HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 281, Issue 35, 25062-25075, September 1, 2006

This Article Abstract Full Text (PDF) All Versions of this Article: 281/35/25062    most recent M600688200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Westrop, G. D. Articles by Coombs, G. H. Search for Related Content PubMed PubMed Citation Articles by Westrop, G. D. Articles by Coombs, G. H. Social Bookmarking                      What's this?

Cysteine Biosynthesis in Trichomonas vaginalis Involves Cysteine Synthase Utilizing O-Phosphoserine^*

From the Division of Infection and Immunity, Institute of Biomedical and Life Sciences and Wellcome Centre for Molecular Parasitology, Glasgow Biomedical Research Centre, University of Glasgow, Glasgow G12 8TA, Scotland, United Kingdom

Received for publication, January 24, 2006 , and in revised form, May 8, 2006.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Trichomonas vaginalis is an early divergent eukaryote with many unusual biochemical features. It is an anaerobic protozoan parasite of humans that is thought to rely heavily on cysteine as a major redox buffer, because it lacks glutathione. We report here that for synthesis of cysteine from sulfide, T. vaginalis relies upon cysteine synthase. The enzyme (TvCS1) can use either O-acetylserine or O-phosphoserine as substrates. The K_m values of the enzyme for sulfide are very low (0.02 mM), suggesting that the enzyme may be a means of ensuring that sulfide in the parasite is maintained at a low level. T. vaginalis appears to lack serine acetyltransferase, the source of O-acetylserine in many cells, but has a functional 3-phosphoglycerate dehydrogenase and an O-phosphoserine aminotransferase that together result in the production of O-phosphoserine, suggesting that this is the physiological substrate. TvCS1 can also use thiosulfate as substrate. Overall, TvCS1 has substrate specificities similar to those reported for cysteine synthases of Aeropyrum pernix and Escherichia coli, and this is reflected by sequence similarities around the active site. We suggest that these enzymes are classified together as type B cysteine synthases, and we hypothesize that the use of O-phosphoserine is a common characteristic of these cysteine synthases. The level of cysteine synthase in T. vaginalis is regulated according to need, such that parasites growing in an environment rich in cysteine have low activity, whereas exposure to propargylglycine results in elevated cysteine synthase activity. Humans lack cysteine synthase; therefore, this parasite enzyme could be an exploitable drug target.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Trichomonas vaginalis is the causative agent of human trichomoniasis (1), a very common sexually transmitted infection with an estimated >170 million cases occurring each year (2), that has been implicated as a major risk factor in predisposition to human immunodeficiency virus/AIDS (3). The parasite itself is an unusual protozoon that may be one of the earliest branching organisms (4, 5). Undoubtedly it is an unusual eukaryote, both at the molecular and cellular levels (6–10). It is adapted for an environment containing only low oxygen concentrations by being a fundamentally fermentative organism, with oxygen apparently not making a significant contribution to energy metabolism (11). Nevertheless, the cells are exposed to oxygen in the natural environment (12) and have to withstand oxidant challenge. Some of the enzymes from the parasite are inactivated by oxygen itself, notably key proteins of the hydrogenosomes (9, 10); various metabolites likely to arise from the metabolism of oxygen (such as hydrogen peroxide and hydroxyl free radical) are generally harmful to cells and so need to be countered. Most eukaryotes have glutathione as a key redox buffer and antioxidant, but trichomonads lack this and related thiols (13). T. vaginalis is able to generate various thiols (methanethiol, propanethiol, and hydrogen sulfide), which have been postulated to have antioxidant roles (13), and also contains thioredoxin reductase, which functions together with thioredoxin and thioredoxin peroxidase to detoxify potentially damaging oxidants (14). Nevertheless, it has been generally believed that cysteine is the major cellular reducing agent and antioxidant (15). However, the source of cysteine for T. vaginalis had not been elucidated. We have analyzed the genome sequence of T. vaginalis in an attempt to predict how the parasite obtains the cysteine that it requires, and we then tested the hypotheses arising experimentally.

Cysteine can be generated from homocysteine using the trans-sulfuration pathway (as occurs in mammals) or from serine and inorganic sulfide. The latter pathway, which occurs in bacteria and plants and just a few protists, incorporates the multistep synthesis of sulfide from inorganic sulfate and a final reaction in which O-acetylserine and sulfide are used to generate cysteine. This final step is catalyzed by cysteine synthase (CS).² Two types of bacterial CSs have been categorized (types A and B), and the key differences between the two types are beginning to emerge (16–20). Both types can use O-acetylserine and inorganic sulfide to generate cysteine using a Ping Pong Bi Bi catalytic mechanism and proceeding by two half-reactions as follows: -elimination of acetate to form the -aminoacrylate intermediate and addition of H₂S to form cysteine (16, 17).

Analysis of the type A CS of Salmonella typhimurium has shown it to be a homodimer with each monomer composed of two domains each with a similar structure (18). The active site pocket, containing pyridoxal 5'-phosphate, is located in a deep cleft between the C- and N-terminal domains. The first half-reaction is facilitated by conformational changes, involving a subdomain of the N-terminal domain (19). This closes the active site pocket, leaving only a narrow channel that allows the product, acetate, to leave and the second substrate, hydrogen sulfide, to enter but excludes larger molecules such as thiosulfate.

The three-dimensional structure of the type B CS of Escherichia coli closely resembles that of S. typhimurium typeACSin many ways (20). The enzymes undergo similar conformational changes during the catalytic cycle, and residues lining the catalytic pocket are highly conserved. There are significant differences, however, in the flexible loop located opposite the pyridoxal 5'-phosphate molecule, and these account for differences in substrate specificity, notably its ability to use thiosulfate in place of hydrogen sulfide. The small residues Gly²³⁰, Ala²³¹, and Gly²³² in Salmonella type A CS are replaced by the bulky residues Arg²¹⁰, Arg²¹¹, and Trp²¹² in E. coli type B CS, and the type B enzyme has an insertion of three amino acid residues. The loop in the E. coli type B CS (residues 210–216) bulges outward, enlarging the active site pocket. This allows access to thiosulfate, which is excluded from the type A enzyme. It has been proposed that the side chain of Arg²¹⁰ stabilizes interaction with thiosulfate.

This same region has been identified as a determinant of substrate specificity in the CS of the hyperthermophilic Archaea Aeropyrum pernix. This CS appeared to be unusual because it uses O-phosphoserine rather than O-acetylserine, which is unstable at very high temperatures (21). The CS of A. pernix has an additional N-terminal domain but otherwise has a similar conformation and dimer structure to the type A and type B enzymes (22). The flexible loop of A. pernix CS (residues 297–302) resembles the loop (residues 210–216) of the E. coli type B enzyme. Arg²⁹⁷ of A. pernix CS, equivalent to Arg²¹⁰ of E. coli type B CS, is thought to interact with the phosphate group of O-phosphoserine. The importance of this was demonstrated using an R297A mutant, which had no activity with O-phosphoserine as a substrate but retained high activity with O-acetylserine.

We report here that a CS of T. vaginalis has similarities to both E. coli type B enzyme and the CS of A. pernix. Analysis of the enzyme activity of T. vaginalis has provided more insight into key residues and the specificities they determine. This allows us to hypothesize the existence of a group of CSs (designated type B CSs) that are characterized by common features. The data on T. vaginalis also allow us to postulate a scheme for the unusual metabolism of cysteine that occurs in this parasite. Central to this is CS using O-phosphoserine and the provision of sulfide by homocysteine desulfurase (also known as methionine -lyase (MGL) (23)). As humans lack both CS and MGL, this pathway represents a distinct parasite-specific feature that could be an exploitable drug target.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Growth and Harvesting of Parasites and Preparation of Lysates—A clonal cell line (G3) of T. vaginalis was routinely grown axenically in modified Diamond's medium and harvested as described previously (23). Parasites were either stored as cell pellets at –70 °C for the Western blot analyses and genomic DNA isolation or suspended in Trizol reagent (Invitrogen) for the RNA preparations and analyses.

T. vaginalis lysates were prepared by resuspending cells in ice-cold lysis buffer containing peptidase inhibitors (0.25 M sucrose, 0.25% (v/v) Triton X-100, 10 µM N-trans-epoxysuccinyl-L-leucine-4-guanidinobutylamide, 2 mM 1,10-phenanthroline, 4 µM pepstatin A, and 1 mM phenylmethanesulfonyl fluoride) to the equivalent of 10⁸ cells/ml and repeated aspiration via a 1-ml micropipette. Cell debris was removed by centrifugation at 12,000 x g for 10 min at 4 °C, and soluble protein in the supernatant was quantified using the Bio-Rad protein assay with bovine serum albumin (BSA) as standard.

In Silico Analysis of T. vaginalis Genes Involved in Cysteine Metabolism—The T. vaginalis genome data base (7.2x genome sequence, April 1st, 2005) was interrogated by BLAST search using gene model sequences from the KEGG GENES data base. Potential homologs were further analyzed by BLAST search of the GenBank^TM data base, CD search of the NCBI conserved domain data base, multiple sequence alignment with AlignX (Vector NTI; Invitrogen), and phylogenetic analysis using MEGA 3.0 (31). Gene function was assigned on the basis of sequence similarity, the presence of conserved domains, conservation of key active site residues, and phylogenetic relationships to model proteins. Genes were deemed to be absent if sequences identified in the initial BLAST search had in minimum sum probability of 1.0 x 10^–3 or if sequences identified were assigned an alternative function by the above criteria.

Cloning of CS, PGDH, and PSAT of T. vaginalis—A gene apparently corresponding to CS was first identified in an EST data base of T. vaginalis G3.³ Blast search of the T. vaginalis genome data base identified the identical sequence and confirmed that EST 215 contained the complete TvCS1 open reading frame.

The TvCS1 coding region was amplified from EST 215 using primers NT194 (GCGCATATGATCTACGACAACATCCTCG) and NT195 (GTGTCGACTTCTGTGTCGAAGAGCTTTG) and the Expand High Fidelity PCR system (Roche Applied Science) (94 °C for 2 min, 25 cycles of 94 °C for 15 s, 55 °C for 30 s, and 72 °C for 1 min, and 72 °C for 7 min). The PCR product was digested with NdeI and SalI, and the 0.92-kb fragment containing the full-length TvCS1 sequence was ligated into pET21a+ previously digested with NdeI and XhoI to give pBP158. A similar procedure was used to clone the coding regions for TvPGDH1 and TvPSAT1, identified by Blast search of the T. vaginalis genome data base (Table 1). T. vaginalis genomic DNA was used as a template for 30 cycles of PCR using primers NT268 (TACATATGAAGATTCTCATTGCAGACACTCTCGCAC) and NT269 (CGCTCGAGTTAATCAAACATCTTACAAGAAACACC) for TvPGDH1 and primers NT296 (GCAAGCTTAAAAGCCTGGCCATTCCTTCATTG) and NT297 (GCCATATGTCTGCCCAACGCGCATACAAC) for TvPSAT1. The PCR conditions were modified by increasing the extension time to 2 min. PCR products encoding TvPGDH1 and TvPSAT1 were cloned into pGEM®-T Easy vector (Promega) to give pBP171 and pBP208, respectively. The 1.2-kb NdeI and XhoI fragment from pBP171, encoding TvPGDH1, was ligated into vector pET28a+ digested previously with the same enzymes to give pBP175. Similarly, the TvPSAT1 gene, contained in the 1.1-kb NdeI and HindIII fragment from pBP208, was cloned into pET28a+ to give pBP222. The sequences of all constructs were confirmed on both strands by the University of Glasgow Molecular Biology Sequencing Unit, Sequencing Facility. Sequence analysis was carried out using Vector NTI software (Informax; Invitrogen). Plasmids were introduced into strain BL21/DE3 for protein expression. The recombinant proteins have N-terminal (rTvPGDH1 and rTvPSAT1) or C-terminal (rTvCS1) His₆ tags, which facilitated purification using Ni²⁺-NTA-agarose.

Northern Blot Analyses—Total RNA from 2 x 10⁷ T. vaginalis was fractionated by electrophoresis on 1.2% (w/v) agarose formaldehyde gels and transferred to Hybond-N membranes (Amersham Biosciences). [-³²P]dATP-labeled DNA probes were prepared from agarose gel-purified restriction endonuclease fragments using Prime-IT II random primer kit (Stratagene) and purified on Microspin S-200 HR columns (Amersham Biosciences). The probes used were as follows: TvCS1, a 0.8-kb XhoI fragment of EST 215; -actin, a 1.2-kb EcoRI/XhoI fragment of EST 197. Hybridizations were performed at 42 °C overnight in 5x SSPE, 5x Denhardt's, 50% formamide, 0.5% SDS, and 100 µg/ml denatured salmon sperm DNA. Filters were washed twice for 10 min at room temperature in 2x SSC, 0.5% (w/v) SDS and twice for 30 min at 55 °C in 0.1x SSC, 0.1% SDS. Storage phosphor screens were exposed to the labeled filters and scanned using a Typhoon 8600 Imager (Amersham Biosciences). Levels of mRNA were quantified using ImageQuant image analysis software (Amersham Biosciences). Filters were stripped with boiling 0.1% SDS, rinsed with 2x SSC, and reprobed. The T. vaginalis -actin mRNA levels were used to normalize TvCS1 mRNA levels. Normalized mRNA levels in the treated cultures were expressed relative to the control culture, which was given an arbitrary value of 1.0 unit.

Production of Recombinant Enzymes—Single colonies of BL21/DE3 harboring pBP158, pBP233, pBP236, pBP174, and pBP222 were grown at 37 °C in Luria Bertani medium, and the expressions of the recombinant proteins, rTvCS1, rTvPGDH1, and rTvPSAT1, were induced for 4 h with 1 mM isopropyl thio--D-galactoside. The soluble rTvCS1 protein was purified using Ni²⁺-NTA-agarose (Qiagen) according to the manufacturer's recommendations using a Bio-Rad FPLC system. Elution was in 50 mM sodium phosphate, 300 mM NaCl, 20 µM pyridoxal 5'-phosphate, 500 mM imidazole, pH 7.9. The eluted protein (rTvCS1) was dialyzed against 50 mM potassium phosphate, 1 mM EDTA, 0.2 mM pyridoxal 5'-phosphate, pH 7.8, and stored at 4 °C with 0.02% sodium azide.

Soluble rTvPGDH1 and rTvPSAT1 were purified with Ni²⁺-NTA-agarose using a batch purification method. All buffers were supplemented with 10% (v/v) glycerol for rTvPGDH1 purification and with 20 µM pyridoxal 5'-phosphate for rTvPSAT1 purification. Cells from a 500-ml culture were harvested by centrifugation at 4,000 x g for 20 min, resuspended in 10 ml of buffer A (50 mM NaH₂PO₄, 300 mM NaCl, 10 mM imidazole, pH 8.0), and lysed by sonication in a Soniprep 150 sonicator (MSE) for 6 bursts of 30 s at maximum output with a 30-s cooling interval between each burst. The lysates were cleared by centrifugation at 10,000 x g for 30 min at 4 °C. 5 ml of Ni²⁺-NTA-agarose was equilibrated in buffer A by two cycles of centrifugation at 1000 x g for 5 min at 4 °C and resuspension in 50 ml of buffer A. The agarose was mixed with 10 ml of cleared lysate and rotated overnight to bind the histidine-tagged protein. The agarose was washed two times in buffer A and two times in buffer B (50 mM NaH₂PO₄, 300 mM NaCl, 20 mM imidazole, pH 8.0). For each wash, the agarose was pelleted by centrifugation at 1000 x g for 5 min at 4 °C, resuspended in 50 ml of buffer, and rotated at 4 °C for 30 min. Recombinant protein was eluted by resuspending the agarose pellet in 5 ml of buffer C (50 mM NaH₂PO₄, 300 mM NaCl, 250 mM imidazole, pH 8.0) and rotating at 4 °C for 2 h. The eluted rTvPSAT1 protein was stored at 4 °C with 0.02% (w/v) sodium azide, and the rTvPGDH1 protein was stored at –20 °C with 50% (v/v) glycerol.

The rTvCS1, rTvPGDH1, and rTvPSAT1 remained highly active, as assessed by enzymic analysis, for more than 2 months. The concentrations of the recombinant proteins were determined using the Bio-Rad protein assay (Bio-Rad), with BSA as standard.

Western Blot Analyses—Polyclonal antiserum was raised in rabbits against purified rTvCS1 by the Scottish Antibody Production Unit (Carluke, UK) using standard immunization protocols. Soluble proteins from T. vaginalis lysates were fractionated on 12% (w/v) SDS-PAGE and electroblotted onto ECL nitrocellulose membranes (Amersham Biosciences). Membranes were blocked for 2 h at room temperature in Tris-buffered saline (TBS) containing 5% (w/v) milk and 0.2% Tween 20 and subsequently incubated overnight at 4 °C with specific polyclonal antiserum diluted 1:10,000 in TBS containing 1% (w/v) milk and 0.1% Tween 20. Bound antibodies were detected using peroxidase-linked anti-rabbit IgG (1:2000 dilution in 10x TBS containing 1% (w/v) milk powder, ECL reagents (Pierce), and Hyperfilm^TM ECL (Amersham Biosciences)).

Enzyme Assays—The sulfhydrylase activity of rTvCS1 was determined by measuring cysteine formation in 0.5-ml reactions containing 200 mM potassium phosphate, 1 mg/ml BSA, 1 mM EDTA, 0.2 mM pyridoxal 5'-phosphate, 100 mM O-acetylserine, 3 mM sodium sulfide, 0.2 µg of rTvCS1, pH 7.8. Reactions were preincubated for 3 min at 37 °C with all the components except sodium sulfide and terminated 5–10 min after addition of the sulfide. The concentration of cysteine formed was determined by the method of Kredich and Tomkins (24). The synthesis of S-sulfocysteine from thiosulfate and O-acetylserine was determined using a similar assay but with 20 mM sodium thiosulfate instead of the sodium sulfide. The S-sulfocysteine concentration was quantified by the method of Gatoinde (25). The S-methylcysteine formation from methanethiol and O-acetylserine was investigated using the method of Kredich and Tomkins (24). The methanethiol was provided by the action of T. vaginalis methionine -lyase (rTvMGL1) (23) on methionine in a coupled reaction. The 0.5-ml reaction contained 200 mM potassium phosphate, 1 mg/ml BSA, 1 mM EDTA, 0.2 mM pyridoxal 5'-phosphate, 100 mM O-acetylserine, 10 mM methionine, 5 µg of rTvMGL1, 4 µg of rTvCS1, pH 7.8. The reaction was started by addition of O-acetylserine after preincubating all other components for 3 min. Reactions were stopped after 2–20 min. The rTvMGL1 was produced as described previously (23) and had a specific activity of 101.2 µmol/min/mg protein in production of hydrogen sulfide from homocysteine. The activity of rTvMGL1 for methionine, producing methanethiol, was 30-fold lower (23).

Desulfurase activity was determined by measuring lead sulfide formation at 360 nm in 1-ml reactions containing 200 mM potassium phosphate, 1 mg/ml BSA, 0.2 mM pyridoxal 5'-phosphate, 5 mM cysteine, 15 mM -mercaptoethanol, 0.33 mM lead acetate, 2 µg of rTvCS1, pH 7.8. Reactions were started by addition of the rTvCS1.

The K_m value of rTvCS1 for O-acetylserine was determined with a fixed concentration of sodium sulfide (3 mM) and variable concentrations of O-acetylserine (1–100 mM). The K_m value for sodium sulfide was measured with 100 mM O-acetylserine and 0.1–10 mM sodium sulfide or with 80 mM O-phosphoserine and 0.01–2.0 mM sodium sulfide. Reactions in 0.2 M potassium phosphate buffer with 2 mM sodium sulfide showed that the K_m value for O-phosphoserine was >100 mM. The enzymic activity was inhibited at higher concentrations of O-phosphoserine because of the reduction in the pH of the buffer. Thus the phosphate buffer was replaced by 0.5 mM Tris-HCl, pH 7.8, and the K_m value for O-phosphoserine was determined with 50–270 mM O-phosphoserine and 2 mM sodium sulfide. The two buffers gave identical rates with 80 mM O-phosphoserine and 1 mM sodium sulfide. The K_m value of rTvCS1 catalyzing the desulfurase reaction with cysteine was determined with a fixed concentration of -mercaptoethanol (15 mM) and variable concentrations of cysteine (0.1–10 mM). The K_m value for -mercaptoethanol was measured with 5 mM cysteine and 1–50 mM -mercaptoethanol.

Cystathione -synthase activity was determined in 0.5-ml reactions containing 100 mM potassium phosphate, 25 mM homocysteine, 100 mM serine, 0.2 mM pyridoxal 5'-phosphate, and 20 µg of enzyme. Reactions were started by addition of the enzyme and terminated after 5–20 min at 37 °C. Cystathionine formed was quantified as described by Kashiwamata and Greenberg (26).

Potential inhibitors were investigated using 500-µl reactions containing 100 mM O-acetylserine, 3 mM sodium sulfide, 0.2 µg of rTvCS1, and various concentrations of the inhibitor. The enzyme was preincubated with the inhibitor for 3 min at 37 °C before addition of O-acetylserine. After a further 3 min at 37 °C, the reaction was started by addition of 3 mM sodium sulfide. Reactions were terminated after 2–20 min, and the cysteine formed was quantified (24).

rTvPGDH1 and rTvPSAT1 activities were analyzed using linked assays with both enzymes. The forward reaction from 3-phosphoglycerate to O-phosphoserine was measured using a fluorimetric assay to detect the NADH generated in the first reaction. Reactions were performed using 1 ml of 100 mM potassium phosphate, 5 mM 3-phosphoglycerate, 0.2 mM NAD⁺, 5mM glutamate, 1 mM DTT, 0.5 µg of rTvPGDH1, and 50 µg of rTvPSAT1, pH 7.8. Reactions were started by addition of 3-phosphoglycerate, and the rate of NADH formation was monitored by measuring fluorescence intensity using a PerkinElmer Life Sciences 55 luminescence spectrometer (excitation 340 nm, emission 470 nm). With 50 µg/ml rTvPSAT1, the rate of NADH formation was proportional to rTvPGDH1 concentration (0.2–0.8 µg/ml). No activity was observed in the absence of 3-phosphoglycerate.

The combined activity of the two enzymes in the reverse direction was measured by monitoring the oxidation of NADH. The reactions were carried out using 1 ml of 100 mM potassium phosphate, 0.25 mM NADH, 5 mM -ketoglutarate, 5 mM O-phosphoserine, 1 mM DTT, 25 µg of rTvPGDH1, 2 µg of rTvPSAT1, pH 7.8. The reactions were started by addition of O-phosphoserine, and the oxidation of NADH was determined by monitoring the absorbance at 340 nm for 5 min. With 25 µg of rTvPGDH1, the rate of NADH oxidation was proportional to rTvPSAT1 concentration (2–12 µg/ml).

All assays were performed at 37 °C. Kinetic calculations were performed using the computer program Grafit (Erithacus Software).

The Effects of Growth Conditions upon the Expression of CS in T. vaginalis—Parasites were grown in 25 ml of medium in tightly capped universal tubes with little gas phase. The standard modified Diamond's medium was varied by removal of ascorbate (normally present at 5.7 mM) or addition of cysteine to 10 mM or propargylglycine to 5 µM. None of these significantly affected growth over 18 h. Cultures were initiated at 10⁵ parasites/ml, and incubation was for 18 h at 37 °C, whereupon the parasites were harvested, washed, and stored as pellets at –70 °C until analysis (23).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Identification of Genes Potentially Involved in Cysteine Biosynthesis—The genome analysis revealed (see Table 1) the following four genes encoding proteins possibly involved in cysteine biosynthesis: cysteine synthase (CS, EC 2.5.1.47 [EC] , six gene copies); 3-phosphoglycerate dehydrogenase (PGDH, EC 1.1.1.95 [EC] , three gene copies); O-phosphoserine aminotransferase (PSAT, EC 2.6.1.52 [EC] , three gene copies); and mercaptopyruvate sulfurtransferase (MST, EC 2.8.1.2 [EC] ). The previously identified MGL (23) may also be involved. Genes searched for but not found were ones encoding serine acetyltransferase (SAT, EC 2.3.1.30 [EC] ), the usual source of O-acetylserine for CSs, and the enzymes of the trans-sulfuration pathway (cystathionine -synthase, EC 4.2.1.22 [EC] ; cystathionine -lyase, EC 4.4.1.1 [EC] ; cystathionine -synthase, EC 2.5.1.48 [EC] ; and cystathionine -lyase, EC 4.4.1.8 [EC] ). Interestingly, a gene encoding O-phosphoserine phosphatase (EC 3.1.3.3 [EC] ), which catalyzes the conversion of O-phosphoserine to serine in the final step of the phosphorylated serine pathway, also could not be identified. Searches of the genome data base for enzymes of the sulfide de novo synthesis pathway identified a possible homolog of 3'-phosphoadenylyl-sulfate reductase (EC 1.8.4.8 [EC] ) in the genome. However, the T. vaginalis predicted protein lacks the conserved C-terminal motif of 3'-phosphoadenylyl-sulfate reductase that contains the redox active cysteine (27), and the T. vaginalis protein has similarity to other related enzymes such as FAD synthetase. Additional genes encoding enzymes required for reduction of sulfate to sulfide (sulfate adenylyltransferase, adenylyl sulfate kinase, and sulfite reductase (NADPH)) are also apparently absent from the T. vaginalis genome (Table 1). These data together suggest that sulfide is not synthesized de novo in T. vaginalis. The results of the genome analyses enabled us to draw up an hypothetical metabolic map for cysteine biosynthesis in T. vaginalis (Fig. 1; pathway shown in boldface) The main features postulated were that CS uses O-phosphoserine as substrate rather than O-acetylserine and that the sulfide it requires is provided either from homocysteine or mercaptopyruvate through the action of MGL or MST, respectively. We tested the hypotheses arising from these predictions experimentally.

Analysis of CS of T. vaginalis—CS of T. vaginalis was originally identified as an EST containing the full-length coding region. The same sequence was subsequently identified in the T. vaginalis genome data base (TVAG_430060) and designated TvCS1. Five additional sequences (TvCS2–6) encoding proteins with between 89 and 98% identity to TvCS1 were also found in the data base. TvCS1 of T. vaginalis is predicted to encode a protein (TvCS1) of 299 amino acids, with a subunit molecular mass of 32.7 kDa.

View larger version (19K): [in this window] [in a new window]   FIGURE 1. Cysteine biosynthesis in T. vaginalis. Enzymes present in T. vaginalis and reactions catalyzed by them (this study and previous published work) are shown in boldface; enzymes predicted to be present are given in lightface type. Enzyme reactions apparently absent from T. vaginalis are in gray type. See Table 1 for key to abbreviations: SAM-MT, S-adenosylmethione-dependent methyltransferase (49); SAHH, S-adenosylhomocysteine hydrolase (50).

Plants produce mitochondrial and chloroplast isoforms of cysteine synthase that contain targeting sequences in long N-terminal extensions. The TvCS1 protein, as well as TvCS2–6 predicted proteins, lack an extension, and amino acid residues close to the N terminus are conserved in bacterial and plant CSs (Fig. 3a). Analysis of TvCS1 and the other CS sequences from T. vaginalis failed to detect a targeting sequence. These results suggest that all the CSs of T. vaginalis are cytosolic.

The levels of identity of TvCS1 with other CSs are as follows: Geobacter sulfurreducens type B (AAR36549 [GenBank] ), 51%; Entamoeba histolytica (BAA93051 [GenBank] ), 47%; E. coli type B (NP_311319 [GenBank] ), 43%; S. typhimurium type A (NP_461365 [GenBank] ), 41%; A. thaliana (P47998 [GenBank] ), 41%; Leishmania major (LmjF36.3590), 38%; and A. pernix (NP_148041 [GenBank] ), 30%. Phylogenetic analysis with the conserved 207 amino acids of the CSs using MEGA 3.0 (31) showed that the six CSs of T. vaginalis are more similar to each other than any other CSs and fall within a clade with bacterial type B CSs (Fig. 2) The TvCSs clearly aligned more closely with the type B CSs of S. typhimurium and E. coli than the type A CSs from the same organisms.

The key differences between the bacterial types A and B CSs (including the ability of the type B enzymes to use thiosulfate as an alternative substrate and the type A CSs to form a regulatory complex with SAT in which the CS activity is decreased and SAT activity increased) are mediated by a loop that is located between 8 and 9 of S. typhimurium CS type A (StCS-A), E. coli CS type B (EcCS-B), and A. thaliana CS (AtCS). The corresponding region of A. pernix CS (ApCS) is between 13 and 14. Fig. 3b shows an alignment of this region from different CS enzymes. This region contains a short segment that lines the entrance of the active site pocket, Gly²³⁰–Phe²³³ in StCS-A and Arg²¹⁰–Tyr²¹⁶ in EcCS-B. In the bacterial type A enzymes (Fig. 3b, group 1), this region forms part of a highly conserved sequence motif that also occurs in plant CSs and CSs known from other protozoa (Fig. 3b, groups 2 and 3). This sequence motif is absent from bacterial type B enzymes (Fig. 3b, group 4), known CSs of Archaea (Fig. 3b, group 6) and also TvCS1. Residues adjacent to the active site pocket implicated in binding of SAT to A. thaliana CS by site-directed mutagenesis (Lys²¹⁷, His²²¹, and Lys²²² (30)) are included in this motif. These residues are conserved in StCS-A and other CSs of groups 1–3, except for the E. histolytica CS in which residues corresponding to Lys²¹⁷ and Lys²²² of A. thaliana CS are Ala²²⁸ and Gly²³³, respectively. The SAT-binding motif is not found in EcCS-B, which is not thought to form a complex with SAT (32), archaeal CSs, and TvCS1. The sequences in this region of the bacterial type B CSs have their own characteristics. Residues 210–216 in EcCS-B comprise an extended flexible loop that bulges outward, enlarging the active site pocket and allowing access to larger substrates that are excluded from type A CSs (20). Moreover, the side chain of Arg²¹⁰ of EcCS-B stabilizes interaction with thiosulfate (20). Interestingly, the equivalent residue of the CS of A. pernix (Arg²⁹⁷) has been reported to be crucial for interaction with O-phosphoserine (22), and the CS of A. pernix apparently also has the extended loop. Sequence similarities suggest that TvCS1 also has the extended loop characteristic of the type B enzymes and archaeal CSs. The TvCS1 residue equivalent to the conserved arginines of EcCS-B and ApCS is Lys²¹⁴, which could also interact the negatively charged side chain of substrates such as thiosulfate and O-phosphoserine. Two other typically bulky residues in bacterial type B CSs (Arg²¹¹ and Trp²¹² in EcCS-B) are Ser²¹⁵ and Met²¹⁶ in TvCS and Arg²⁹⁸ and Val²⁹⁹ in ApCS. These analyses allowed us to postulate that TvCS1 may have substrate specificities similar to EcCS-B and ApCS and that all could be classified together as type B CS enzymes.

CS of T. vaginalis Catalyzes the Synthesis of Cysteine from O-Phosphoserine—Soluble recombinant CS of T. vaginalis (designated rTvCS1) was produced in large quantities (14 mg/liter) in E. coli with a C-terminal His₆ tag. Denaturing SDS-PAGE analysis confirmed that the histidine-tagged rTvCS1 was of the correct size (33 kDa) and showed that it had a high degree of purity (Fig. 4). It was stable for several weeks when stored at 4 °C.

View larger version (44K): [in this window] [in a new window]   FIGURE 2. Phylogenetic tree of CS sequences. Sequences were aligned with AlignX (Vector NTI 9.0; Invitrogen), and all regions with gaps and inserts/extensions were removed. Phylogenetic analyses were conducted using MEGA version 3.0 (31) on 207 conserved positions. A bootstrap test was performed with the Neighbor-joining method (500 replicates, seed 74307). Bootstrap values for interior branches of <95% are shown. Protein accession numbers are shown in brackets. The bar shows the number of substitutions per amino acid position.

The apparent K_m values of rTvCS toward its substrates were in the range of other CSs and were relatively high toward O-acetylserine compared with that for sulfide (Table 3). The K_m value for sulfide was reduced 40-fold with O-phosphoserine as substrate in place of O-acetylserine; however, the apparent K_m value toward O-phosphoserine was very high.

rTvCS1 was relatively insensitive to trifluoroalanine and propargylglycine, inhibitors of various pyridoxal 5'-phosphate-dependent enzymes (34, 35), with 14 mM to trifluoroalanine inhibiting the activity by 40% (with 100 mM O-acetylserine) and 50 mM propargylglycine inhibiting only 4%.

View larger version (79K): [in this window] [in a new window]   FIGURE 3. Multiple alignments of protein sequences of various cysteine synthases. Sequences were aligned with AlignX (Vector NTI 9.0; Invitrogen) and edited by reference to published alignments based on three-dimensional structures of S. typhimurium CS type A (StCS-A) (18), E. coli CS type B (EcCS-B) (20), A. pernix CS (22), and A. thaliana CS (30). Blocks of conserved residues are indicated by white on a black background and blocks of similar residues by white on a gray background. Sequences are arranged into six groups: 1, bacterial CS type A sequences; 2, protozoan CS, type A-related; 3, plant CSs; 4, bacterial CS type B sequences; 5, CS, type B-related; 6, archaeal CSs. EcCS-A, E. coli CS type A (NP-311319); StCS-A, S. typhimurium CS type A (NP_461365]); EhCS, E. histolytica CS (BAA21916); LmCS, L. major CS (LmjF36.3590); AtCS, A. thaliana CS (P47998); AtCS chlor., A. thaliana chloroplast CS (P47999); AtCS mito., A. thaliana mitochondrial CS (Q43725); EcCS-B., E. coli CS type B (NP_311319); StCS-B, S. typhimurium CS type B (NP_461375); GsCS-B, G. sulfurreducens CS type B (AAR36549); TvCS1, T. vaginalis CS (TVAG_430060); ApCS, A. pernix CS (NP_148041); PfCS, Pyrococcus furiosus CS (CAB49296). a, conserved N-terminal amino acid residues. Active site lysine is indicated by . b, loop region amino acid residues (located between 8 and 9). Structural features identified in plant and bacterial type A CS proteins are indicated by symbols above the top sequence: *, highly conserved sequence; , residues implicated (by mutagenesis of AtCS) in binding of serine acetyltransferase to plant CS proteins. Structural features identified in bacterial type B and thermophile CS proteins are indicated by symbols below the bottom sequence: •, loop forming part of active site pocket (20, 22); , conserved positively charged residue implicated (by mutagenesis) in binding of O-phosphoserine to thermophile CS proteins (22).

CS Expression in T. vaginalis Is Modulated by Exogenous Cysteine Concentration—Northern blots with T. vaginalis total and poly(A)⁺ RNA revealed a single CS transcript of 1.1 kb, which corresponds well with the size of the full-length EST. Western blots using the antiserum raised against rTvCS1 revealed that it recognized the recombinant protein itself and just a single protein of the expected size, of about 33 kDa, in a T. vaginalis soluble fraction (Fig. 6, lane 1). No proteins were detected when duplicate blots were probed with the preimmune serum (not shown).

T. vaginalis was cultured under conditions that were predicted to alter the requirement of the parasite for cysteine biosynthesis. Gene expression was assessed via measuring mRNA levels by Northern blotting and protein levels by Western blotting and activity assays. The conditions chosen were as follows: (i) minus ascorbate, by removal of the antioxidant ascorbate from the medium with the rationale that the parasite would need to adapt to the greater oxidant stress, perhaps by up-regulating cysteine biosynthesis; (ii) plus cysteine, by addition of an extra 10 mM cysteine as a redox buffer and potential source of the amino acid for the parasite; (iii) plus 5 µM propargylglycine, by addition of the compound, which is an inhibitor of many pyridoxal 5'-phosphate-dependent enzymes, including methionine -lyase of T. vaginalis (23), but a poor inhibitor of TvCS1. The protein, activity, and mRNA levels of CS were greatly reduced in cells grown in the presence of additional cysteine (Fig. 6, a–c, respectively, lane 3). There was also, surprisingly, a marked reduction when the parasites were grown in medium lacking ascorbate (Fig. 6, lane 2). This suggests that the ascorbate in the medium does not help protect the parasite from oxidant stress intracellularly, perhaps because it is not transported. The reason that the lack of ascorbate resulted in down-regulation of CS is unclear but perhaps could reflect ascorbate interfering with cysteine salvage by the parasite. In contrast, when the parasites were exposed to propargylglycine there was a great increase in the level of protein and also enzyme activity (Fig. 6, lane 4).

View larger version (55K): [in this window] [in a new window]   FIGURE 4. Recombinant proteins used in activity analyses. Lane 1, rTvCS1 (34.7 kDa); lane 2, rTvPSAT1 (44.1 kDa); lane 3, rTvPGDH1 (45.1 kDa). All 5 µg/lane.

Similarly, three potential PSAT proteins were identified by BlastP search of the T. vaginalis genome data base with the E. coli PSAT sequence. The putative T. vaginalis PSAT proteins showed between 92 and 99% amino acid identity. In contrast to a recent report (36), the predicted proteins did not contain N-terminal extensions or any potential mitochondrial targeting signal. One of these genes was expressed in E. coli and purified (designated rTvPSAT1) (Fig. 4, lane 2; Table 1). The yield was 21.3 mg/liter.

The forward reactions from 3-phosphoglycerate to O-phosphoserine via phosphohydroxypyruvate (PHP) were measured by monitoring the formation of NADH fluorimetrically. With 50 µg/ml rTvPSAT1, the rate of NADH formation was proportional to rTvPGDH1 concentration. An initial rate of 1.47 ± 0.46 µmol/min/mg rTvPGDH1 was obtained. No activity was observed in the absence of phosphoglycerate. In the absence of glutamate, the reaction stalled after 1–2 min, when the NADH concentration reached 2 µM. Removal of PHP by the action of PSAT therefore increases the extent of the reaction but not the initial rate, as also observed for the E. coli PGDH (37). Thus the two trichomonad proteins together are able to synthesize O-phosphoserine, which confirms their identity and activity as PSAT and PGDH.

In general, the PGDH forward reaction is more than 10-fold slower (for example, 70-fold for E. coli PGDH (37) and 20-fold for E. histolytica PGDH (38)) than the reverse reaction (37, 38). In vivo, the forward reaction is favored because the intracellular concentration of NAD⁺ is much higher than that of NADH, and the product PHP is removed by the action of PSAT. Thus the forward reaction of PGDH by itself is not readily analyzed. Experimentally, the activity of PGDH can be analyzed in the reverse reaction, but the substrate PHP is not commercially available. To determine whether the T. vaginalis PGDH1 is active in the reverse direction, we provided PHP by the reverse reaction of PSAT1 and measured the combined activity of the two enzymes by monitoring the oxidation of NADH. With 25 µg of rTvPGDH1, the rate of NADH oxidation was proportional to rTvPSAT1 concentration. The complete reaction showed a rate of 4.78 ± 0.08 µmol/min/mg rTvPSAT1. No activity was detected when PGDH1, PSAT1, or O-phosphoserine were omitted. These data show that both T. vaginalis enzymes are active in the reverse direction.

View larger version (20K): [in this window] [in a new window]   FIGURE 5. Variation of cysteine synthase activity of rTvCS1 with substrate concentration. Inset: double-reciprocal plot. a, 1–100 mM O-acetylserine with 3 mM sodium sulfide (Na2S); b, 0.1–10 mM sodium sulfide with 100 mM O-acetylserine; c, 50–270 mM O-phosphoserine with 1 mM sodium sulfide; d, 0.01–1 mM sodium sulfide with 80 mM O-phosphoserine.

View larger version (19K): [in this window] [in a new window]   FIGURE 6. Changes in CS protein, enzymic activity, and mRNA levels in T. vaginalis grown under different conditions. a, the protein expression levels determined by Western blotting: TvCS, cysteine synthase; TvTR, thioredoxin reductase (14). b, CS activities, means ± S.D. from three experiments in µmol/min/mg protein, determined at 37 °C in 0.2-ml reactions containing 15 mM O-acetylserine, 3 mM sodium sulfide, and 10 µg of soluble protein from T. vaginalis. c, the levels of mRNA assessed by quantitation of 32P hybridization using a PhosphorImager and shown relative to the levels in T. vaginalis grown under standard conditions. The variation in growth conditions were as follows: lane 1, control; lane 2, without ascorbate, lane 3; with added 10 mM cysteine; lane 4, with 5 µM propargylglycine. Northern blot analysis was not carried out for the propargylglycine-treated cells.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
We have shown that T. vaginalis has a gene that encodes a functional CS. The recombinant enzyme is active in vitro both in the synthetic and desulfurase directions, but the finding that the enzyme level is greatly reduced when cysteine is available in abundance exogenously (Fig. 6) is strongly supportive of the enzyme operating in the synthesis of cysteine in the parasite. These data also suggest that T. vaginalis can salvage cysteine from its host. Whether this is salvaged as such or is oxidized and then salvaged as cystine is unknown. However, the parasite contains abundant thioredoxin reductase, which is able to reduce cystine (14), and so the latter would be effective in generating cysteine intracellularly. The level of exogenous cysteine and cystine available to the parasite in its host is unknown, and so it is not possible to predict the extent to which this can satisfy the requirement of the parasite for cysteine in vivo. Irrespective of this, the presence of CS in T. vaginalis suggests that de novo biosynthesis certainly plays an important role. A 7.2x coverage of the 180-Mb T. vaginalis genome has now been completed, and we have identified six CS genes. The significance of this multiplicity is uncertain, but the relatively minor differences between the predicted proteins (they are 89–98% identical) is suggestive that they perform similar functions.

The O-acetylserine used by CS enzymes results from the action of serine acetyltransferase (SAT) in most cells that synthesize cysteine, whereas the sulfide required is produced in many cases via a de novo synthesis pathway. This is reported to be the case, for instance, in another anaerobic protozoon E. histolytica (40, 41). However, analysis of the T. vaginalis genome sequence data has failed to detect a gene that could encode a SAT homolog. The genome sequence analysis is not 100%, so we cannot completely discount the possibility that the gene is present. The possibility that the source of O-acetylserine in T. vaginalis is unusual also deserves consideration, but we investigated the possibility that CS of T. vaginalis uses a different substrate. The extreme thermophile A. pernix has a CS but lacks a SAT gene (21). There is evidence that the physiological substrate of A. pernix CS is O-phosphoserine, produced as an intermediate in the phosphorylated serine pathway (21). The hypothesis suggested was that this thermophile uses O-phosphoserine as it, unlike O-acetylserine, is stable at high temperatures (21). Our studies have now shown that T. vaginalis CS1 is also able to use O-phosphoserine as a substrate and indeed suggest that perhaps this is a common characteristic of type B CSs. Trichomonas lives at 37 °C, so in this case there is no correlation between lack of stability of O-acetylserine and use of O-phosphoserine.

Phylogenetic analysis showed that TvCSs form a clade with bacterial type B CSs (Fig. 2), and sequence comparison indicates that these enzymes and those of thermophiles have a conserved loop (Lys²¹⁴–Ile²²⁰ in TvCS1), which includes a conserved basic residue (Lys²¹⁴) near the active site. Modifying this conserved basic residue in A. pernix CS (to generate a R297A mutant) resulted in an enzyme with 74% of wild type sulfhydrylase activity with O-acetylserine but with no detectable activity with O-phosphoserine (22). The K214A mutation of TvCS1 had a similar affect on the specific activities with O-acetylserine (40% of wild type) and phosphoserine (0.5% of wild type). In addition, the K214A mutant showed only 3% of wild type activity in its reaction with O-phosphoserine and thiosulfate. The A. pernix CS was shown to use thiosulfate as an alternative nucleophile (21), but the effect of the R297A mutation on this activity was not reported. However, the equivalent basic residue of E. coli type B CS (Arg²¹⁰) was implicated in binding of thiosulfate by molecular modeling of the three-dimensional structure (20), although O-phosphoserine binding was not considered. Thus our studies have shown that Lys²¹⁴ of T. vaginalis CS has an important role in the substrate specificity, conferring the ability to use phosphoserine, as reported for Arg²⁹⁷ of A. pernix CS (22), and thiosulfate, as reported for Arg²¹⁰ of E. coli type B CS (20). It will be interesting to see if this is common for this group of CSs and if other type B enzymes can use O-phosphoserine as substrate and, if so, the implications of this for the organisms.

The explanation for the similarity between the CSs of T. vaginalis and the bacterial CSs is unclear, especially as the known CSs of other protozoa appear to be type A (Fig. 3). The possibility that the Trichomonas CS arose through lateral gene transfer from a bacterium deserves consideration, especially in light of previous observations of likely bacteria-like genes in this organism that may have been acquired through gene transfer from bacteria.

The type A CSs form a macromolecular complex with SAT in which CS activity is inhibited and SAT activity is enhanced. A conserved sequence motif within the 8-9 surface loop important for this association (30) is absent from the type B CSs of E. coli and S. typhimurium, supporting the suggestion that these enzymes do not form a regulatory complex with SAT (32). This appears to be a property shared by TvCS and the thermophile CSs because these enzymes also lack the SAT-binding motif, and there is no evidence of an SAT homolog in the genomes of T. vaginalis or thermophiles. The E. histolytica CS is unusual in that it is related to type A CSs by phylogeny, the structure of the 8-9 loop, and by its inability to use thiosulfate as a substrate (44) but does not appear to associate with SAT (41). However, a pair of Lys residues found to be critical for SAT binding in A. thaliana CS (30) are not conserved in the E. histolytica enzyme.

The ability to use thiosulfate as a substrate rather than a sulfide is a characteristic of bacterial type B CSs (45). rTvCS1 also has activity toward thiosulfate, although much lower than toward sulfide (Table 2). This raises the possibility that thiosulfate is of physiological significance as a substrate for TvCS in vivo. The sulfocysteine produced in such a reaction could feasibly be converted to cysteine. For instance, the parasite's thioredoxin, which is able to reduce cystine (14), perhaps could reduce the sulfocysteine. The type B CSs of S. typhimurium are also able to use methanethiol as a substrate, forming methylcysteine in its reaction with O-acetylserine, although at a 100-fold lower rate than the reaction with thiosulfate and sulfide (45). rTvCS1 showed no activity with methanethiol, showing that it does not share all of the features of bacterial type B CSs. Similarly, TvCS1 differs from the CS of A. pernix in not using serine as a substrate (data not shown).

The apparent K_m value of TvCS1 for O-phosphoserine is extremely high, similar to that of the CS of A. pernix (21), but the V_max is high and notably the K_m value for sulfide is very low when O-phosphoserine is used. This combination could relate both to the physiological concentration of O-phosphoserine (reported to be 0.98 mM by Knodler et al. (46)) and the need for the parasite to salvage sulfide very efficiently to avoid any toxic effects. T. vaginalis is unusual in containing high activity of MGL, which hydrolyzes very efficiently both methionine and, more relevantly, homocysteine, with the release of hydrogen sulfide (23). The latter is known to be toxic to cells, and it is likely that T. vaginalis has to have some means of negating such an effect. The low K_m value of CS for sulfide could be this mechanism. The large difference in the K_m value for sulfide with O-phosphoserine compared with O-acetylserine is surprising. There is no binding site for sulfide in the CS active site; thus, the decrease in the apparent K_m value for sulfide with O-phosphoserine is likely to be the result of an increase in the rate of the first half-reaction, to form the -aminoacrylate. There is a conformational change triggered by the binding of the first substrate for E. coli type B CS (20), and perhaps this is induced more rapidly by O-phosphoserine than O-acetylserine with Trichomonas CS.

O-Phosphoserine is synthesized in most cells by the phosphorylated serine pathway that has as its initiating metabolite 3-phosphoglycerate, an intermediate of glycolysis. We have shown in this study that in T. vaginalis PGDH and PSAT can function to generate O-phosphoserine. T. vaginalis relies heavily upon glycolysis, both for energy production per se and also to generate pyruvate that feeds into the hydrogenosomes to produce additional ATP (47). Glycolytic flux in T. vaginalis is controlled by regulation of pyruvate kinase (47). The phosphorylated serine pathway feeds off glycolysis before this point and so potentially has an unlimited source of initiating metabolite. In mammals, the first two steps of the phosphorylated serine pathway, catalyzed by PGDH and PSAT, are reversible and uncontrolled, and the flux from 3-phosphoglycerate to serine is regulated by the final step of the pathway catalyzed by O-phosphoserine phosphatase (48). Thus the biosynthesis of serine is controlled by the rate of serine utilization rather than the availability of 3-phosphoglycerate. O-Phosphoserine phosphatase appears to be absent from T. vaginalis; thus it seems likely that the synthesis of O-phosphoserine may be relatively uncontrolled and so, potentially, reach high levels. A concentration of 0.98 mM has been reported (46). The high K_m value of TvCS for O-phosphoserine could ensure that the parasite can obtain the level of cysteine that it needs without disrupting energy production in the parasite by draining 3-phosphoglycerate from the glycolytic pathway.

The source of the sulfide required by CS is enigmatic, especially as genome mining provides no evidence for the de novo pathway. This led us to postulate that the sulfide required by CS in T. vaginalis is provided by MGL. The physiological function of the enzyme has yet to be discovered, but its presence must have implications for the availability of sulfur amino acids in the parasite. For instance, exogenous methionine is rapidly catabolized. Moreover, the parasite uses methionine to produce S-adenosylmethionine for methylation reactions (49) with the resulting S-adenosylhomocysteine being hydrolyzed by S-adenosylhomocysteine hydrolase (50) to homocysteine, which is even more rapidly catabolized by MGL. This would provide sulfide for the biosynthesis of cysteine using CS. MGL is inhibited by propargylglycine, and growth of the parasites in 5 µM propargylglycine would have resulted in the majority of MGL being inhibited. This could correlate with the observed increase in T. vaginalis CS activity that resulted from growth with propargylglycine, in that the reduced availability of sulfide would necessitate an increased CS activity to ensure a sufficient cysteine biosynthetic flux to satisfy the requirements of the parasite.

T. vaginalis appears to lack all four enzymes of both the forward and reverse trans-sulfuration pathway, suggesting that direct methionine-cysteine interconversions do not occur. This is also thought to be the case in the anaerobic protozoon E. histolytica (51), which has sulfur amino acid somewhat similar to that of T. vaginalis. Moreover, methionine synthase (which converts homocysteine to methionine) is apparently absent from T. vaginalis (Table 1), and so the only fate of homocysteine in the parasite may well be catabolism by MGL, with the provision of sulfide. Another possible source of sulfide may be from the T. vaginalis MST, as has been suggested for Leishmania (52).

The metabolic scheme arising from these studies is outlined in Fig. 1. The findings suggest that T. vaginalis depends heavily upon cysteine biosynthesis involving CS, with MGL possibly providing the required sulfide. MGL has been postulated as a drug target as it has no counterpart in mammals. We have solved its structure (15) and have designed a prodrug that is activated by the parasite-specific enzyme and has anti-trichomonal activity in vivo (29). CS is also absent from humans and so could represent a good drug target. Unfortunately, there appear to have been few attempts to date to obtain specific inhibitors of CS from any source, and so there are few known inhibitors that could be used to investigate whether inhibition of the enzyme is toxic to the parasite. We did investigate 1,2,4-triazole, a reported inhibitor of bacterial CSs (42), but at 20 mM it neither inhibited the rTvCS1 of T. vaginalis nor parasite growth in vitro. However, we are currently investigating the structure of CS of T. vaginalis with the aim of being able to discover ways of exploiting its importance to T. vaginalis.

	FOOTNOTES

 
^* This work was supported by the Wellcome Trust. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom correspondence should be addressed. Tel.: 44-141-330-4777; Fax: 44-141-330-3516; E-mail: g.coombs{at}bio.gla.ac.uk.

² The abbreviations used are: CS, gene encoding cysteine synthase; CS, protein encoded by CS; rTvCS1, recombinant T. vaginalis CS1; BSA, bovine serum albumin; Ni²⁺-NTA, Ni²⁺-nitrilotriacetic acid; MGL, methionine -lyase; PGDH, 3-phosphoglycerate dehydrogenase; PSAT, O-phosphoserine aminotransferase; MST, mercaptopyruvate sulfurtransferase; SAT, serine acetyltransferase; DTT, dithiothreitol; PHP, phosphohydroxypyruvate; EST, expressed sequence tag.

³ R. P. Hirt and T. M. Embley, unpublished data.

	ACKNOWLEDGMENTS

 
We thank Antoinette Cherubini for technical assistance. We also thank Jane Carlton and the team at TIGR for the T. vaginalis genome data.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Petrin, D., Delgaty, K., Bhatt, R., and Garber, G. (1998) Clin. Microbiol. Rev. 11, 300–317