| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 281, Issue 35, 25425-25437, September 1, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11
2
From the
Institute of Biochemistry, Center for Structural and Cell Biology in Medicine, University of Lübeck, Ratzeburger Allee 160, 23538 Lübeck, Germany and Drug Discovery and Design Centre, State Key Laboratory of Drug Research, Shanghai Institute of Materia Medica, Shanghai Institutes for Biological Sciences and Graduate School, Chinese Academy of Sciences, 555 Zuchongzhi Road, Shanghai 201203, China
Received for publication, April 19, 2006 , and in revised form, June 13, 2006.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
-hairpin hemoglobin binding motif, a flexible N-terminal 
-helical extension, and a unique active-site cleft. We also demonstrate by biochemical methods that mature FP-2 can proteolytically process its own precursor in trans at neutral to weakly alkaline pH, that the binding of hemoglobin to FP-2 is strictly pH-dependent, and that FP-2 preferentially binds methemoglobin over hemoglobin. Because the specificity and proteolytic activity of FP-2 toward its multiple targets appears to be pH-dependent, we suggest that environmental pH may play an important role in orchestrating FP-2 function over the different life stages of the parasite. Moreover, it appears that selectivity of FP-2 for methemoglobin may represent an evolutionary adaptation to oxidative stress conditions within the host cell. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
The only currently available antimalarial drugs without known resistance are artemisinin (from Artemisia annua) and its hemisynthetic derivatives (4). Recently, however, the occurrence of mutations that could lead to artemisinin resistance has been reported (5). Consequently, the WHO has called for a halt of artemisinin mono-therapies to curtail the emergence of resistance against this compound (WHO News Release 19-01-2006). Given the inexorable speed of the development of drug resistance and lack of an efficient vaccine, the search for effective, safe, and affordable drugs for malaria treatment is one of the most pressing health priorities worldwide (6).
Plasmodium infections are exclusively transmitted by anopheline mosquito bites. The sexual stage of the parasite life cycle is restricted to the insect host, whereas asexual reproduction and gametocyte development take place in the human host, where the parasite infects and multiplies within hepatocytes and erythrocytes. The primary infection of liver cells is not associated with the typical symptoms of malaria, yet the liver stages (schizonts and hypnozoites) are of particular importance since they are insensitive to many drugs (4) and are responsible for the well known relapses of plasmodial infections. Gametocyte reproduction and development occur within erythrocytes, and the massive, systemic rupture of infected red blood cells at the end of this phase causes the clinical symptoms of malaria. During intraerythrocytic replication, the parasites utilize cytosolic proteins of the host cell as a food source. To digest hemoglobin and other cytosolic proteins, Plasmodia have developed a specialized acidic (pH 5–6) organelle, termed the food vacuole, which contains a set of specific proteases. These include several aspartic proteases called plasmepsins (7, 8), which perform the initial cleavage of hemoglobin. The cysteine proteases falcipain-2 and falcipain-3 (9–12) as well as the very recently discovered falcipain-2B (13) (which appears to be identical to falcipain-2' (14)), further degrade the plasmepsin cleavage products. The short peptides produced by the falcipains are finally degraded by the metalloprotease falcilysin (15, 16).
During the late trophozoite and schizont stages, falcipain-2 is also involved in the degradation of erythrocyte-membrane skeletal proteins including ankyrin and the band 4.1 protein (17). This activity displays a pH optimum in the range of 7.0–7.5 and is thought to contribute to destabilization of the erythrocyte membrane, leading to host cell rupture and release of the mature merozoites. The autoproteolytic processing of its own precursor at neutral pH has been suggested as a third function of falcipain-2 (18, 19). Falcipain-2 is synthesized during the trophozoite stage as a membrane-bound proenzyme comprising 484 amino acid residues (18, 20). The proenzyme is transported to the food vacuole through the endoplasmic reticulum/Golgi system, and during this process the N-terminal 243 residues containing the membrane anchor are proteolytically removed. An autoproteolytic processing mechanism was suggested on the basis of inhibitor studies (19) and from the observation that the recombinant proenzyme undergoes spontaneous processing during in vitro refolding (18, 21). It remains unclear how falcipain-2 can perform the diverse activities of self-processing, hemoglobin degradation, and cytoskeletal degradation at different pH optima during the various stages of parasite development. Disruption of the falcipain-2 gene results in reduced hemoglobin degradation in the trophozoite stage and accumulation of undegraded hemoglobin within the parasite food vacuole but seems to be compensated for by overexpression of falcipain-2B and falcipain-3 in later stages of the Plasmodium life cycle (22). This suggests an overlapping function and the need for an effective inhibitor that simultaneously inhibits the falcipains. In contrast to falcipain-2, -2B, and -3, falcipain-1 does not digest hemoglobin but plays a role in host cell invasion (23) and may also be involved in oocyst production within the anopheles mosquito vector (24).
Based on their primary structures, the falcipains have been classified as members of the papain family of cysteine proteases (C1A) (12, 18, 25). Previous studies have demonstrated that inhibition of the plasmodial aspartic or cysteine proteases (26, 27) inhibits the development of the parasites in vitro and can cure parasitic infection in a mouse model (28). Moreover, the recent discovery of an essential 
14-residue hemoglobin binding motif near the C terminus of falcipain-2 and related plasmodial cysteine proteases (25) points toward the possibility of designing peptidomimetic drugs that block falcipain activity by disrupting critical protein-protein interactions with its hemoglobin target. Hence, the falcipain-2 subfamily of plasmodial proteases is among the prime targets for discovery of novel anti-malarial drugs. Toward this goal, here we present the x-ray structure of falcipain-2, crystallized in the presence of the irreversible cysteine-protease inhibitor iodoacetamide, at 3.1 Å of resolution. The structure reveals unique features of the falcipain-2 subfamily proteases. The four copies of the enzyme in the crystallographic asymmetric unit provide individual snapshots of the dynamic and adaptable hemoglobin binding motif and the flexible N-terminal helical extension. A comparative structural analysis of the falcipain-2 active site with that of cruzain (cruzipain) from Trypanosoma cruzi suggests that existing vinyl sulfone inhibitors designed against cruzipain may be useful starting compounds for further chemical elaboration and rational design of novel antimalarials. We also demonstrate that mature, recombinant falcipain-2 can proteolytically process its own precursor in trans at a neutral to weakly alkaline pH and that the binding of hemoglobin to falcipain-2 is dependent on the pH of the medium and the oxidation state of the heme iron. Based on our results, we propose that methemoglobin is the preferred substrate for falcipain-2 within the acidic food vacuole and that the pH-modulated activity of falcipain-2 toward its various substrates may help to orchestrate critical events in the life cycle of the parasite.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
A plasmid for the expression of mature, inactive falcipain-2 was constructed by amplifying the DNA sequence encoding amino acid residues 245–484 from pFPc285a using the primers PmutA (ATGAATTATGAAGAAGTTATAAAAAAATATAGA) and PmutAanti (ATTAGCTTATTCAATTAATGGAATGAA). The PCR product was purified, ligated into pETBlue-1 (Novagen), and transformed into Nova Blue competent cells as described above. Plasmids isolated from individual clones that contained the insert in the correct orientation as indicated by restriction mapping, termed pFPc285aM, were verified by DNA sequencing, transformed into RosettaBlueTM (DE3) cells (Novagen), and tested for expression in small cultures (10 ml).
Large Scale Expression, Purification, and Refolding of Wild-type and Mutant Falcipain-2—Bacteria containing pFPc285a or pFPc285aM were grown in 2–6-liter batches at 37 °C on YT or Luria-Bertani (LB) medium containing 100 µg/ml carbenicillin (plus 25 µg/ml kanamycin in the case of the M15 (pRep4)-derived strains). Recombinant gene expression was induced by the addition of 0.5 mM isopropyl 1-thio--D-galactopyranoside to the liquid cultures at an optical density of 0.6–0.7 (measured at 546 nm). The cultures were incubated for another 3 h at 37 °C and harvested by centrifugation. The cells were washed with 1/10th of the culture volume of cold 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, resuspended in 1/100th of the culture volume of the same buffer, and either stored at –20 °C or immediately broken by sonication. Recovery of recombinant wild-type falcipain-2 and the inactive mutants, which were all produced as inclusion bodies, was achieved by collection of the insoluble cell lysate fraction after centrifugation for 20 min at 20,000 x g. Inclusion bodies of the His-tagged falcipain-2 mutants were washed and dissolved, and the recombinant protein was purified by nickel nitrilotriacetic acid chromatography essentially as described by Sijwali et al. (11). Purified protein was refolded as described (11) with only minor modifications; protein concentration in the nickel nitrilotriacetic acid elution fractions was estimated using a theoretical extinction coefficient of 44,640 M–1·cm–1 at 279 nm (29), and the ratio of protein solution to refolding buffer was reduced to 1:50. The refolded protein was desalted on a HighTrapTM column (Amersham Biosciences) equilibrated with 20 mM Tris/HCl (pH 7.5), and eluted in the same buffer. The desalted protein was further purified on a Poros 20HQ 4.6/10 anion exchange column (PerSeptive Biosystems) equilibrated with 20 mM Tris/HCl, pH 7.5, and eluted with a gradient of 0–500 mM NaCl. For the purification of the wild-type protein, 10 mM iodoacetamide was included in the desalting and ion-exchange buffers.
Expression of mature, inactive falcipain-2 (FPc285aM) was the same as described above; however, since this protein could not be purified by metal affinity chromatography, the inclusion bodies were more intensely washed; twice with buffer A (2 M urea, 2.5% (w/v) Triton X-100, 20 mM Tris/HCl (pH 8.0)) and twice with buffer B (20% (w/v) sucrose, 20 mM Tris/HCl (pH 8.0)). After each centrifugation step, the inclusion bodies were resuspended by sonication. Inclusion bodies from a 6-liter culture were resuspended in 5 ml of buffer B plus 10 mM MgCl2 and 125 units of benzonase (Merck). The suspension was stirred overnight at 4 °C followed by the addition of 25 ml of buffer B, centrifugation, and solubilization in 17 ml of denaturing buffer (8 M urea, 1 M imidazole, 20 mM Tris/HCl (pH 8.0)). Protein concentration was measured using a theoretical extinction coefficient of 40,605 M–1·cm–1 at 279 nm (29). This solution was either stored at –20 °C or directly subjected to refolding and ion-exchange purification.
General Activity Assay—The chromogenic substrate Z-Phe-Arg-pNA3 (Bachem AG) was used for routine activity assays. The assay mixture contained protein sample in 50 µM Z-Phe-Arg-pNA, 10 mM dithiothreitol, and 100 mM sodium acetate (pH 5.5) in a final volume of 700 µl. The absorbance at 405 nm was measured against a blank consisting of protein-free assay mixture. The activity was calculated using an extinction coefficient of 10,500 M–1·cm–1. The pH dependence of the reaction was tested using BisTris-propane/HCl buffer in place of sodium acetate.
Hemoglobinase Assay—Hemoglobin-degrading activity was assayed by incubating human hemoglobin (Sigma, H7379) with varying concentrations of recombinant falcipain-2. Falcipain-2 was added to a mixture consisting of 0.2 mg/ml hemoglobin, 100 mM sodium acetate (pH 5.5), and 10 mM dithiothreitol. The assay mixture was incubated for 10–120 min at 37 °C, and 20 µl aliquots were extracted at fixed time points, mixed immediately with 10 µl of denaturing SDS-PAGE loading buffer, heated for 5 min at 95 °C, and analyzed by SDS-PAGE. To test the pH dependence of hemoglobin degradation, the sodium acetate buffer was replaced by 100 mM BisTris-propane/HCl at the indicated pH.
Self-processing Assay—The same procedure as described for the hemoglobinase assay was used to study the processing of inactive, truncated falcipain-2 precursor (FPc285a) by active, refolded falcipain-2. The assay mixture contained 0.2 mg/ml refolded FPc285a instead of hemoglobin.
Binding Studies—The binding of hemoglobin to mature, inactive falcipain-2 was studied by surface plasmon resonance using a Biacore® 3000 system at room temperature. Inactive falcipain-2 was immobilized to the carboxymethylated dextran matrix of a CM5 research-grade sensor chip (Biacore) by the standard primary-amine coupling reaction in HBS-EP buffer (10 mM HEPES/NaOH, pH 7.5, 150 mM NaCl, 3 mM EDTA). The flow cell was activated for 7 min with a 1:1 mixture of 0.2 M N-hydroxysuccinimide and 50 mM N-ethyl-N'-(3-diethylaminopropyl)-carbodiimide) at a flow rate of 5 µl/min at 25 °C. Inactive, mature falcipain-2 (FPc285aM) at a concentration of 0.066 mg/ml in 10 mM sodium acetate (pH 3.9) was injected for 7 min at 5 µl/min, yielding a final immobilization level of 600 response units. The surface of the flow cell was subsequently blocked with a 7-min injection of 1 M ethanolamine (pH 8.5). Finally, 50 mM NaOH was injected for 10 s to remove any non-covalently bound protein. The control flow cell was activated and immediately blocked without immobilizing any protein to prevent nonspecific binding of the analyte to the sensor surface of the reference cell. Equilibration of the base line was carried out by a continuous flow of HBS-EP buffer (pH 6.0) through the chip for at least 3 h. Human hemoglobin (methemoglobin (Sigma H7379) or ferrous stabilized hemoglobin (Sigma H0267)) in 20 mM Na2HPO4/NaH2PO4, 150 mM NaCl, 3 mM EDTA buffer of the indicated pH was injected at a flow rate of 30 µl/min for 120 s at 25 °C. After each hemoglobin injection, the chip was regenerated by two injections of 50 mM NaOH at a flow rate of 50 µl/min for 6 s. Individual rate constants were determined using the Biacore software. Alternatively, the equilibrium dissociation constants were determined by plotting the intensity of the steady-state response (response units) against the hemoglobin concentration. The data were fitted to the standard formula of the absorption isotherm using the program KaleidaGraph 3.6 (Synergy Software).
Crystallization and Diffraction Data Collection—Wild-type, mature falcipain-2 was crystallized in the presence of the irreversible inhibitor iodoacetamide. Crystals were obtained at room temperature using the hanging-drop vapor diffusion method by equilibrating a mixture containing 5 µl of protein solution (2 mg/ml falcipain-2, 20 mM Tris-HCl (pH 7.5), 10 mM iodoacetamide, 150–200 mM NaCl) and an equivolume of precipitant solution (0.4–0.8 M (NH4)2SO4, 100 mM sodium citrate, pH 4.5–5.0) over reservoirs containing 1 ml of precipitant. Crystals appeared after 3–4 days and reached maximum dimensions of 250 x 50 x 50 µm within 10 days. Crystals generally diffracted anisotropically to a minimum Bragg spacing (dmin) of 10.0–6.0 Å, possibly due to their very high solvent content (see below). Only a few of the >50 crystals screened diffracted to a resolution of better than 3.5 Å, the best of which we report in this paper. Crystals were briefly soaked in a cryoprotectant consisting of precipitant solution with 25% (v/v) ethylene glycol and cooled to 100 K in a nitrogen-gas stream. The C-centered orthorhombic cell had dimensions a = 145.83 Å, b = 168.28 Å, and c = 178.09 Å. X-ray diffraction data were collected at 100 K and with an incident wavelength of 0.8045 Å at the Joint University of Hamburg-IMB Jena-EMBL Beamline X13, DESY (Hamburg). Crystal indexing and integration of reflection intensities were performed with Mosflm 6.2.4 (30, 31), with subsequent data scaling and merging carried out with Scala 3.2.5 of the CCP4 software suite (32, 33).
Structure Determination and Refinement—Structure determination by molecular replacement phasing was implemented with Phaser 1.3 (34) using a "mixed-model" (35) derived from residues 4–218 of the crystal structure of KDEL-tailed cysteine endopeptidase (36), which displays 43% sequence identity with falcipain-2. The correct solution, consisting of four falcipain-2 monomers in the crystallographic asymmetric unit (76% solvent content) was found in space group C2221 and yielded a log-likelihood gain (the difference between the log-likelihoods of the molecular replacement model and a random distribution of atoms) of 927 in the 40.0-3.5 Å resolution range. An initial 
A-weighted electron density map (37) calculated from the molecular replacement phases and measured amplitudes was subjected to prime-and-switch phasing with 4-fold non-crystallographic symmetry (NCS) averaging, as implemented in Resolve 2.05 (38), to reduce bias arising from the model-based phases. The NCS-averaged prime-and-switch electron density map was used to construct an initial model of falcipain-2 with the molecular graphics program Coot (39). Early rounds of crystallographic refinement were performed in CNS 1.1 (40) using anisotropic bulk solvent correction, torsion-angle simulated annealing, positional, and grouped B-factor protocols with strict 4-fold NCS constraints. The model was subjected to iterative rounds of building into A-weighted 3Fo – 2Fc and Fo – Fc maps, and crystallographic refinement with relaxed 4-fold NCS restraints was initiated at later stages once structural differences between the individual monomers were detected. Composite simulated-annealing omit maps were used regularly during the building process to verify and correct the model. The final falcipain-2 model, which exhibits good stereochemistry (Table 1), consists of 962 amino acid residues and 40 water molecules. Final R and Rfree values are 23.1 and 27.4% for data in the 40.0-3.1 Å range (with 5% of the observed data reserved for calculation of Rfree). Molecular figures were generated using the program PyMOL (41).
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
pH Dependence of Substrate Binding and Protease Activity—The pH-dependent proteolytic activity of recombinant, active falcipain-2 was measured with three different substrates: (i) human methemoglobin (Fig. 1c), (ii) the recombinant, inactive truncated falcipain-2 precursor (FPc285a) (Fig. 1d), and (iii) the chromogenic substrate Z-Phe-Arg-pNA (Fig. 1b). The hemoglobinase activity (Fig. 1c) displayed a clear pH optimum in the acidic range as has been previously described (18). Hemoglobin was completely digested within 30 min at pH 6.0, whereas only minimal or no proteolysis was observed at pH 7.0 and 7.5, respectively. The autoprocessing assay shown in Fig. 1d demonstrates that mature, refolded wild-type falcipain-2 can process the inactive, truncated proenzyme in trans. In contrast to the hemoglobinase activity, trans processing exhibited detectable activity over a wide pH range and showed a maximum at pH 8.5. The peptidic substrate Z-Phe-Arg-pNA was cleaved with relatively high efficiency over the entire pH range studied (pH 6–8.5); however, the proteolytic activity decreased by 30% above pH 7.5 (Fig. 1b).
To further investigate the basis for the different pH dependencies of the various catalytic activities of recombinant falcipain-2, we studied the binding of hemoglobin to mature, inactive falcipain-2 (FPc285aM) by surface plasmon resonance using a Biacore® 3000 system. These experiments showed that the binding of hemoglobin to falcipain-2 decreased with increasing pH (Fig. 2). The individual data collected at pH 7.0 and 8.0 could be fitted to a standard adsorption isotherm for the formation of a bimolecular complex assuming a single binding site (R values of 0.9967–0.9994). The data collected at pH 6.0 could be fitted significantly better assuming a second, low affinity binding site (R values 0.9995 and 0.9999). The dissociation constants of this second binding site were higher by about 35-fold (121 versus 3.3 µM for hemoglobin) to 90-fold (74 versus 0.8 µM for methemoglobin) than the constants for the high affinity binding site. The individual dissociation constants showed some variability depending on the protein preparation. The KD at pH 6.0 for methemoglobin varied in a range from 0.8 to 2.3 µM; however, the constants determined at higher pH values varied accordingly (e.g. the binding of methemoglobin at pH 7.0 was hardly measurable in the preparation that showed a KD at pH 6.0 of 2.3 µM). Thus, the observed reduction in hemoglobinase activity of falcipain-2 at higher pH values is due to decreased substrate binding under these conditions. Interestingly, very significant differences were observed between the binding of falcipain-2 to methemoglobin and hemoglobin, with methemoglobin exhibiting much smaller KD values (Fig. 2).
|
QMNYF). Despite a limiting resolution of 3.1 Å, the 3Fo – 2Fc electron density maps were of good quality and allowed unambiguous tracing of the polypeptide chain for 958 of 964 amino acid residues. The Pro-189—Leu-190 segment of monomers A and C was modeled with zero occupancy, and the Glu-14—Glu-15 segment in monomer C was not modeled due to poor density. The overall fold of falcipain-2 is illustrated in Fig. 3, showing a core structure with a distorted ellipsoidal shape that is characteristic of the C1A proteases. The polypeptide chain of mature falcipain-2 folds into the prototypical structure of papain-like proteases, with two distinct domains separated by a long central substrate binding cleft containing the active site (42, 43) (Fig. 3). The left domain (L domain) is predominantly -helical (2, 3, 4) with several long disulfide-stabilized segments lacking regular secondary structure, whereas the right domain (R domain) contains a large antiparallel -sheet (2-7-3-4-5-6) that is extended at the central part of 4 by the very short 1 and is decorated by peripheral helices 1, 5, and 6. Additional structural features that are unique to the falcipain-2 subfamily (with members such as the vivapain, vinckepain, and berghepain homologues (Fig. 4)) include a 17-residue N-terminal extension and a 14-residue -hairpin protuberance extending from 4 and 5 that comprises the hemoglobin binding motif (Figs. 3 and 4). Structural differences were clearly evident between the four monomers in both of these regions, specifically in 1/1 loop residues 13–16 and in residues 186–195 (5-loop-6) of the hemoglobin binding insert. These segments were, therefore, exclusively omitted from the 4-fold NCS restraints implemented during crystallographic refinement. Unless otherwise indicated, the following discussion will be based on the slightly better-defined monomer D of the crystallographic asymmetric unit.
|
39% compared with 38% for papain.
The N-terminal Extension—The presence of a 17-residue N-terminal extension is one of the major distinctive structural features of the falcipain-2 subfamily when compared with other C1A proteases. Previous functional studies have shown that the N-terminal extension plays a crucial role in folding of the mature protein into its active conformation (20). The crystal structure of falcipain-2 reveals that the N-terminal extension comprises a short -helix (1, residues 4–11) followed by a 10-residue loop (Fig. 3). The 1 helix is stabilized by the highly conserved Tyr-4, Ile-8, and Tyr-11, which pack tightly against residues of the R domain elements 2 (Leu-129), 5 (Glu-138, Leu-143), and the intervening 2/5 loop (Pro-132). The long loop (residues 12–21) of the N-terminal extension traverses the lower surface of the R domain before entering the domain core nearly 20 Å away at the base of the hemoglobin binding -hairpin. The loop exhibits elevated conformational flexibility as evidenced by relatively high B factors and diffuse electron density in some of the monomers.
An Additional Cys-99—Cys-119 Disulfide Bond in Falcipain-2 and Related Homologues—Apart from the catalytic Cys-42 (corresponding to Cys-285 of the full-length precursor), there are a total of eight cysteine residues in falcipain-2 forming four disulfide bonds (Cys-39—Cys-80, Cys-73—Cys-114, Cys-99—Cys-119, and Cys-168—Cys-229). The disulfides Cys-39—Cys-80 and Cys-73—Cys-114 are well conserved among the papain-like enzyme structures. Like papain and the majority of C1A proteases, falcipain-2 also has the disulfide Cys-168—Cys-229 to fix the upper loops defining the S2 and S1' substrate binding sites, in contrast to some of the cathepsins which lack this stabilizing element. An additional Cys-99—Cys-119 disulfide bond in the falcipain family was predicted on the basis of homology modeling studies (49), and mutations of either Cys-99 or Cys-119 have been shown to abolish enzyme activity, probably by disrupting protein folding and leading to a catalytically inactive conformation (50). Here we confirm the presence of a Cys-99—Cys-119 disulfide, which appears to play an important role together with the Cys-73—Cys-114 disulfide in stabilizing the long 4/2 loop (30 residues) that blankets the lateral surface of the L domain.
The Hemoglobin Binding Insert—A 14-residue insertion located in the C-terminal half of falcipain-2 has been recently shown to fulfill an important function by capturing hemoglobin (25). This insert adopts an extended antiparallel -hairpin conformation that causes the 4/5 strands to protrude out from the surface of the R domain by 20 Å (Figs. 3 and 5). The elevated conformational flexibility of the -hairpin manifests itself in progressively diminishing electron density in a distal direction along the long axis of this segment in monomers A and C. This is not surprising since the -hairpin of monomers A and C extends into bulk solvent and does not make contact with any adjacent monomers in the crystal (this crystal form has a solvent content of 76%). As a result, the distally positioned residues of the -hairpin were difficult to model and refine in monomers A and C; hence, some of these residues exhibit rather strained main-chain torsion angles, and Pro-189 and Leu-190 at the tip of the hairpin in these monomers were modeled with zero occupancy. In monomers B and D, however, the -hairpin is stabilized by intermolecular contacts, allowing for confident modeling and refinement of the entire insert including residues at the tip of the hairpin (Fig. 5).
|
2), Leu-84 (3/4 loop), Ile-85 (N terminus of 4), Ser-149 (C terminus of 3), and Ala-175 (N terminus of 5) as well as the main-chain carbonyl group of Gly-83 (3/4 loop)) (Fig. 6a). When we superimposed the structures of various C1A protease-inhibitor complexes with falcipain-2, we found the difference density to overlap perfectly with the side-chain atoms of residues in the inhibitor P2 position (Fig. 6b), suggesting the density may have arisen from S2-subsite binding of Tris (a component of the crystallization buffer) or ethylene glycol (the cryoprotectant) or possibly iodide (a product of iodoacetamide treatment). Computation of an anomalous-difference Fourier did not support the presence of an anomalous scatterer such as iodine, however, and the residual Fo – Fc density lacks characteristic features that would allow an unambiguous assignment to any particular buffer molecule.
Comparison with the Falcipain-2-Cystatin Complex—One day after our experimental data were submitted to the Protein Data Bank (PDB), the 2.7-Å crystal structure of falcipain-2 in complex with egg white cystatin (a macromolecular cysteine protease inhibitor) appeared in the PDB (code 1YVB).4 Although the details of the structure have not yet been reported, the release of the coordinates has allowed us to make a brief comparison between the two structures. The overall C r.m.s.d. between monomer D of our crystal structure and falcipain-2 in the cystatin complex is 0.63 Å, with the largest C deviations between the two structures occurring in the hemoglobin binding insert (Leu-190 at the tip of the -hairpin exhibits the most prominent C r.m.s.d (3.0 Å)). Because the -hairpin is remotely positioned from cystatin in the falcipain-2-cystatin complex, the structural displacement does not appear to be a direct consequence of cystatin binding.
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Because the catalytic site of the enzyme itself seems to be active over a wide pH range, the different pH profiles of the substrates are likely to reflect pH-controlled binding of the respective substrates. This hypothesis was found to be true for hemoglobin binding (Fig. 2). The observation that the affinity of falcipain-2 for methemoglobin is significantly higher than for hemoglobin was completely unexpected, although it had been demonstrated that several factors contribute to the formation of methemoglobin during plasmodial infection, including the acidic pH of the plasmodial food vacuole, oxidative damage within infected erythrocytes (51, 52), and the reduced activity of NADH-methemoglobin reductase (53). A significantly increased methemoglobin content in the range of 20–42% has been detected in the plasmodial food vacuole compared with 0.6–1.0% in uninfected erythrocytes (51). Thus, the higher affinity of falcipain-2 for methemoglobin seems to reflect an adaptation to the conditions within Plasmodia-infected erythrocytes. This hypothesis is supported by further experimental data, where Sobolewski and co-workers (54) demonstrated in ex vivo experiments using murine erythrocytes that the conversion of 95% of the hemoglobin into methemoglobin by the addition of NO had no detectable impact on the viability of Plasmodium berghei. The authors suggested that under these conditions, the parasites had either resorted to an alternative food source or were able to utilize methemoglobin. Akompong et al. (51) could even demonstrate that a reduction of the methemoglobin content by the addition of riboflavin resulted in a reduced size of the P. falciparum food vacuole and blocked parasite proliferation in erythrocyte cultures. Consequently, it seems that the formation of methemoglobin is not an unwanted side effect of a plasmodial infection but a prerequisite for the efficient utilization of hemoglobin as a food source by the parasite. Our data indicate that falcipain-2 is perfectly suited to perform this function.
|
Structural Determinants of Protein Folding and Hemoglobin Recognition—Although the exact involvement of the 17-residue N-terminal segment in mediating correct folding of mature falcipain-2 is not clearly understood, previous mutational studies have pinpointed a critical role for the highly conserved Tyr-4 (20). The x-ray structure of falcipain-2 reveals this residue to be situated at the N terminus of helix 1, where it makes multiple side-chain interactions with 2, 5, and the 2/5 bridging loop of the R domain core. This observation and the high sequence conservation of other residues mediating packing interactions between helix 1 and the bulk of the R domain would intuitively suggest that positioning of 1 in this region is critical for overall folding of the polypeptide and that the long 1/1 loop may act simply as a spacer to allow the N-terminal helix 1 to interact with the lower surface of the R domain. An essential role for the N-terminal extension in protein folding cannot be easily corroborated by a structural comparison of falcipain-2 with other C1A proteases lacking this structural element, because the underlying 2-loop-5 structure does not exhibit any pronounced dissimilarities between the different proteins (Fig. 3c). The spatial proximity of the N-terminal 1/1 loop region to the hemoglobin binding -hairpin does raise speculations of a possible function in hemoglobin capture. This is supported by a sequence comparison of the different plasmodial falcipain-2-subfamily proteases, which demonstrates that the 1/1 loop is restricted to a length of 10–11 residues (Fig. 4). Falcipain-1 is an exception in that it has a much larger 1/1 loop, but it has also been shown to be incapable of degrading hemoglobin (23). When taken together, the evidence alludes to a possible hemoglobin binding role for the N-terminal extension, particularly the 1/1 loop. Whether this structural element does indeed contribute to hemoglobin capture requires further examination.
The 14-residue hemoglobin binding -hairpin (residues 183–196) exhibits a high degree of conformational flexibility when freely exposed to bulk solvent. The large positional deviations exhibited by the -hairpin when comparing our structure and the structure of the falcipain-2-cystatin complex4 further underscore an inherent flexibility and plasticity of this element that may have functional implications in hemoglobin binding. A sequence comparison between the different falcipains and related homologues indicates a conservation of insert length (14 residues) but very low sequence identity (Fig. 4). Containing a much larger insertion in this region, falcipain-1 is once again an exception to this rule. A recent sequence analysis of 607 family C1A proteases has identified 40 members with insertions of longer than 12 residues at this location, with 18 of these members representing falcipains and falcipain homologues from other species (25). Other C1A proteases, such as cathepsin X (57), contain prominent insertions at other locations (Fig. 3c), although the biological role of these insertions remains less explored.
Toward Novel Antimalarial Drugs Targeting the Falcipains—Despite the absence of structural data concerning the falcipain-2-hemoglobin complex, an opportunity is now emerging to apply the current three-dimensional knowledge of the falcipain-2 hemoglobin-binding -hairpin toward structure-guided design of inhibitors that interfere with falcipain-2-hemoglobin complex formation. As an example, -hairpin protein epitope mimetic inhibitors show great promise in the field of drug design, as exemplified by recent work demonstrating their utility in blocking complex formation between the p53 tumor-suppressor protein and its natural human inhibitor HDM2 (58). Indeed, preliminary work by Rosenthal and co-workers (25) has already shown that a noncyclic peptide comprising the hemoglobin binding motif effectively inhibits the in vitro degradation of hemoglobin by falcipain-2 in a dose-dependent manner. The feasibility of designing hemoglobin binding inhibitors that have broad-spectrum activity against members of the falcipain-2 subfamily awaits further research.
The active-site cleft of falcipain-2 subfamily proteases, as for other C1A proteases and cysteine proteases in general, represents a prime target for therapeutic intervention (59, 60). Peptides and irreversible peptidic inhibitors have traditionally been used to probe the substrate specificity of cysteine proteases and to generate information that can be translated into the design of non-peptidic inhibitors with drug-like properties. Structure-guided approaches have already proven indispensable in the design of potent and highly selective inhibitors against the closest known structural homolog of falcipain-2, cruzipain (cruzain), from T. cruzi (the causative agent of Chagas disease) (46, 47, 61, 62). An experimental cure for Chagas disease in mice using optimized vinyl-sulfone-derivatized pseudopeptides has been reported (63), and similar vinyl-sulfone inhibitors have shown marked antimalarial effects in mice (with up to a 40% cure rate after 4 days of oral administration) (64) and broad activity across multiple P. falciparum strains (65).
The S2 pocket is the major determinant of specificity for most cysteine proteases (66), and its predominantly hydrophobic nature in falcipain-2 agrees well with the observation that all characterized falcipain-2 cleavage motifs of its specific intracellular protein targets, including ankyrin (NVSARFWLSD) (67), band 4.1 (SQEEIKKHHASI) (17), and the falcipain-2 precursor (KYLLDQMNYF) (18), contain a hydrophobic residue at the P2 position (marked in bold in the preceding sequences). Experiments with fluorogenic substrates have also shown that falcipain-2 has a strong preference for substrates with a hydrophobic residue, particularly Leu, at the P2 position (18). The crystal structure of falcipain-2 reveals that although the S2 subsite is generally hydrophobic, the electronegative side chain of Asp-234 is positioned very deep in the S2 pocket (Fig. 6). Previous x-ray structures of cruzipain and cathepsin B have uncovered a Glu side chain in the homologous position (Glu-205 in cruzipain; Glu-245 in cathepsin B) (45, 68). It has been demonstrated for cruzipain that the binding of substrates containing a basic side chain in the P2 position is mediated by salt-bridge formation between the P2 side chain and the carboxylate moiety of Glu-205 in the S2 pocket, thereby explaining the dual specificity of cruzipain and cathepsin B for substrates containing either a hydrophobic or basic residue at the P2 position (61). In falcipain-2 and falcipain-2B, however, the S2 pocket is slightly deeper due to the presence of the shorter Asp-234 side chain at this position, and it is therefore questionable whether an Arg or Lys in P2 could make a similar saltbridge interaction (Fig. 6b). In designing selective inhibitors against falcipain-2 and falcipain-2B, it might be feasible to exploit this feature of the S2 pocket by engineering a pseudopeptide inhibitor containing a longer basic side chain in the P2 position, such as homoarginine, which would presumably have the capacity to form a salt bridge with Asp-234. With the crystal structure at hand, synthetic chemistry can now be initiated to rationally explore the structural determinants of falcipain-2 specificity.
|
FOOTNOTES |
|---|
This paper is dedicated to the memory of Anastância Joaquim, who died of misdiagnosed malaria on July 9, 2006.
The atomic coordinates and structure factors (code 2GHU) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/). 
1 These authors contributed equally to this work.
2 To whom correspondence should be addressed. Tel.: 49-451-500-4060; Fax: 49-451-500-4068; E-mail: hilgenfeld{at}biochem.uni-luebeck.de.
3 The abbreviations used are: Z-Phe-Arg-pNA, benzoyl-Phe-Arg-p-nitroanilide; NCS, non-crystallographic symmetry; r.m.s.d., root mean square deviation; Bis-Tris-propane, 1,3-bis[tris(hydroxymethyl)methylamino]propane; AMC, 7-amino-4-methylcoumarin.
4 S. X. Wang, unpublished data.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
