|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 281, Issue 35, 25425-25437, September 1, 2006
Structural and Functional Characterization of Falcipain-2, a Hemoglobinase from the Malarial Parasite Plasmodium falciparum*![]() 1 1![]() ![]() ![]() ![]() ![]() ![]() 2![]()
From the
Received for publication, April 19, 2006 , and in revised form, June 13, 2006.
Malaria is caused by protozoan erythrocytic parasites of the Plasmodium genus, with Plasmodium falciparum being the most dangerous and widespread disease-causing species. Falcipain-2 (FP-2) of P. falciparum is a papain-family (C1A) cysteine protease that plays an important role in the parasite life cycle by degrading erythrocyte proteins, most notably hemoglobin. Inhibition of FP-2 and its paralogues prevents parasite maturation, suggesting these proteins may be valuable targets for the design of novel antimalarial drugs, but lack of structural knowledge has impeded progress toward the rational discovery of potent, selective, and efficacious inhibitors. As a first step toward this goal, we present here the crystal structure of mature FP-2 at 3.1 Å resolution, revealing novel structural features of the FP-2 subfamily proteases including a dynamic -hairpin hemoglobin binding motif, a flexible N-terminal -helical extension, and a unique active-site cleft. We also demonstrate by biochemical methods that mature FP-2 can proteolytically process its own precursor in trans at neutral to weakly alkaline pH, that the binding of hemoglobin to FP-2 is strictly pH-dependent, and that FP-2 preferentially binds methemoglobin over hemoglobin. Because the specificity and proteolytic activity of FP-2 toward its multiple targets appears to be pH-dependent, we suggest that environmental pH may play an important role in orchestrating FP-2 function over the different life stages of the parasite. Moreover, it appears that selectivity of FP-2 for methemoglobin may represent an evolutionary adaptation to oxidative stress conditions within the host cell.
At the end of 2004, about 3.2 billion people in the world were estimated to be at risk of contracting malaria (1). The estimated worldwide number of annual clinical malaria episodes is 350500 million, mostly caused by the erythrocytic parasites Plasmodium falciparum and Plasmodium vivax, and the global annual death toll of the disease exceeds one million people (1). Efforts to reduce these numbers are being complicated by the rapid development of resistance by Plasmodium species against the currently available antimalarial drugs. Depending on the geographical region, up to 85% of clinical malaria cases cannot be cured by chloroquine, which was the standard drug only a few decades ago. Furthermore, more than 50% of the Plasmodium infections in sub-Saharan Africa and in some regions of Asia are insensitive to sulfametoxine-pyrimethamine treatment, which otherwise shows a good efficacy against chloroquine-resistant P. falciparum strains. Of the malaria cases observed in Asia (Myanmar, Thailand, and Cambodia), 1015% do not respond to treatment with mefloquine, which emerged as a successor to chloroquine in the 1980s. Resistance of P. falciparum to primaquine has also been reported (2), and widespread resistance of P. vivax against standard primaquine therapy is suspected (3). Even though quinine is the oldest anti-malarial drug, it still shows relatively high efficacies in Asia and South America, i.e. 95 and 67%, respectively. However, severe side effects like hemolytic anemia, coma, and respiratory arrest unfortunately limit the wider application of this compound (4). The only currently available antimalarial drugs without known resistance are artemisinin (from Artemisia annua) and its hemisynthetic derivatives (4). Recently, however, the occurrence of mutations that could lead to artemisinin resistance has been reported (5). Consequently, the WHO has called for a halt of artemisinin mono-therapies to curtail the emergence of resistance against this compound (WHO News Release 19-01-2006). Given the inexorable speed of the development of drug resistance and lack of an efficient vaccine, the search for effective, safe, and affordable drugs for malaria treatment is one of the most pressing health priorities worldwide (6). Plasmodium infections are exclusively transmitted by anopheline mosquito bites. The sexual stage of the parasite life cycle is restricted to the insect host, whereas asexual reproduction and gametocyte development take place in the human host, where the parasite infects and multiplies within hepatocytes and erythrocytes. The primary infection of liver cells is not associated with the typical symptoms of malaria, yet the liver stages (schizonts and hypnozoites) are of particular importance since they are insensitive to many drugs (4) and are responsible for the well known relapses of plasmodial infections. Gametocyte reproduction and development occur within erythrocytes, and the massive, systemic rupture of infected red blood cells at the end of this phase causes the clinical symptoms of malaria. During intraerythrocytic replication, the parasites utilize cytosolic proteins of the host cell as a food source. To digest hemoglobin and other cytosolic proteins, Plasmodia have developed a specialized acidic (pH 56) organelle, termed the food vacuole, which contains a set of specific proteases. These include several aspartic proteases called plasmepsins (7, 8), which perform the initial cleavage of hemoglobin. The cysteine proteases falcipain-2 and falcipain-3 (912) as well as the very recently discovered falcipain-2B (13) (which appears to be identical to falcipain-2' (14)), further degrade the plasmepsin cleavage products. The short peptides produced by the falcipains are finally degraded by the metalloprotease falcilysin (15, 16). During the late trophozoite and schizont stages, falcipain-2 is also involved in the degradation of erythrocyte-membrane skeletal proteins including ankyrin and the band 4.1 protein (17). This activity displays a pH optimum in the range of 7.07.5 and is thought to contribute to destabilization of the erythrocyte membrane, leading to host cell rupture and release of the mature merozoites. The autoproteolytic processing of its own precursor at neutral pH has been suggested as a third function of falcipain-2 (18, 19). Falcipain-2 is synthesized during the trophozoite stage as a membrane-bound proenzyme comprising 484 amino acid residues (18, 20). The proenzyme is transported to the food vacuole through the endoplasmic reticulum/Golgi system, and during this process the N-terminal 243 residues containing the membrane anchor are proteolytically removed. An autoproteolytic processing mechanism was suggested on the basis of inhibitor studies (19) and from the observation that the recombinant proenzyme undergoes spontaneous processing during in vitro refolding (18, 21). It remains unclear how falcipain-2 can perform the diverse activities of self-processing, hemoglobin degradation, and cytoskeletal degradation at different pH optima during the various stages of parasite development. Disruption of the falcipain-2 gene results in reduced hemoglobin degradation in the trophozoite stage and accumulation of undegraded hemoglobin within the parasite food vacuole but seems to be compensated for by overexpression of falcipain-2B and falcipain-3 in later stages of the Plasmodium life cycle (22). This suggests an overlapping function and the need for an effective inhibitor that simultaneously inhibits the falcipains. In contrast to falcipain-2, -2B, and -3, falcipain-1 does not digest hemoglobin but plays a role in host cell invasion (23) and may also be involved in oocyst production within the anopheles mosquito vector (24).
Based on their primary structures, the falcipains have been classified as members of the papain family of cysteine proteases (C1A) (12, 18, 25). Previous studies have demonstrated that inhibition of the plasmodial aspartic or cysteine proteases (26, 27) inhibits the development of the parasites in vitro and can cure parasitic infection in a mouse model (28). Moreover, the recent discovery of an essential
Construction of Inactive Falcipain-2 MutantsA pQE-30 plasmid (Qiagen) containing the DNA sequence coding for residues 211484 of the falcipain-2 precursor with an N-terminal His tag (MRGSHHHHHHGSG) was kindly provided by Prof. T. Schirmeister (Würzburg). The expression plasmid for an inactive mutant form of the truncated falcipain-2 precursor containing an alanine residue instead of the active-site cysteine (pFPc285a) was constructed by PCR mutagenesis. The primers FPsen (TGGGCCTTTAGTAGTATAGGTTC) and FPantiA (GGCAGATCCACAATTTTTTTGATCCTTT) were used to amplify the entire plasmid, and the PCR product was purified by chloroform extraction and desalting with a MontageTM PCR filter device (Millipore). The plasmid was ligated using the Perfectly Blunt® Kit (Novagen) and transformed into NovaBlue competent cells (Novagen). Individual clones were selected, and pFPc285a was isolated and verified by DNA sequencing (MWG Biotech) followed by transformation into M15 (pRep4) competent cells (Qiagen) and test expression in 10-ml cultures. A plasmid for the expression of mature, inactive falcipain-2 was constructed by amplifying the DNA sequence encoding amino acid residues 245484 from pFPc285a using the primers PmutA (ATGAATTATGAAGAAGTTATAAAAAAATATAGA) and PmutAanti (ATTAGCTTATTCAATTAATGGAATGAA). The PCR product was purified, ligated into pETBlue-1 (Novagen), and transformed into Nova Blue competent cells as described above. Plasmids isolated from individual clones that contained the insert in the correct orientation as indicated by restriction mapping, termed pFPc285aM, were verified by DNA sequencing, transformed into RosettaBlueTM (DE3) cells (Novagen), and tested for expression in small cultures (10 ml).
Large Scale Expression, Purification, and Refolding of Wild-type and Mutant Falcipain-2Bacteria containing pFPc285a or pFPc285aM were grown in 26-liter batches at 37 °C on YT or Luria-Bertani (LB) medium containing 100 µg/ml carbenicillin (plus 25 µg/ml kanamycin in the case of the M15 (pRep4)-derived strains). Recombinant gene expression was induced by the addition of 0.5 mM isopropyl 1-thio- Expression of mature, inactive falcipain-2 (FPc285aM) was the same as described above; however, since this protein could not be purified by metal affinity chromatography, the inclusion bodies were more intensely washed; twice with buffer A (2 M urea, 2.5% (w/v) Triton X-100, 20 mM Tris/HCl (pH 8.0)) and twice with buffer B (20% (w/v) sucrose, 20 mM Tris/HCl (pH 8.0)). After each centrifugation step, the inclusion bodies were resuspended by sonication. Inclusion bodies from a 6-liter culture were resuspended in 5 ml of buffer B plus 10 mM MgCl2 and 125 units of benzonase (Merck). The suspension was stirred overnight at 4 °C followed by the addition of 25 ml of buffer B, centrifugation, and solubilization in 17 ml of denaturing buffer (8 M urea, 1 M imidazole, 20 mM Tris/HCl (pH 8.0)). Protein concentration was measured using a theoretical extinction coefficient of 40,605 M1·cm1 at 279 nm (29). This solution was either stored at 20 °C or directly subjected to refolding and ion-exchange purification. General Activity AssayThe chromogenic substrate Z-Phe-Arg-pNA3 (Bachem AG) was used for routine activity assays. The assay mixture contained protein sample in 50 µM Z-Phe-Arg-pNA, 10 mM dithiothreitol, and 100 mM sodium acetate (pH 5.5) in a final volume of 700 µl. The absorbance at 405 nm was measured against a blank consisting of protein-free assay mixture. The activity was calculated using an extinction coefficient of 10,500 M1·cm1. The pH dependence of the reaction was tested using BisTris-propane/HCl buffer in place of sodium acetate.
Hemoglobinase AssayHemoglobin-degrading activity was assayed by incubating human hemoglobin (Sigma, H7379) with varying concentrations of recombinant falcipain-2. Falcipain-2 was added to a mixture consisting of 0.2 mg/ml hemoglobin, 100 mM sodium acetate (pH 5.5), and 10 mM dithiothreitol. The assay mixture was incubated for 10120 min at 37 °C, and 20 µl aliquots were extracted at fixed time points, mixed immediately with 10 µl of denaturing SDS-PAGE loading buffer, heated for 5 min at 95 °C, and analyzed by SDS-PAGE. To test the pH dependence of hemoglobin degradation, the sodium acetate buffer was replaced by 100 mM BisTris-propane/HCl at the indicated pH. Self-processing AssayThe same procedure as described for the hemoglobinase assay was used to study the processing of inactive, truncated falcipain-2 precursor (FPc285a) by active, refolded falcipain-2. The assay mixture contained 0.2 mg/ml refolded FPc285a instead of hemoglobin. Binding StudiesThe binding of hemoglobin to mature, inactive falcipain-2 was studied by surface plasmon resonance using a Biacore® 3000 system at room temperature. Inactive falcipain-2 was immobilized to the carboxymethylated dextran matrix of a CM5 research-grade sensor chip (Biacore) by the standard primary-amine coupling reaction in HBS-EP buffer (10 mM HEPES/NaOH, pH 7.5, 150 mM NaCl, 3 mM EDTA). The flow cell was activated for 7 min with a 1:1 mixture of 0.2 M N-hydroxysuccinimide and 50 mM N-ethyl-N'-(3-diethylaminopropyl)-carbodiimide) at a flow rate of 5 µl/min at 25 °C. Inactive, mature falcipain-2 (FPc285aM) at a concentration of 0.066 mg/ml in 10 mM sodium acetate (pH 3.9) was injected for 7 min at 5 µl/min, yielding a final immobilization level of 600 response units. The surface of the flow cell was subsequently blocked with a 7-min injection of 1 M ethanolamine (pH 8.5). Finally, 50 mM NaOH was injected for 10 s to remove any non-covalently bound protein. The control flow cell was activated and immediately blocked without immobilizing any protein to prevent nonspecific binding of the analyte to the sensor surface of the reference cell. Equilibration of the base line was carried out by a continuous flow of HBS-EP buffer (pH 6.0) through the chip for at least 3 h. Human hemoglobin (methemoglobin (Sigma H7379) or ferrous stabilized hemoglobin (Sigma H0267)) in 20 mM Na2HPO4/NaH2PO4, 150 mM NaCl, 3 mM EDTA buffer of the indicated pH was injected at a flow rate of 30 µl/min for 120 s at 25 °C. After each hemoglobin injection, the chip was regenerated by two injections of 50 mM NaOH at a flow rate of 50 µl/min for 6 s. Individual rate constants were determined using the Biacore software. Alternatively, the equilibrium dissociation constants were determined by plotting the intensity of the steady-state response (response units) against the hemoglobin concentration. The data were fitted to the standard formula of the absorption isotherm using the program KaleidaGraph 3.6 (Synergy Software).
Crystallization and Diffraction Data CollectionWild-type, mature falcipain-2 was crystallized in the presence of the irreversible inhibitor iodoacetamide. Crystals were obtained at room temperature using the hanging-drop vapor diffusion method by equilibrating a mixture containing 5 µl of protein solution (2 mg/ml falcipain-2, 20 mM Tris-HCl (pH 7.5), 10 mM iodoacetamide, 150200 mM NaCl) and an equivolume of precipitant solution (0.40.8 M (NH4)2SO4, 100 mM sodium citrate, pH 4.55.0) over reservoirs containing 1 ml of precipitant. Crystals appeared after 34 days and reached maximum dimensions of
Structure Determination and RefinementStructure determination by molecular replacement phasing was implemented with Phaser 1.3 (34) using a "mixed-model" (35) derived from residues 4218 of the crystal structure of KDEL-tailed cysteine endopeptidase (36), which displays 43% sequence identity with falcipain-2. The correct solution, consisting of four falcipain-2 monomers in the crystallographic asymmetric unit (
Refolding and Purification of the Falcipain-2 Mutant FormsThe FPc285a (inactive mutant form of the truncated falcipain-2 precursor) and FPc285aM (inactive, mature falcipain-2) proteins were successfully refolded and purified (Fig. 1a). In the case of FPc285a, the recovery of soluble protein was significantly lower than for the active form. Moreover, handling of FPc285a was complicated by its relative instability as it precipitated gradually upon storage at 4 °C and completely upon freezing. In contrast, recovery of FPc285aM was slightly better than for the wild-type protein, and it was stable for up to 2 weeks at 4 °C. None of the mutant forms displayed any protease activity when assayed with Z-Phe-Arg-pNA as a substrate.
pH Dependence of Substrate Binding and Protease ActivityThe pH-dependent proteolytic activity of recombinant, active falcipain-2 was measured with three different substrates: (i) human methemoglobin (Fig. 1c), (ii) the recombinant, inactive truncated falcipain-2 precursor (FPc285a) (Fig. 1d), and (iii) the chromogenic substrate Z-Phe-Arg-pNA (Fig. 1b). The hemoglobinase activity (Fig. 1c) displayed a clear pH optimum in the acidic range as has been previously described (18). Hemoglobin was completely digested within 30 min at pH 6.0, whereas only minimal or no proteolysis was observed at pH 7.0 and 7.5, respectively. The autoprocessing assay shown in Fig. 1d demonstrates that mature, refolded wild-type falcipain-2 can process the inactive, truncated proenzyme in trans. In contrast to the hemoglobinase activity, trans processing exhibited detectable activity over a wide pH range and showed a maximum at pH 8.5. The peptidic substrate Z-Phe-Arg-pNA was cleaved with relatively high efficiency over the entire pH range studied (pH 68.5); however, the proteolytic activity decreased by To further investigate the basis for the different pH dependencies of the various catalytic activities of recombinant falcipain-2, we studied the binding of hemoglobin to mature, inactive falcipain-2 (FPc285aM) by surface plasmon resonance using a Biacore® 3000 system. These experiments showed that the binding of hemoglobin to falcipain-2 decreased with increasing pH (Fig. 2). The individual data collected at pH 7.0 and 8.0 could be fitted to a standard adsorption isotherm for the formation of a bimolecular complex assuming a single binding site (R values of 0.99670.9994). The data collected at pH 6.0 could be fitted significantly better assuming a second, low affinity binding site (R values 0.9995 and 0.9999). The dissociation constants of this second binding site were higher by about 35-fold (121 versus 3.3 µM for hemoglobin) to 90-fold (74 versus 0.8 µM for methemoglobin) than the constants for the high affinity binding site. The individual dissociation constants showed some variability depending on the protein preparation. The KD at pH 6.0 for methemoglobin varied in a range from 0.8 to 2.3 µM; however, the constants determined at higher pH values varied accordingly (e.g. the binding of methemoglobin at pH 7.0 was hardly measurable in the preparation that showed a KD at pH 6.0 of 2.3 µM). Thus, the observed reduction in hemoglobinase activity of falcipain-2 at higher pH values is due to decreased substrate binding under these conditions. Interestingly, very significant differences were observed between the binding of falcipain-2 to methemoglobin and hemoglobin, with methemoglobin exhibiting much smaller KD values (Fig. 2).
Overall StructureMature falcipain-2 was crystallized at pH 4.55.0 in the presence of 0.40.8 M (NH4)2SO4, 100 mM sodium citrate, and 10 mM irreversible inhibitor iodoacetamide. Its three-dimensional structure was determined by molecular replacement techniques using a modified set of coordinates of the KDEL-tailed cysteine endopeptidase, KDEL-CysEP, from Ricinus communis (castor bean) (36). The crystallographic asymmetric unit consists of four almost identical falcipain-2 monomers, with each exhibiting good stereochemistry, and 40 water molecules (Table 1). The residue numbering scheme chosen for the crystal structure reflects the sequence of mature falcipain-2 rather than its full-length precursor, i.e. residue 1 has been assigned to the Gln of the new N terminus liberated after self-processing (KYLLD QMNYF). Despite a limiting resolution of 3.1 Å, the 3Fo 2Fc electron density maps were of good quality and allowed unambiguous tracing of the polypeptide chain for 958 of 964 amino acid residues. The Pro-189Leu-190 segment of monomers A and C was modeled with zero occupancy, and the Glu-14Glu-15 segment in monomer C was not modeled due to poor density. The overall fold of falcipain-2 is illustrated in Fig. 3, showing a core structure with a distorted ellipsoidal shape that is characteristic of the C1A proteases. The polypeptide chain of mature falcipain-2 folds into the prototypical structure of papain-like proteases, with two distinct domains separated by a long central substrate binding cleft containing the active site (42, 43) (Fig. 3). The left domain (L domain) is predominantly -helical ( 2, 3, 4) with several long disulfide-stabilized segments lacking regular secondary structure, whereas the right domain (R domain) contains a large antiparallel -sheet ( 2- 7- 3- 4- 5- 6) that is extended at the central part of 4 by the very short 1 and is decorated by peripheral helices 1, 5, and 6. Additional structural features that are unique to the falcipain-2 subfamily (with members such as the vivapain, vinckepain, and berghepain homologues (Fig. 4)) include a 17-residue N-terminal extension and a 14-residue -hairpin protuberance extending from 4 and 5 that comprises the hemoglobin binding motif (Figs. 3 and 4). Structural differences were clearly evident between the four monomers in both of these regions, specifically in 1/ 1 loop residues 1316 and in residues 186195 ( 5-loop- 6) of the hemoglobin binding insert. These segments were, therefore, exclusively omitted from the 4-fold NCS restraints implemented during crystallographic refinement. Unless otherwise indicated, the following discussion will be based on the slightly better-defined monomer D of the crystallographic asymmetric unit.
To probe the entire Protein Data Bank for the closest known structural homolog of falcipain-2, a comprehensive VAST (Vector Alignment Search Tool) search (44) was carried out. Interestingly, this procedure identified cruzipain (also known as cruzain), the major cysteine protease of the blood parasite T. cruzi (the causative agent of Chagas disease) (4547), as the most similar structural relative to falcipain-2, with a backbone root mean square deviation (r.m.s.d.) of 1.7 Å over 207 homologous residues. Using the same search algorithm, monoclinic papain (48) was found to exhibit a backbone r.m.s.d. of 1.8 Å over 204 residues. The overall sequence identity between falcipain-2 and cruzipain is 39% compared with 38% for papain.
The N-terminal ExtensionThe presence of a 17-residue N-terminal extension is one of the major distinctive structural features of the falcipain-2 subfamily when compared with other C1A proteases. Previous functional studies have shown that the N-terminal extension plays a crucial role in folding of the mature protein into its active conformation (20). The crystal structure of falcipain-2 reveals that the N-terminal extension comprises a short
An Additional Cys-99Cys-119 Disulfide Bond in Falcipain-2 and Related HomologuesApart from the catalytic Cys-42 (corresponding to Cys-285 of the full-length precursor), there are a total of eight cysteine residues in falcipain-2 forming four disulfide bonds (Cys-39Cys-80, Cys-73Cys-114, Cys-99Cys-119, and Cys-168Cys-229). The disulfides Cys-39Cys-80 and Cys-73Cys-114 are well conserved among the papain-like enzyme structures. Like papain and the majority of C1A proteases, falcipain-2 also has the disulfide Cys-168Cys-229 to fix the upper loops defining the S2 and S1' substrate binding sites, in contrast to some of the cathepsins which lack this stabilizing element. An additional Cys-99Cys-119 disulfide bond in the falcipain family was predicted on the basis of homology modeling studies (49), and mutations of either Cys-99 or Cys-119 have been shown to abolish enzyme activity, probably by disrupting protein folding and leading to a catalytically inactive conformation (50). Here we confirm the presence of a Cys-99Cys-119 disulfide, which appears to play an important role together with the Cys-73Cys-114 disulfide in stabilizing the long
The Hemoglobin Binding InsertA 14-residue insertion located in the C-terminal half of falcipain-2 has been recently shown to fulfill an important function by capturing hemoglobin (25). This insert adopts an extended antiparallel
The Active-site CleftThe active site of falcipain-2 is located at the bottom of an elongated surface depression that has a slightly altered surface topology when compared with cruzipain and papain. The active-site Cys-42 exhibits strong residual Fo Fc electron density closely flanking the side-chain sulfur atom, indicating the presence of an attached acetamide moiety, although the density was not strong enough to facilitate modeling of the inhibitor (Fig. 6a). Most striking was the presence of a large ellipsoidal Fo Fc electron density peak residing within the S2 subsite (which is formed by the side chains of Trp-43 ( 2), Leu-84 ( 3/ 4 loop), Ile-85 (N terminus of 4), Ser-149 (C terminus of 3), and Ala-175 (N terminus of 5) as well as the main-chain carbonyl group of Gly-83 ( 3/ 4 loop)) (Fig. 6a). When we superimposed the structures of various C1A protease-inhibitor complexes with falcipain-2, we found the difference density to overlap perfectly with the side-chain atoms of residues in the inhibitor P2 position (Fig. 6b), suggesting the density may have arisen from S2-subsite binding of Tris (a component of the crystallization buffer) or ethylene glycol (the cryoprotectant) or possibly iodide (a product of iodoacetamide treatment). Computation of an anomalous-difference Fourier did not support the presence of an anomalous scatterer such as iodine, however, and the residual Fo Fc density lacks characteristic features that would allow an unambiguous assignment to any particular buffer molecule.
Comparison with the Falcipain-2-Cystatin ComplexOne day after our experimental data were submitted to the Protein Data Bank (PDB), the 2.7-Å crystal structure of falcipain-2 in complex with egg white cystatin (a macromolecular cysteine protease inhibitor) appeared in the PDB (code 1YVB).4 Although the details of the structure have not yet been reported, the release of the coordinates has allowed us to make a brief comparison between the two structures. The overall C
Catalytic Activity of Falcipain-2The pH profile of falcipain-2 activity shows pronounced differences depending on the offered substrates. The broad pH optima of Z-Phe-Arg-pNA hydrolysis and of self-processing indicates that the active site of the protein is in a catalytically active state at least in the range from pH 4.5 (as shown in Ref. 18) to 8.5. Even minor substrate modifications can apparently result in significantly different pH-dependent activity profiles; Shenai and co-workers (18) observed no activity at pH 8.0 with Z-Phe-Arg-AMC as a substrate, whereas 60% of the maximal activity was still observed at this pH with Z-Phe-Arg-pNA (Fig. 1b). The exact reason for this discrepancy remains to be established. Apparently, pNA is a better leaving group than AMC at this elevated pH. The cleavage specificity offalcipain-2 appears to change in a pH-/substrate-dependent manner from the rather unspecific cleavage of hemoglobin under acidic conditions to the highly specific cleavage of band 4.1 (17) and the falcipain-2 precursor at a neutral to weakly alkaline pH (Fig. 1d). The appearance of processing intermediates at pH 8.0 and above (Fig. 1d) in the case of the truncated falcipain precursor may indicate a stepwise removal of the pro-sequence. Because the catalytic site of the enzyme itself seems to be active over a wide pH range, the different pH profiles of the substrates are likely to reflect pH-controlled binding of the respective substrates. This hypothesis was found to be true for hemoglobin binding (Fig. 2). The observation that the affinity of falcipain-2 for methemoglobin is significantly higher than for hemoglobin was completely unexpected, although it had been demonstrated that several factors contribute to the formation of methemoglobin during plasmodial infection, including the acidic pH of the plasmodial food vacuole, oxidative damage within infected erythrocytes (51, 52), and the reduced activity of NADH-methemoglobin reductase (53). A significantly increased methemoglobin content in the range of 2042% has been detected in the plasmodial food vacuole compared with 0.61.0% in uninfected erythrocytes (51). Thus, the higher affinity of falcipain-2 for methemoglobin seems to reflect an adaptation to the conditions within Plasmodia-infected erythrocytes. This hypothesis is supported by further experimental data, where Sobolewski and co-workers (54) demonstrated in ex vivo experiments using murine erythrocytes that the conversion of 95% of the hemoglobin into methemoglobin by the addition of NO had no detectable impact on the viability of Plasmodium berghei. The authors suggested that under these conditions, the parasites had either resorted to an alternative food source or were able to utilize methemoglobin. Akompong et al. (51) could even demonstrate that a reduction of the methemoglobin content by the addition of riboflavin resulted in a reduced size of the P. falciparum food vacuole and blocked parasite proliferation in erythrocyte cultures. Consequently, it seems that the formation of methemoglobin is not an unwanted side effect of a plasmodial infection but a prerequisite for the efficient utilization of hemoglobin as a food source by the parasite. Our data indicate that falcipain-2 is perfectly suited to perform this function.
Self-processing of Falcipain-2Recombinant falcipain-2 was reported to be proteolytically processed during refolding (18). Our studies confirm these results, as N-terminal sequencing of the refolded protein exclusively revealed the sequence of the native mature protein (data not shown). Because we did not observe this auto-processing during the refolding of the inactive, truncated falcipain-2 precursor (FPc285a) (data not shown), we can now exclude the possibility that processing was an artifact due to trace amounts of a cysteine protease being present from the expression host. Based on inhibitor studies invivo, Dahl and Rosenthal (19) previously concluded that falcipain-2 and -3 are autohydrolytically processed at a neutral pH before their secretion into the food vacuole. Our results depicted in Fig. 1d demonstrate for the first time that falcipain-2 is capable of self-processing in trans, with an optimum at a weakly alkaline pH. This self-processing is fully sensitive to the cysteineprotease inhibitor E-64. Because the self-processing is still observable under acidic conditions, falcipain-2 may also contribute to the processing of other plasmodial proteins within the food vacuole. For instance, it has been shown that an as yet unidentified cysteine protease is involved in the processing of the plasmepsins (55, 56). However, the E-64 insensitivity of the plasmepsin processing (55, 56) would argue against a significant contribution of falcipain-2 to the processing of these particular proteins.
Structural Determinants of Protein Folding and Hemoglobin RecognitionAlthough the exact involvement of the 17-residue N-terminal segment in mediating correct folding of mature falcipain-2 is not clearly understood, previous mutational studies have pinpointed a critical role for the highly conserved Tyr-4 (20). The x-ray structure of falcipain-2 reveals this residue to be situated at the N terminus of helix
The 14-residue hemoglobin binding
Toward Novel Antimalarial Drugs Targeting the FalcipainsDespite the absence of structural data concerning the falcipain-2-hemoglobin complex, an opportunity is now emerging to apply the current three-dimensional knowledge of the falcipain-2 hemoglobin-binding The active-site cleft of falcipain-2 subfamily proteases, as for other C1A proteases and cysteine proteases in general, represents a prime target for therapeutic intervention (59, 60). Peptides and irreversible peptidic inhibitors have traditionally been used to probe the substrate specificity of cysteine proteases and to generate information that can be translated into the design of non-peptidic inhibitors with drug-like properties. Structure-guided approaches have already proven indispensable in the design of potent and highly selective inhibitors against the closest known structural homolog of falcipain-2, cruzipain (cruzain), from T. cruzi (the causative agent of Chagas disease) (46, 47, 61, 62). An experimental cure for Chagas disease in mice using optimized vinyl-sulfone-derivatized pseudopeptides has been reported (63), and similar vinyl-sulfone inhibitors have shown marked antimalarial effects in mice (with up to a 40% cure rate after 4 days of oral administration) (64) and broad activity across multiple P. falciparum strains (65).
The S2 pocket is the major determinant of specificity for most cysteine proteases (66), and its predominantly hydrophobic nature in falcipain-2 agrees well with the observation that all characterized falcipain-2 cleavage motifs of its specific intracellular protein targets, including ankyrin (NVSAR
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. This paper is dedicated to the memory of Anastância Joaquim, who died of misdiagnosed malaria on July 9, 2006.
The atomic coordinates and structure factors (code 2GHU) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).
1 These authors contributed equally to this work. 2 To whom correspondence should be addressed. Tel.: 49-451-500-4060; Fax: 49-451-500-4068; E-mail: hilgenfeld{at}biochem.uni-luebeck.de.
3 The abbreviations used are: Z-Phe-Arg-pNA, benzoyl-Phe-Arg-p-nitroanilide; NCS, non-crystallographic symmetry; r.m.s.d., root mean square deviation; Bis-Tris-propane, 1,3-bis[tris(hydroxymethyl)methylamino]propane; AMC, 7-amino-4-methylcoumarin.
4 S. X. Wang, unpublished data.
We thank Prof. T. Schirmeister (University of Würzburg) for supplying the initial falcipain-2 expression clone and Dr. A. Petersen (Research Center Borstel) for N-terminal sequencing. We thank S. Siedler, D. Mutschall, and S. Zoske for excellent technical assistance. R. H. thanks the Fonds der Chemischen Industrie for continuous support.
This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||