the PDI antiserum (Fig. 2A, lanes 8 and 9), but disulfide-dependent Ero-PDI dimers were not evident when compared with the background (antibody) bands from the mock transfectant (Fig. 2A, lanes 6 and 7). Like G252S, the H254Y mutant also ran as a monomer, but the trapped, higher molecular weight species were more abundant and less diffuse than seen with G252S (Fig. 2B, lane 1, compare with Fig. 2A, lane 1). H254Y specifically co-immunoprecipitated with PDI (Fig. 2B, lanes 9 and 10), but unlike G252S, H254Y became trapped in a disulfide-dependent complex with PDI under non-reducing conditions (compare Fig. 2B, lanes 6 and 7 with Fig. 2A, lanes 6 and 7).
|
and an active site mutant with altered PDI binding properties (Ero1
C390A-Myc). Cell lysates were directly analyzed by non-reducing SDS-PAGE, blotted, and probed with
Myc (Fig. 2C, lanes 14). Equal portions of the lysates were subjected to immunoprecipitation with
PDI followed by blotting with
Myc under reducing (Fig. 2C, lanes 58) or non-reducing conditions (Fig. 2C, lanes 1013). All Ero1
proteins resolved as a collection of monomeric and disulfide-linked forms (Fig. 2C, lanes 14). G252S, H254Y, C390A, and wild-type Ero1
could all be co-immunoprecipitated with PDI (Fig. 2C, lanes 58). However, only H254Y (Fig. 2C, lane 11) and wild-type(Fig. 2C, lane 13) formed prominent, discrete disulfide-dependent complexes with PDI. We conclude from this experiment that both G252S and H254Y can interact non-covalently with PDI but that inter-molecular disulfide bonding with PDI is disturbed in the G252S mutant.
|
G252S and Ero1
H254Y Both DimerizeWild-type Ero1
can form homodimers, and mutating Cys396 of the Ero1
active site impedes both function and dimerization (22). Ero-Ero interactions may therefore be important for Ero1
regulation and/or activity (32). To ask whether ero1-1 and ero1-2 phenotypes could be partly explained by a failure of mutant Eros to self-complex, we investigated whether the G252S and H254Y mutants interacted with wild-type Ero1
. For this, we co-transfected HeLa cells with both HA and Myc-tagged versions of Ero1
. Since these tagged proteins have different molecular weights, they can be discriminated by their migration on SDS-PAGE gels.
Under reducing conditions, G252S-Myc (Fig. 3A, lane 1) migrated more slowly than wt-HA (Fig. 3A, lane 2), as expected. In double transfectants, both G252S-Myc and wt-HA could be detected (Fig. 3A, lane 3). No signal was seen in mock transfectants (Fig. 3A, lane 4). Lysates from these transfectants were subjected to immunoprecipitation with
HA and the blots probed with
Myc. Whereas no Ero1
signal could be detected from the single transfectants or mock lysates (Fig. 3B, lanes 1, 2, and 4), G252S-Myc clearly co-immunoprecipitated with HA-tagged wild-type Ero1
(Fig. 3B, lane 3). Similar results were obtained with the H254Y mutant: the single and double transfectants expressed the proteins expected (Fig. 3C, lanes 13) and the H254Y mutant co-immunoprecipitated with HA-tagged wild-type Ero1
(Fig. 3D, lane 3).
Having demonstrated that the G252S and H254Y mutants interacted with wild-type Ero1
, we investigated whether mutant-mutant interactions could occur. This was of interest because an Ero1
C396A mutant heterodimerizes with wild-type Eros but fails to form mutant-mutant dimers (22). Thus cells were transfected with individual HA-tagged mutants or co-transfected with both the Myc- and HA-tagged versions of the same mutant. The lysates were analyzed by SDS-PAGE to verify transfection and were subjected to immunoprecipitation with
Myc prior to immunoblotting with the anti-Ero1
serum.
The single and double transfectants expressed the expected proteins (Fig. 3E, lanes 14). No signal was observed in mock transfectants (Fig. 3E, lane 5). Upon immunoprecipitation with
Myc, no Ero1
signal was detected in the H254Y-HA, G252S-HA, or mock transfectants, as expected (Fig. 3E, lanes 7, 8, and 11, respectively). However, H254Y-HA clearly co-immunoprecipitated with H254Y-Myc (Fig. 3E, lane 9) and likewise G252S-HA was co-isolated with G252S-Myc (Fig. 3E, lane 10). We conclude from these experiments that point mutations in the FAD binding domain do not prevent Ero1
mutants from self-complexing or interacting with wild-type Ero1
molecules in the ER.
Aberrant Oxidation of Ero1
G252S and Ero1
H254Y during Reducing and Temperature StressThe yeast counterparts of G252S and H254Y are hypersensitive to temperature stress and reductants (16, 17). We therefore examined the fate of the G252S and H254Y proteins when mammalian cells were subjected to similar conditions. First, we established the effects of DTT treatment on living HeLa cells transfected with wild-type Ero1
. We found that at steady state, 10 mM DTT in the medium eliminated the majority of disulfide-dependent (Ero-PDI and Ero-Ero) complexes when the lysates were subsequently analyzed by non-reducing SDS-PAGE (Fig. 4A, lanes 1 and 2). A similar result was obtained with cells co-transfected with wild-type Ero1
-HA and wild-type Ero1
-Myc (Fig. 4A, lanes 3 and 4). When the samples were analyzed by reducing SDS-PAGE, a single reduced band was recovered for each mutant, as expected (Fig. 4A, lanes 710). The small shift in mobility of Ero1
after exposing the cells to DTT was a consequence of increasing availability of -SH groups to the alkylating agent (Fig. 4A, compare lanes 7 and 8 and lanes 9 and 10).
To confirm that Ero1
complex formation was abolished by DTT treatment, lysates from the DTT-treated and untreated cells were subject to immunoprecipitation with
Myc and probed with
Ero1
serum after immunoblotting. As expected, the wt-Myc protein from single transfectants was detected regardless of DTT treatment (Fig. 4B, lanes 1 and 2). Ero1
-HA only co-immunoprecipitated with Ero1
-Myc in the absence of DTT treatment (Fig. 4B, lane 4). We conclude from this experiment that a strongly reducing environment disrupts the majority of Ero1
-mediated covalent and non-covalent interactions at steady state.
Next, we examined the fate of H254Y and G252S after incubating cells with DTT. Cell lysates from treated and untreated transfectants were examined by non-reducing SDS-PAGE and were immunoblotted with
Myc. Wild-type Ero1
became mostly reduced and lost virtually all detectable disulfide-dependent interactions, as seen in Fig. 4A (Fig. 4C, lanes 1 and 2). However, the H254Y and G252S mutants behaved differently. H254Y maintained its complexes in the face of a DTT challenge (Fig. 4C, lanes 3 and 4, *). For G252S, DTT treatment caused a reproducible increase in the proportion of higher molecular weight complexes and aggregates (Fig. 4C, lanes 5 and 6, **). As an internal control, monomeric Ero1
became reduced upon DTT treatment (R, Fig. 4C, lanes 1, 3, and 5). All Ero1
molecules could be reduced in vitro when DTT was added to the sample buffer (Fig. 4D, lanes 16), demonstrating that the species seen in the non-reducing gels were disulfide-dependent complexes. Note the small shift in Ero1
mobility caused by increased exposure of Ero1
thiols to the alkylating agent (Fig. 4D, compare lanes 1 and 2, lanes 3 and 4, and lanes 5 and 6). Misoxidation was reversible, since the most severe mutant, G252S, could recover after DTT washout in normal medium prior to lysis (Fig. 4E, lane 3). Other stresses such as hydrogen peroxide challenge or deprivation of glutathione by treatment with butathione sulfoxamine did not result in oxidative misfolding of either mutant or wild-type Ero1
at steady state (not shown).
Finally, we asked whether varying the temperature could also invoke behavioral changes in the mutant proteins. Thus transfected HeLa cells were incubated at 24, 37, and 42 °C for 1 h prior to lysis. The wild-type Ero1
protein was stable across the temperature range and maintained its intermolecular Ero-PDI and Ero-Ero disulfide bonds (Fig. 4F, lanes 13, *). In contrast, both H254Y and G252S lost their disulfide-dependent complexes at 24 °C (Fig. 4F, lanes 4 and 7, *) and misoxidised at 42 °C, with mutant complexes also being retained in the stacking gel (Fig. 4F, lanes 6 and 9, **). Temperature variation did not markedly influence the oxidation state of the remaining monomers, although in general, H254Y tended to have a higher proportion of monomers in the reduced form, regardless of treatment (Fig. 4F, lanes 46, and Fig. 4C, lane 4). All Ero1
molecules could be reduced to a single band when DTT was added to the sample buffer, showing that all the complexes were disulfide-dependent (Fig. 4G, lanes 19).
We conclude from these experiments that both mutations in the FAD binding domain disrupt disulfide-dependent Ero1
interactions and result in misoxidation of the Ero1
protein when cells are subjected to either a reducing or temperature stress.
Implications of Ero1
MisoxidationThe human and yeast Eros have conserved Gly and His residues at the FAD binding site. Although the properties of the yeast ero1-1 and ero1-2 mutant proteins have not been examined in this study, one would predict that the equivalent mutations in Ero1p also result in stress-induced misoxidation and that the Ero1
FAD mutants will not restore viability to the ero1-1 and ero1-2 strains. We have shown that there is an inducible misoxidation defect in the equivalent Ero1
gene product upon temperature or reducing stress (Fig. 4). In the absence of FAD as a cofactor and electron acceptor, we suspect that the normal relationship between Ero's intramolecular disulfides and its inter-molecular disulfides with PDI cannot be maintained, resulting in -SH exposure and incorrect selection of S-S bridges by the mutant Ero proteins. The fact that misoxidation could be partly reversed (Fig. 4E) may explain why oxidizing agents such as diamide can restore viability to the ero1-1 yeast strain (16, 17).
Recent work has suggested that Ero-Ero dimers contribute to Ero function (22, 32). Given that an Ero1
C396A mutant does not homodimerise efficiently, it was possible that mutations in the FAD binding domain also prevent dimerization. However, our data show that Ero-Ero associations do not depend entirely on the FAD binding domain (Fig. 3) and thus a failure to self-complex is not likely to explain the ero1-1 and ero1-2 phenotypes. Nevertheless, it remains possible that Ero-Ero intermolecular disulfide bond formation could be altered in the G252S and H254Y mutants. Structural and enzymatic studies will be required to investigate this question further.
In S. cerevisiae, the conditional ero1-1 strain is unable to oxidize PDI, and PDI remains in the reduced state in these yeast (31). Here, we show that while the equivalent G252S Ero1
mutant can bind to PDI non-covalently, intermolecular disulfide bond formation between Ero1 and PDI is largely prevented (Fig. 2). This result demonstrates that Ero1 and PDI can interact in a disulfide and flavin-fold independent manner. We show that residue Gly252 is required for the establishment of PDI-Ero1 disulfide bonds (Fig. 2), even though the Ero-PDI docking site and the buried FAD binding site are not likely to be in direct contact. This fits with the idea that Ero1-PDI specificity might arise from both the active site cysteines and direct protein-protein interactions (23) and that structural changes may occur during electron transfer to the Cxx(CxxC) site in Ero1p (32).
The properties of its novel FAD fold make Ero well placed to regulate oxidative protein folding in the ER. The dual function of FAD as an electron transfer agent and as a stabilizing cofactor provides the Ero protein with the ability to catalyze oxidation reactions and, at the same time, maintain appropriate protein-protein interactions and structural stability in a rapidly changing, stressful environment.
| FOOTNOTES |
|---|
The on-line version of this article (available at http://www.jbc.org) contains supplemental Fig. 1. ![]()
1 An overseas research scholar. ![]()
2 To whom correspondence should be addressed. Tel.: 44-191-334-1259; Fax: 44-191-334-1201; E-mail: Adam.benham{at}durham.ac.uk.
3 The abbreviations used are: Eros, endoplasmic reticulum oxidoreductases; ER, endoplasmic reticulum; PDI, protein-disulfide isomerase; DTT, dithiothreitol; PBS, phosphate-buffered saline; HA, hemagglutinin; TPCK, L-1-to-sylamido-2-phenylethyl chloromethyl ketone; wt, wild-type. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |