Originally published In Press as doi:10.1074/jbc.M603193200 on June 27, 2006
J. Biol. Chem., Vol. 281, Issue 35, 25492-25501, September 1, 2006
Elevated Testosterone Induces Apoptosis in Neuronal Cells*
Manuel Estrada12,
Anurag Varshney1, and
Barbara E. Ehrlich3
From the
Departments of Pharmacology and Cellular and Molecular Physiology, Yale University, New Haven, Connecticut 06520
Received for publication, April 4, 2006
, and in revised form, June 20, 2006.
 |
ABSTRACT
|
|---|
Testosterone plays a crucial role in neuronal function, but elevated concentrations can have deleterious effects. Here we show that supraphysiological levels of testosterone (micromolar range) initiate the apoptotic cascade. We used three criteria, annexin V labeling, caspase activity, and DNA fragmentation, to determine that apoptotic pathways were activated by testosterone. Micromolar, but not nanomolar, testosterone concentrations increased the response in all three assays of apoptosis. In addition, testosterone induced different concentration-dependent Ca2+ signaling patterns: at low concentrations of testosterone (100 nM), Ca2+ oscillations were produced, whereas high concentrations (1-10 µM) induced a sustained Ca2+ increase. Elevated testosterone concentrations increase cell death, and this effect was abolished in the presence of either inhibitors of caspases or the inositol 1,4,5-trisphosphate receptor (InsP3R)-mediated Ca2+ release. Knockdown of InsP3R type 1 with specific small interfering RNA also abolished the testosterone-induced cell death and the prolonged Ca2+ signals. In contrast, knockdown of InsP3R type 3 modified neither the apoptotic response nor the Ca2+ signals. These results support our hypothesis that elevated testosterone alters InsP3R type 1-mediated intracellular Ca2+ signaling and that the prolonged Ca2+ signals lead to apoptotic cell death. These effects of testosterone on neurons will have long term effects on brain function.
 |
INTRODUCTION
|
|---|
Neurosteroids have been implicated as components essential for the normal function of the central nervous system (1-4). The gonadal steroid hormones are required for reproductive function, but androgens also affect areas of the brain that are not primarily involved in reproduction such as the hippocampus (5), preoptic area, amygdala, and medial hypothalamic area (6). At physiological levels, androgens are involved in neuronal differentiation, neuroprotection, neuronal survival and development (7-9). These responses occur slowly (over hours) and are mediated through the intracellular androgen receptor. In the developing brain, androgens are capable of changing the ultrastructural characteristics of the neuronal plasma membrane with a relatively fast pace (10, 11). Recently, we have shown that nanomolar levels of testosterone induce rapid intracellular Ca2+ increases in neuroblastoma cells (within seconds), which begin as Ca2+ transients in the cytosol, propagate as waves of Ca2+ in the cytoplasm and nucleus, and develop into an oscillatory pattern (12). These Ca2+ signals depend on an interplay between Ca2+ efflux from the endoplasmic reticulum through inositol 1,4,5-trisphosphate-sensitive Ca2+ release channels (InsP3Rs)4 and Ca2+ reuptake into the endoplasmic reticulum by Ca2+ pumps. This new testosterone-induced pathway in neuronal cells leads to neurite outgrowth (12), an essential event in neuronal differentiation (13). These results suggest an important physiological mechanism for the action of testosterone in neurons at physiological concentrations. However, it is unknown how these cells respond to high plasma levels of this neurosteroid, generally administered exogenously to achieve an increase in muscle mass (14, 15) or for replacement therapy (16). In vivo administration of large doses of androgens has been correlated with neurobehavioral changes like hyperexcitability, supra-aggressive nature, and suicidal tendencies (17, 18). These behavioral changes could be the outward manifestation of neuronal damage resulting from exposure to high concentrations of testosterone.
In this investigation, we evaluated the hypothesis that high concentrations of testosterone can induce deleterious effects in neurons. We show that high levels of testosterone initiate an apoptotic program in neuroblastoma cells. Apoptosis is the normal and controlled process of cell death (19). Precise control of apoptosis is critical in many processes of life, including development and disease. The onset of apoptosis and its progression can be altered by both endogenous and exogenous insults (20). Apoptosis is characterized by many physical, cellular, and physiological parameters, which include membrane blebbing, caspase activation, change in membrane potential, and DNA damage-associated nuclear deformation (19, 21, 22). Prolonged elevated cytosolic calcium (Ca2+) concentrations can initiate the apoptotic program in many cell types (23, 24), including neurons (25). The testosterone-induced apoptosis described here occurs through overactivation of intracellular Ca2+ signaling pathways. The progression into cell death could be attenuated by the addition of inhibitors of the InsP3R signaling pathway. Moreover, we found that InsP3R type 1, the predominant isoform of the InsP3R found in neurons (26), is the key integrator of the testosterone response in both normal and hyperstimulated Ca2+ signaling in neuroblastoma cells. It is this pathway that has been implicated in other pathophysiological conditions. For example, overstimulation of the apoptotic program in neurons has been associated with several neurological illnesses, such as Alzheimer disease (27, 28) and Huntington disease (29-31). Our results suggest that the responses to elevated testosterone can be compared with these pathophysiological conditions.
 |
MATERIALS AND METHODS
|
|---|
Chemical ReagentsTestosterone, 17
-estradiol, 2-aminoe-thoxydiphenyl borate (2-APB), and the TOX-2 cell viability assay were purchased from Sigma. Fluo4-acetoxymethylester was acquired from Molecular Probes, Inc. (Eugene, OR). Caspase-cleavable peptides, Ac-DEVD-AFC and Ac-DEVD-CHO, were obtained from BD Biosciences. Cell-permeable forms of these peptides, colorigenic caspase substrate Ac-DEVD-pNA, and xestospongin-C were obtained from Calbiochem.
Cell CulturesThe human neuroblastoma cell line (SH-SY5Y; ATCC) was cultured in 1:1 Dulbecco's modified Eagle's medium/Ham's F-12 medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 5% nonessential amino acids, 100 units of penicillin, and 50 µg/ml streptomycin in a 95% air, 5% CO2 humidified incubator at 37 °C. Cells were grown on 22 x 22-mm gelatin-coated glass coverslips for the Ca2+ measurements or in 100-mm Petri dishes for biochemical and spectrochemical assays. Cultured cells were washed once with PBS before stimulation with testosterone (from concentrated stocks made in ethanol). The final ethanol concentration (<0.01%) had no effect on intracellular Ca2+ concentration or biochemical determinations (32).
Cell ViabilityCells were exposed to various concentrations of steroid hormones for different times. The number of viable cells was determined using a standard trypan blue exclusion assay. Cells were washed twice with PBS and then resuspended with EDTA. Cells were stained with 0.5% trypan blue, and the number of viable and nonviable cells was determined in a hemacytometer. Results are expressed as percentage viability (100 x number of viable cells/number of total cells per well) for each concentration of hormone tested. Cell viability was also assessed using the TOX-2 kit (Sigma) according to the manufacturer's protocol. This method determines the ability of metabolically active cells to reduce the yellow salt 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (XTT) to an orange formazan dye. Therefore, the conversion only occurs in living cells, and the amount of orange formazan formed directly correlates to the number of living cells. Neuroblastoma cells, grown in 60-mm Petri dishes in culture medium without phenol red and exposed to different steroid hormone concentrations, were washed with PBS and incubated with the XTT solution (final concentration 0.3 mg/ml), according to the kit specifications. After this incubation period, quantification of formazan dye formed was determined using a spectrophotometer at a wavelength of 450 nm minus the absorbance at 690 nm. Results are expressed as percentages with respect to controls (untreated cells).
Ca2+ ImagingCells were loaded with 5 µM Fluo4-acetoxymethylester at 37 °C for 30 min in "imaging solution": 135 mM NaCl, 5 mM KCl, 2 mM MgCl2, 2 mM CaCl2, 10 mM HEPES, 5.6 mM glucose, pH 7.4. After loading, cells were washed twice with the imaging solution and placed on an inverted microscope (Axiovert 100; Zeiss) connected to a laser scanning imaging system (LSM 510 META; Zeiss). Cells were stimulated with the hormone diluted in the imaging solution. A 488-nm excitation wavelength was focused through a 40x Apochromat water immersion objective lens (numerical aperture 1.2; Zeiss). In order to identify the cells expressing the siRNA, cells were cotransfected with DsRed-pCMV-cyto construct, which produced DsRed (red fluorescence protein), and were examined using fluorescence excitation at 568 nm. Regions of interest with the same pixel dimensions were identified and analyzed using Image J software (National Institutes of Health, Bethesda, MD). The inhibitors were added during the dye incubation; times and concentrations are indicated under "Results." The fluorescence intensity ratio (F/Fo) was plotted as a function of time.
Annexin V LabelingCells were incubated in different concentrations of testosterone for 6 h. After treatment, cells were washed twice with PBS and once with fixation buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM NaCl, 5 mM CaCl2) and were incubated with fluorescein isothiocyanate-conjugated annexin V (0.5 µl per 100 µl of fixation buffer; BD Biosciences) for 15 min at room temperature. The fluorescence of fluorescein isothiocyanate was visualized by laser-scanning confocal microscopy (LSM 510 META; Zeiss). Annexin V fluorescence-positive cells were analyzed by the Image J program using the particle analysis macro (National Institutes of Health) and normalized to total cell count.
DNA Fragmentation AssayNeuroblastoma cells (1 x 106 cells) growing on 100-mm plates were washed once in PBS, harvested in 0.5 ml of extraction buffer (50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 0.5% SDS, 0.5 mg/ml proteinase K), and incubated at 55 °C for 30 min in the presence of 20 mg/ml RNase A. The lysate was centrifuged at 15,000 x g for 10 min, and aqueous fractions were extracted with phenol/chloroform two to three times. Nucleic acids were precipitated with 0.1 volumes of 3 M sodium acetate and 2.5 volumes of 100% ethanol. Pelleted DNA was washed with 70% ethanol and was resuspended in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) kept at 37 °C. DNA was run on a 2% agarose gel containing ethidium bromide, visualized with a UV transilluminator, recorded with a UVP gel-doc system, and analyzed by scanning densitometry.
Assay of Proteolytic Activity of Caspases 6 h after incubation with 100 nM to 10 µM testosterone, 1 x 106 neuroblastoma cells were washed with PBS and collected in cell lysis buffer (50 mM HEPES, pH 7.5, containing 10% sucrose and 1% Triton X-100). Following removal of cell debris and mitochondria from the lysate by centrifugation, the supernatant was diluted 2-fold with PBS and incubated at 37 °C for 30 min in the presence of 10 mM dithiothreitol. Ac-DEVD-AFC (at the final concentration of 15 µM), dissolved in Me2SO, was added to the mixture, and the sample was incubated for another 30 min. The mixture was then transferred to a quartz 1-cm square cuvette, and AFC fluorescence (excitation, 400 nm; emission, 505 nm) was measured (Quantamaster spectrofluorometer; Photon Technology International). For colorimetric measurement of caspase activity, Ac-DEVD-pNA (Calbiochem) was added at a final concentration of 200 µM to lysates generated from identical numbers of cells under different experimental conditions. Caspase activity was monitored as optical absorbance at 405 nm (Spectronic Genesys2 spectrophotometer) in a time-dependent manner. In the caspase inhibition experiments, 200 nM Ac-DEVD-CHO (BD Biosciences) was added to the mixture prior to Ac-DEVD-AFC or Ac-DEVD-pNA for 30 min.
Western BlotCells lysates containing 40 µg of protein were separated by SDS-PAGE in a 4-20% linear gradient followed by electrophoretic transfer onto polyvinylidene difluoride membranes for 3 h at 400 mA. The following primary antibodies and their dilution were used: anti-InsP3R type 1 (1:2,000; custom produced by Research Genetics), anti-InsP3R type 3 (1:1,000; BD Biosciences), ERK2 (1:1,000, Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Membranes were incubated with primary antibodies overnight at 4 °C. After incubation with horseradish peroxidase-conjugated secondary antibodies (1:10,000; Bio-Rad) for 2 h at room temperature, the bands were visualized by an enhanced chemiluminescence system (Pierce). Membranes were stripped and reprobed with ERK2 antibody, which was used as a sample loading control. Blots were quantified by scanning densitometry.
siRNAsiRNAs for InsP3R type 1 and type 3 were kindly provided by Dr. M. Nathanson (Yale University). The siRNA templates were obtained from Ambion, and the sequence was AAAGCACCAGCAGCTACAACTCCTGTCTC of the human InsP3R type 1 and AAACAAGTTTGCCAGCACCAT for InsP3R type 3. Transfection of cells with siRNA was performed using RNAiFect (Qiagen), and down-regulation of either type 1 or type 3 InsP3R was confirmed by immunofluorescence and Western blot analysis.
StatisticsData are expressed as the mean ± S.E. Colorimetrical measurements of caspase activity were fit to a linear equation to estimate the rate of activation. In order to compare the difference between basal and poststimulated points, we carried out analysis of variance, and the statistic differences were determined by the Bonferroni post-test. p < 0.05 was considered statistically significant.
 |
RESULTS
|
|---|
High Concentration of Testosterone Induces Neurotoxicity Previously we found that physiological concentrations of testosterone (nanomolar range) induced neuronal differentiation in neuroblastoma cells (12), but it was not clear that supraphysiological levels of this hormone (micromolar range) would have the same effect. Therefore, we treated neuroblastoma cells with different concentrations of testosterone and compared the effect on several parameters, including cell survival. When treated with low concentrations of testosterone (100 nM), cell viability did not change to any appreciable extent over the time range studied (Fig. 1A). Exposure of the cells to 1 µM testosterone induced a significant decrease in cell viability over 24 h. At 10 µM, testosterone was even more lethal (Fig. 1A). To confirm the results determined by the trypan blue exclusion assay, we monitored the effect of testosterone using the XTT cell viability assay. The response after 12 h of treatment was selected for comparison, because the higher concentrations of testosterone (1 and 10 µM) induced a significant deleterious effect at this time point using the previous assay. As predicted, 100 nM testosterone did not affect cell viability, whereas 1 and 10 µM testosterone significantly decreased cell viability (Fig. 1B). Using a similar range of concentrations of estrogen (17
-estradiol), we saw no effect on cell viability, indicating that the decrease in cell viability was specifically triggered by high concentrations of testosterone (Fig. 1B).
High Concentrations of Testosterone Induce ApoptosisCell viability as determined using either trypan blue exclusion or XTT methods does not discriminate between cell death by apoptosis or necrosis. To identify the mechanism of cell death induced by testosterone, we examined annexin V labeling, caspase activation, and DNA laddering, all markers of apoptosis. Untreated cells did not show fluorescence due to annexin V labeling (Fig. 2A), whereas staurosporine (1 µM), a well established inducer of apoptosis, produced high levels of annexin V-positive cells, depicted in green (Fig. 2B). In the bright field image, it is possible to observe the morphological changes induced by staurosporine (Fig. 2B; superimposed images are shown in the right panel). When neuroblastoma cells were exposed to 100 nM testosterone, very few annexin V-positive cells were detected after 6 h of incubation (Fig. 2C; 4 ± 1%, n = 780 cells). Elevated concentrations of testosterone significantly increased the number of annexin V-positive cells: 21 ± 3% for 1 µM (n = 834 cells; p < 0.05) and 34 ± 8 for 10 µM (n = 600 cells; p < 0.01) testosterone were annexin V-positive (Fig. 2, D and E), where p values are calculated for treatment as compared with the control. These percentages for apoptotic cell death are consistent with the number of dead cells identified by the cell viability assay. Moreover, bright field images also show morphological changes associated with apoptosis; cells have plasma membrane blebs and were more round in shape with loss of their processes (Fig. 2, D and E). To further confirm the specificity of the response to testosterone, cells were exposed to high concentrations of estrogen (1-10 µM). There was no significant labeling of annexin V detected (data not shown), indicating that the apoptotic death pathway was specifically activated by testosterone.

View larger version (99K):
[in this window]
[in a new window]
|
FIGURE 2. Effect of testosterone on annexin V labeling in neuroblastoma cells. Cells were exposed to different concentrations of testosterone and the fluorescent apoptotic marker, annexin V, was visualized by confocal microscopy. A, untreated cells did not show fluorescence, and in the bright field image the integrity of the cells was observed. B, staurosporine was used as a positive control to maximally induce apoptosis. Cells induced with 1 µM staurosporine displayed a high fluorescence with a marked change in the cellular morphology. C-E, cells were exposed to three concentrations of testosterone for 12 h, and the annexin V-positive labeling was determined. C, at 100 nM testosterone, few cells were positive to annexin V, and the cell morphology did not change when compared with the control cells. At 1 µM (D) and 10 µM (E) testosterone, an increase in the number of fluorescent cells was observed. In the bright field images, cells were much rounder in shape with loss of their process. For each concentration, at least 1000 cells were counted. *, p < 0.05. FITC, fluorescein isothiocyanate.
|
|
Apoptotic cell death can be defined by morphological and biochemical characteristics, such as DNA fragmentation (33), that can be visualized on an agarose gel. We observed that 1 and 10 µM testosterone induced considerable DNA damage in neuroblastoma cells within 6 h (Fig. 3A, lanes 4 and 5), whereas treatment with 100 nM testosterone for the same duration did not induce DNA damage (Fig. 3A, lane 3). To be certain that the death of neuroblastoma cells is indeed due to a canonical apoptotic pathway, it is necessary to show that testosterone activates aspartate-specific proteases (caspases) (34). Pretreatment of neuroblastoma cells with the cell-permeable caspase inhibitor (Ac-DEVD-CHO with 16 N-terminal amino acid residues of the signal peptide of Kaposi fibroblast growth factor that confers cell permeability to the peptide) abolishes the testosterone effect on cell viability at both concentrations tested earlier (Fig. 3B). To directly follow caspase activity, the hydrolysis of a specific fluorogenic substrate, Ac-DEVD-AFC, in cell-free extracts prepared from neuroblastoma cells was recorded after cells were treated with testosterone. The steadystate fluorescence emission spectrum of the mitochondria-free extract (Fig. 3C), recorded after the addition of Ac-DEVD-AFC, indicates hydrolysis of the substrate and release of the AFC fluorophore. Prior addition of the caspase inhibitor, Ac-DEVD-CHO, competitively inhibits AFC release (Fig. 3C), suggesting the specific activation of aspartate protease(s). The cell-free extracts prepared from untreated neuroblastoma cells produced no caspase activity. In addition, the time course of caspase activation as a function of increasing concentrations of testosterone was monitored by using a colorimetric caspase substrate Ac-DEVD-pNA. There was an increase in caspase activity in cells treated with either 1 or 10 µM testosterone, whereas treatment with 100 nM testosterone elicited caspase activity comparable with that of untreated cells (Fig. 3D). All three characteristic parameters, annexin V labeling, DNA fragmentation, and caspase activation, were induced by treatment with testosterone, supporting the conclusion that cells treated with high levels of testosterone (micromolar concentrations) die by initiation of the apoptotic cascade.

View larger version (50K):
[in this window]
[in a new window]
|
FIGURE 3. DNA fragmentation and assay of caspase activity in neuroblastoma cells. A, cells were treated with three concentrations of testosterone (Testo) for 6 h, and DNA fragmentation was assessed by 2% agarose gel electrophoresis and ethidium bromide staining. B, neuroblastoma cell viability was determined by an XTT assay. Cells were preincubated with the cell-permeable caspase inhibitor and exposed to 1 µM or 10 µM testosterone for 12 h. C, the fluorescence spectrum, recorded 30 min after the addition of Ac-DEVD-AFC to the extract prepared from 1µM testosterone-induced cells. Ac-DEVD-AFC was added to a final concentration of 150 nM. The caspase-dependent release of AFC following hydrolysis of the substrate is monitored upon excitation at 400 nm. A distinctive emission peak was observed between 475 and 505 nm. The extracts were prepared from 1 x 106 cells 6 h after treatment with testosterone (black line) or from cells without any treatment (gray line). The addition of the caspase inhibitor Ac-DEVD-CHO competitively blocked the AFC release. Lysates from the testosterone-treated cells that were incubated first with Ac-DEVD-CHO and than subjected to the same treatment as in C did not exhibit the AFC release (dotted line). D, concentration dependence of testosterone on caspase activation. For these experiments, a colorigenic substrate of caspase, Ac-DEVD-pNA, was used. Lysates generated from cells treated with 100 nM ( ), 1 µM ( ), and 10 µM () testosterone were incubated with the substrate, and the pNA absorbance was plotted as a function of time. Lysates from untreated cells were used as negative control ( ). Data points were fit to a straight line (gray lines) to calculate the rate of caspase activation (1.1 ± 0.05/s and 1.4 ± 0.02/s for 1 and 10 µM testosterone treatments, respectively). The same amount of protein was used in each assay. The values represent the mean ± S.E. of three independent experiments (*, p < 0.05; **, p < 0.01).
|
|
High Concentrations of Testosterone Increase Intracellular Ca2+An incremental rise in cytosolic Ca2+ has been suggested as a critical step in activating neuronal apoptosis (22). We examined the testosterone-induced Ca2+ responses in neuroblastoma cells by measuring Ca2+ changes at the single cell level in cells loaded with the Ca2+-sensitive fluorescent dye, Fluo4-acetoxymethylester. Stimulation of neuroblastoma cells with different testosterone concentrations (100 nM, 1 µM, and 10 µM) induced Ca2+ responses with different temporal patterns (Fig. 4). At 100 nM testosterone, increases in Ca2+, which were absent at the time of hormone application, were observed, and the level of Ca2+ returned to the basal level between repetitive oscillations (Fig. 4A; n = 70 cells from five independent cultures). We previously determined that Ca2+ signals evoked by testosterone were dependent on the generation of inositol 1,4,5-trisphosphate as well as on the activity of the InsP3R (12). At higher concentrations of testosterone, the response was more irregular, often with a persistent Ca2+ rise, which was maintained as long as hormone was present in the medium. At 1 µM, an initial rise was observed that was followed by a slow return to base line (Fig. 4B, n = 83 cells, from four independent cultures), whereas at 10 µM, long lasting Ca2+ increases were seen where the return to basal level occurred only after several minutes (Fig. 4C, n = 91 cells, from four independent cultures). The duration of the Ca2+ spike increased as the hormone concentration was raised (Fig. 4D), showing a change from repetitive Ca2+ spikes to a prolonged Ca2+ transient. The peak amplitudes of the Ca2+ transients were conserved (Fig. 4). These results demonstrate a loss of the normal oscillatory Ca2+ pattern when testosterone levels are elevated.

View larger version (33K):
[in this window]
[in a new window]
|
FIGURE 4. Testosterone induces rises in intracellular Ca2+ in a concentration-dependent manner. The relative fluorescence change (ratio between stimulated and basal values) as a function of time is shown for three different concentrations of testosterone. Shown are representative single cell intracellular Ca2+ tracings in response to the indicated hormone concentrations; the arrows indicate the time of stimulation. Three types of responses were observed; nanomolar concentrations of testosterone induced Ca2+ oscillations (A), whereas micromolar concentrations produced long lasting Ca2+ transients (B and C) without oscillations. The testosterone-induced Ca2+ response was blocked, at all three concentrations of testosterone, in cells preincubated with inhibitors of the InsP3R, 2-APB (20 µM), or xestospongin-C (Xesto-C; 5 µM). D, each bar corresponds to the average duration of a Ca2+ response (or transient) of a single cell evoked by a specific concentration of testosterone. The bars indicate mean ± S.E. of 50 individual cells from six independent experiments. *, p < 0.05; **, p < 0.01.
|
|
The ability of testosterone to induce either Ca2+ oscillations or sustained Ca2+ responses was attenuated by InsP3R inhibitors. When the cells where preincubated with either 2-APB (20 µM) or xestospongin-C (5 µM), the testosterone-induced Ca2+ oscillations at 100 nM were abolished (Fig. 4A; n = 46 and n = 57, respectively). The addition of InsP3R inhibitors also altered the Ca2+ response patterns evoked by elevated concentrations of testosterone. At 1 or 10 µM testosterone, the Ca2+ response was significantly attenuated or inhibited (Fig. 4, B and C; n = 35 and n = 48, respectively). Taken together, these results suggest that testosterone regulates InsP3R-evoked Ca2+ increases by controlling the Ca2+ release from internal stores.
InsP3R Is Involved in the Apoptotic Pathway Induced by TestosteroneOur results suggest that the InsP3R is directly involved in the apoptotic response induced by testosterone. We tested this hypothesis by monitoring the apoptosis parameters in the presence of InsP3R blockers. Cells treated with 1 or 10 µM testosterone in the presence of these blockers had significantly lower staining for annexin V as compared with cells treated with testosterone alone (compare Fig. 5, A and B, with Fig. 2, D and E). We found that 2-APB and xestospongin-C could also protect the cells from apoptosis-associated DNA damage (Fig. 5C, lanes 3 and 4, and Fig. 5D). We also compared caspase activity in the presence of 2-APB and xestospongin-C and found that treatment with InsP3R blockers suppressed the activation of caspases by testosterone at both concentrations tested (see Fig. 5E for 1 µM). The rates of caspase activation by testosterone were significantly lower when cells were treated with 2-APB and xestospongin-C (Fig. 5F). Taken together, these results confirm that testosterone-induced apoptosis is mediated though InsP3R and that InsP3R blockers can protect cells from progression into this cell death pathway.
InsP3R Type 1 Is Involved in Both Normal and Dysregulated Ca2+ SignalingNeuroblastoma cells express mainly InsP3R type 1 (35), but the presence of significant amounts of InsP3R type 3 has also been described (36). To establish which isoform of InsP3R is important for the testosterone-induced Ca2+ increases and subsequent activation of the cell death program, neuroblastoma cells were transfected with specific siRNA against InsP3R type 1 or type 3. These siRNA probes have not shown any cross-reactivity among the subtypes (37). There was a significant reduction in the immunosignal for InsP3R protein in either InsP3R type 1 siRNA-transfected cells (Fig. 6A, left; n = 6; p < 0.01) or InsP3R type 3 siRNA-transfected cells (Fig. 6A, right; n = 6; p < 0.01). Cells knocked down for InsP3R type 1 or type 3 were then treated with testosterone under conditions described earlier. Cells knocked down for InsP3R type 3 showed a similar caspase activity as untransfected cells, whereas in cells knocked down for InsP3R type 1, the caspase activity induced by 1 µM testosterone was completely abolished (Fig. 6B). In order to determine the molecular contribution of InsP3R type 1 and type 3 to the testosterone-induced Ca2+ response, Ca2+ transients were recorded in InsP3R type 1 or type 3 knocked down cells. To identify the successfully transfected cells, we co-transfected the siRNA with a plasmid DNA coding for DsRed. We found that neuroblastoma cells knocked down for InsP3R type 3 did not modify their ability to evoke Ca2+ oscillations or prolonged transients in response to testosterone (Fig. 6, C-E, black lines). These responses to testosterone were similar to those recorded in untransfected cells (compare Fig. 6, C-E, with Fig. 4). In contrast, cells knocked down for the InsP3R type 1 did not respond to testosterone (Fig. 6, C-E, gray lines), but they still responded to extracellular application of ATP (data not shown). The magnitude of the response to thapsigargin, an inhibitor of the Ca2+ pump on the endoplasmic reticulum, was similar (data not shown), suggesting that store loading was unchanged by InsP3R knockdown. These data indicate a critical role of InsP3R type 1 but not type 3 in controlling the Ca2+ signaling in response to testosterone and regulation of its neuronal function.

View larger version (49K):
[in this window]
[in a new window]
|
FIGURE 5. InsP3R blockers inhibit testosterone-induced apoptosis. Inhibitors of InsP3R, 2-APB (20 µM), and xestospongin-C (Xesto-C; 5 µM) were used to determine the role of the InsP3R in testosterone-induced apoptosis. A and B, annexin V labeling in the presence of InsP3R inhibitors. Cells were treated with high (1 µM (A) and 10 µM (B)) concentrations of testosterone in the presence of 2-APB or xestospongin-C and scored for annexin V-positive cells. Upon the addition of these blockers, few cells were positive to annexin V, and the cell morphology did not change with respect to the control cells; compare these images with the responses shown in Fig. 2. One representative set of images is shown for 1 and 10 µM testosterone. C, DNA fragmentation in the presence of InsP3R blockers. Genomic DNA isolated from neuroblastoma cells treated with 1 µM testosterone in the presence of 2-APB (lane 3) and Xesto-C (lane 4) show significantly less DNA damage than that of 1 µM testosterone alone (lane 2). Cells without treatment (lane 1) and cells treated with 1 µM staurosporine (lane 5) were used as negative and positive control experiments, respectively. DNA damage was quantified by scanning densitometry and was normalized by total DNA intensity in each lane. D, the percentage of DNA degraded by 1 µM testosterone (52 ± 11%), in the presence of 2-APB (14 ± 2%), or in the presence of xestospongin-C (8 ± 6%) with respect to the response after treatment with staurosporine (86 ± 6%) and untreated cells (12 ± 3%). E and F, testosterone-induced caspase activity in the presence of InsP3R inhibitors. Using a colorigenic caspase substrate, Ac-DEVD-pNA, the time course of caspase activation was followed in lysates from cells treated with testosterone in the presence of InsP3R blockers. E, caspase activation induced by 1 µM testosterone () is inhibited by 2-APB ( ) or xestospongin-C ( ) treatment. The addition of the caspase inhibitor, Ac-DEVD-CHO, also abolishes the caspase activity ( ). These data were fit to the linear functions (gray lines) to yield rates of caspase activation. F, rates of caspase activation are severely affected by InsP3R blockers at both concentrations of testosterone tested. At 1 µM testosterone, the rate of caspase activation was 1.1 ± 0.1/s versus 0.2 ± 0.2/s for 2-APB and 0.2 ± 0.1/s for xestospongin-C. At 10 µM testosterone, the rate of caspase activation was 1.4 ± 0.0/s versus 0.2 ± 0.1/s for 2-APB and 0.1 ± 0.1/s for xestospongin-C. **, p < 0.01. FITC, fluorescein isothiocyanate.
|
|
 |
DISCUSSION
|
|---|
Testosterone is the main endogenous anabolic/androgenic steroid hormone, and it plays fundamental roles in development, differentiation, and cellular growth (38, 39). In neurons, testosterone acts as a neurosteroid and can induce changes at the cellular level, which in turn lead to changes in behavior, mood, and memory (40). Both neuroprotective (41, 42) as well as neurodegenerative (43) effects of androgens have been reported. Testosterone levels are substantially increased in human subjects using elevated doses of anabolic steroids to increase muscle mass (14), which can negatively affect their behavior (17) or induce degenerative processes (40). The cellular mechanisms of these physiological and deleterious effects of testosterone have not been elucidated.
In the present study, we have demonstrated for the first time that the treatment of neuroblastoma cells with elevated concentrations of testosterone for relatively short time periods (6-12 h) induces a decrease in cell viability by activation of a cell death program. Low concentrations of testosterone had no effects on cell viability, whereas at high concentrations the cell viability decreased with incremental increases in hormone concentration. Using three characteristic parameters, it was possible to show that this action of testosterone was through the apoptotic program. Being lipid-soluble molecules, steroids could influence membrane fluidity (and phosphatidylserine accessibility), as shown in lipid bilayer experiments with millimolar concentrations of steroids (44). In addition, aromatase, an enzyme that converts testosterone into estrogen (17
-estradiol), has been reported in the central nervous system and neuroblastoma cells (45). To rule out these possibilities, we simulated the cells with estrogen and found that equally elevated concentrations of estrogen had no effect on cell viability (Fig. 1B), suggesting that the response was specific for elevated testosterone concentration and not due to its metabolism to estrogen (Fig. 1B).
Previously, we demonstrated that testosterone (10-100 nM) induces intracellular Ca2+ oscillations in the cytosol and nucleus, which are an important mediator of downstream events, such as neurite outgrowth (12). In several cell models and using different apoptotic stimuli, it has been shown that an intracellular Ca2+ increase can trigger apoptosis (23, 25). In general, this occurs when the Ca2+ signal differs from the pattern expected for a specific stimulus. For example, modifying the amplitude or duration of the Ca2+ signals can lead to cell death (28). Here we show that testosterone can induce concentration-dependent patterns of Ca2+ signals. At low concentrations (100 nM), testosterone produces intracellular Ca2+ oscillations, which could be an important physiological mechanism for the action of androgen in neurons. When the concentration of testosterone is increased, the oscillatory pattern is lost, and transient and long-lasting responses appear. These testosterone-induced, long lasting rises in intracellular Ca2+ signals would be sufficient to initiate the apoptotic response.
Recently, a mechanism of apoptosis has been proposed that involves an interaction between cytochrome c and the InsP3R (46, 47). It has been suggested that the release of cytochrome c from mitochondria into the cytosol during the early stages of apoptosis could induce changes in inositol 1,4,5-trisphosphate-mediated Ca2+ signals. The model relies upon a binding between cytochrome c and the InsP3R causing a lack of regulation and producing an exaggerated Ca2+ release from the endoplasmic reticulum (46-48). The results presented in this study are consistent with this model, which shows that InsP3R blockers can inhibit the apoptotic response induced by testosterone. There are several reports that demonstrate that androgens can activate pertussis toxin-sensitive G proteins (49, 50). Also, other G-protein receptor agonists can induce an apoptotic program via phospholipase C-InsP3R-Ca2+ increase. For example, G-protein activation and subsequent interaction of G
with phospholipase C mediates the proapoptotic effects of ethanol in developing neural crest (51). The proapoptotic effects of the hormone angiotensin II also has been shown to mediate Ca2+ release from internal stores via G-protein-coupled receptor (52). Moreover, overexpression of wild-type G
q, which further increased Gq signaling, produced initial hypertrophy in cardiomyocytes, which rapidly progressed to apoptotic death (53).
Moreover, the importance of the InsP3R pathway for cell survival has been shown in cell models where deletion of InsP3Rs is associated with less cellular damage and more resistance to apoptosis (54, 55). Depending on the cell type studied, different subtypes of InsP3R have been associated with apoptosis progression. In developing and regenerating neurons, InsP3R type 1 is concentrated in the growth cone, suggesting its participation in neurite outgrowth (56), whereas InsP3R type 3 has been shown to be in neuron terminals in limbic and basal forebrain regions, including olfactory tubercle, central nucleus of the amygdala, and bed nucleus of the stria terminalis (26). Elevated expression of InsP3R type 3 has been implicated in developmental apoptosis in many cell types like early postnatal cerebellar granule cells, dorsal root ganglia, embryonic hair follicles, and intestinal villi (57). Recently, InsP3R type 3 was shown to modulate apoptosis in epithelial cells (58). In contrast, InsP3R type 1 was required for activation of the apoptosis pathway in T cells (54, 55) and in the neuroblastoma cells studied in this report. There are increasing numbers of reports showing differential distribution and different roles of InsP3Rs (59, 60) in agreement with the hypothesis that specific isoforms of the InsP3R will be critical for maintaining cell health; in the case of testosterone, the deleterious effects appear to be mediated through InsP3R type 1.
Both beneficial and pathological effects of androgens are observed clinically. Depletion of androgen (below normal plasma levels) increases kainate-induced neuronal loss (61). Interestingly, high levels of testosterone also produced serious side effects and have been related to neurobehavioral changes like hyperexcitability, supra-aggressive nature, and suicidal tendencies (17, 18). Externally administrated supraphysiological levels of testosterone can stimulate muscular bulk in human subjects (14, 15). Although this effect could be useful for patients with muscular physiopathologies, these kind of studies generally use blood testosterone concentrations ranging from 0.1 to 0.5 mM (16). Despite the complexity of the blood-brain barrier, the lipid-permeable nature of testosterone and the duration of these treatments (more than weeks) suggest that significant amounts of this hormone would be accessible to neuronal tissues. The effects of testosterone we describe here at the single cell level will have long term effects at the system level. Importantly, this study suggests that androgen supplementation for additional performance, rather than clinical needs, requires a careful reexamination. Thus, it appears that the beneficial effects of androgens are carefully regulated over a narrow (nanomolar) range of concentration, which is crucial for normal neuronal functions. A deviation from this concentration range in either direction could be deleterious for neuronal health.
The rapid effects of testosterone on intracellular Ca2+ signaling in neurons occur in the absence of the androgen receptor (12). There are additional effects of testosterone in neurons that require the androgen receptor (62). For example, testosterone activation of the androgen receptor increases the expression of cytoskeleton proteins, such as tubulin (63) and neuritin (64), which are important for neurite outgrowth and neuronal differentiation. Mutations of the androgen receptor that cause aggregation of polyglutamine-expanded protein induce cytotoxicity with normal levels of testosterone (65, 66), a primary cause of Kennedy syndrome (67). The effect of high testosterone concentration on cell function in these altered cells is not known. In addition, specific regions of the central nervous system contain 5
-reductase, a key protein for the action of testosterone (68), suggesting that in some cases local concentrations of testosterone could be higher than the plasma concentrations. Moreover, differential expression of androgen receptor in the central nervous system could also generate a range of testosterone sensitivity among neuronal cells (5).
Together, these results suggest that elevated concentrations of testosterone can induce programmed cell death, which is characterized by a decrease of cell viability, an increase in the number of annexin V-positive cells, DNA fragmentation, and caspase activation. Apoptotic parameters are blocked or diminished by InsP3R inhibitors and the specific knocking down of InsP3R type 1, indicating that this isoform is a key regulator in this event. Overall, the conclusions from these studies are that normal levels of testosterone are necessary for the normal Ca2+ response and to maintain homeostasis, but elevated concentrations produce altered Ca2+ signal, leading to deleterious effects in neurons.
 |
FOOTNOTES
|
|---|
* This work was supported by National Institutes of Health Grants GM63496 and DK61747 (to B. E. E.), and FONDECYT Grant 1060077 (to M. E.), and a National Kidney Foundation postdoctoral fellowship (to A. V.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
1 These authors contributed equally to this work. 
2 Present address: Programa de Fisiología y Biofísica, ICBM, Facultad de Medicina, Universidad de Chile, Correo 7, Santiago, Chile. Tel.: 56-2-9786272; Fax: 56-2-7776916; E-mail: iestrada{at}med.uchile.cl. 
3 To whom correspondence should be addressed: Dept. of Pharmacology, Yale University, 333 Cedar St., New Haven, CT 06520-8066. Tel.: 203-737-1158; Fax: 203-737-2027; E-mail: barbara.ehrlich{at}yale.edu.
4 The abbreviations used are: InsP3R, inositol 1,4,5-trisphosphate receptor; XTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide salt; PBS, phosphate-buffered saline; Ac, N-acetyl; AFC, amino-4-trifluoromethyl coumarin; CHO, aldehyde; pNA, p-nitroanilide; 2-APB, 2-aminoethyl diphenylborate; siRNA, small interfering RNA. 
 |
ACKNOWLEDGMENTS
|
|---|
We are grateful to M. Nathanson for providing critical reagents and to C. Gibson for thoughtful discussions and comments on the manuscript.
 |
REFERENCES
|
|---|
- Gould, E., and McEwen, B. S. (1993) Curr. Opin. Neurobiol. 3, 676-682[CrossRef][Medline]
[Order article via Infotrieve]
- McEwen, B. S. (1972) Adv. Behav. Biol. 4, 41-59[Medline]
[Order article via Infotrieve]
- McEwen, B. S. (1997) Ann. N. Y. Acad. Sci. 823, 201-213[Medline]
[Order article via Infotrieve]
- Pfaff, D. W., and McEwen, B. S. (1983) Science 219, 808-814[Abstract/Free Full Text]
- Kerr, J. E., Allore, R. J., Beck, S. G., and Handa, R. J. (1995) Endocrinology 136, 3213-3221[Abstract]
- Sar, M., Lubahn, D. B., French, F. S., and Wilson, E. M. (1990) Endocrinology 127, 3180-3186[Abstract]
- Hammond, J., Le, Q., Goodyer, C., Gelfand, M., Trifiro, M., and LeBlanc, A. (2001) J. Neurochem. 77, 1319-1326[CrossRef][Medline]
[Order article via Infotrieve]
- Matsumoto, A., Arai, Y., Urano, A., and Hyodo, S. (1994) Horm. Behav. 28, 357-366[CrossRef][Medline]
[Order article via Infotrieve]
- Rubinow, D. R., and Schmidt, P. J. (1996) Am. J. Psychiatry 153, 974-984[Abstract/Free Full Text]
- Tabori, N. E., Stewart, L. S., Znamensky, V., Romeo, R. D., Alves, S. E., McEwen, B. S., and Milner, T. A. (2005) Neuroscience 130, 151-163[CrossRef][Medline]
[Order article via Infotrieve]
- Mong, J. A., Glaser, E., and McCarthy, M. M. (1999) J. Neurosci. 19, 1464-1472[Abstract/Free Full Text]
- Estrada, M., Uhlen, P., and Ehrlich, B. E. (2005) J. Cell Sci. 119, 733-743
- Goldberg, J. L., and Barres, B. A. (2000) Annu. Rev. Neurosci. 23, 579-612[CrossRef][Medline]
[Order article via Infotrieve]
- Bhasin, S., Storer, T. W., Berman, N., Callegari, C., Clevenger, B., Phillips, J., Bunnell, T. J., Tricker, R., Shirazi, A., and Casaburi, R. (1996) N. Engl. J. Med. 335, 1-7[Abstract/Free Full Text]
- Morales, A. J., Haubrich, R. H., Hwang, J. Y., Asakura, H., and Yen, S. S. (1998) Clin. Endocrinol. 49, 421-432[CrossRef][Medline]
[Order article via Infotrieve]
- Rhoden, E. L., and Morgentaler, A. (2004) N. Engl. J. Med. 350, 482-492[Free Full Text]
- Thiblin, I., Lindquist, O., and Rajs, J. (2000) J. Forensic Sci. 45, 16-23[Medline]
[Order article via Infotrieve]
- Tirassa, P., Thiblin, I., Agren, G., Vigneti, E., Aloe, L., and Stenfors, C. (1997) J. Neurosci. Res. 47, 198-207[CrossRef][Medline]
[Order article via Infotrieve]
- Strasser, A., O'Connor, L., and Dixit, V. M. (2000) Annu. Rev. Biochem. 69, 217-245[CrossRef][Medline]
[Order article via Infotrieve]
- Thorburn, A. (2004) Cell. Signal. 16, 139-144[CrossRef][Medline]
[Order article via Infotrieve]
- Bhuyan, A. K., Varshney, A., and Mathew, M. K. (2001) Cell Death Differ. 8, 63-69[CrossRef][Medline]
[Order article via Infotrieve]
- Eldadah, B. A., and Faden, A. I. (2000) J. Neurotrauma 17, 811-829[Medline]
[Order article via Infotrieve]
- Hajnoczky, G., Davies, E., and Madesh, M. (2003) Biochem. Biophys. Res. Commun. 304, 445-454[CrossRef][Medline]
[Order article via Infotrieve]
- Orrenius, S., Zhivotovsky, B., and Nicotera, P. (2003) Nat. Rev. Mol. Cell. Biol. 4, 552-565[CrossRef][Medline]
[Order article via Infotrieve]
- Lipton, S. A., and Nicotera, P. (1998) Cell Calcium 23, 165-171[CrossRef][Medline]
[Order article via Infotrieve]
- Sharp, A. H., Nucifora, F. C., Jr., Blondel, O., Sheppard, C. A., Zhang, C., Snyder, S. H., Russell, J. T., Ryugo, D. K., and Ross, C. A. (1999) J. Comp. Neurol. 406, 207-220[CrossRef][Medline]
[Order article via Infotrieve]
- Guo, Q., Sopher, B. L., Furukawa, K., Pham, D. G., Robinson, N., Martin, G. M., and Mattson, M. P. (1997) J. Neurosci. 17, 4212-4222[Abstract/Free Full Text]
- Verkhratsky, A., and Toescu, E. C. (2003) J. Cell Mol. Med. 7, 351-361[Medline]
[Order article via Infotrieve]
- Varshney, A., and Ehrlich, B. E. (2003) Neuron 39, 195-197[CrossRef][Medline]
[Order article via Infotrieve]
- Tang, T. S., Tu, H., Chan, E. Y., Maximov, A., Wang, Z., Wellington, C. L., Hayden, M. R., and Bezprozvanny, I. (2003) Neuron 39, 227-239[CrossRef][Medline]
[Order article via Infotrieve]
- Tang, T. S., Slow, E., Lupu, V., Stavrovskaya, I. G., Sugimori, M., Llinas, R., Kristal, B. S., Hayden, M. R., and Bezprozvanny, I. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 2602-2607[Abstract/Free Full Text]
- Estrada, M., Liberona, J. L., Miranda, M., and Jaimovich, E. (2000) Am. J. Physiol. 279, E132-E139
- Nagata, S. (2005) Annu. Rev. Immunol. 23, 853-875[CrossRef][Medline]
[Order article via Infotrieve]
- Martin, S. J., and Green, D. R. (1995) Cell 82, 349-352[CrossRef][Medline]
[Order article via Infotrieve]
- Wojcikiewicz, R. J. (1995) J. Biol. Chem. 270, 11678-11683[Abstract/Free Full Text]
- Tovey, S. C., de Smet, P., Lipp, P., Thomas, D., Young, K. W., Missiaen, L., De Smedt, H., Parys, J. B., Berridge, M. J., Thuring, J., Holmes, A., and Bootman, M. D. (2001) J. Cell Sci. 114, 3979-3989[Medline]
[Order article via Infotrieve]
- Mendes, C. C., Gomes, D. A., Thompson, M., Souto, N. C., Goes, T. S., Goes, A. M., Rodrigues, M. A., Gomez, M. V., Nathanson, M. H., and Leite, M. F. (2005) J. Biol. Chem.
- Beato, M. (1989) Cell 56, 335-344[CrossRef][Medline]
[Order article via Infotrieve]
- Mooradian, A. D., Morley, J. E., and Korenman, S. G. (1987) Endocr. Rev. 8, 1-28[Medline]
[Order article via Infotrieve]
- Kelly, S. J., Ostrowski, N. L., and Wilson, M. A. (1999) Pharmacol. Biochem. Behav. 64, 655-664[CrossRef][Medline]
[Order article via Infotrieve]
- Aragno, M., Parola, S., Brignardello, E., Mauro, A., Tamagno, E., Manti, R., Danni, O., and Boccuzzi, G. (2000) Diabetes 49, 1924-1931[Abstract]
- Compagnone, N. A., and Mellon, S. H. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 4678-4683[Abstract/Free Full Text]
- Freeman, L. M., Watson, N. V., and Breedlove, S. M. (1996) Horm. Behav. 30, 424-433[CrossRef][Medline]
[Order article via Infotrieve]
- Duval, D., Durant, S., and Homo-Delarche, F. (1983) Biochim. Biophys. Acta 737, 409-442[Medline]
[Order article via Infotrieve]
- Wozniak, A., Hutchison, R. E., Morris, C. M., and Hutchison, J. B. (1998) Steroids 63, 263-267[CrossRef][Medline]
[Order article via Infotrieve]
- Boehning, D., Patterson, R. L., Sedaghat, L., Glebova, N. O., Kurosaki, T., and Snyder, S. H. (2003) Nat. Cell Biol. 5, 1051-1061[CrossRef][Medline]
[Order article via Infotrieve]
- Boehning, D., Patterson, R. L., and Snyder, S. H. (2004) Cell Cycle 3, 252-254[Medline]
[Order article via Infotrieve]
- Boehning, D., van Rossum, D. B., Patterson, R. L., and Snyder, S. H. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 1466-1471[Abstract/Free Full Text]
- Lieberherr, M., and Grosse, B. (1994) J. Biol. Chem. 269, 7217-7223[Abstract/Free Full Text]
- Estrada, M., Espinosa, A., Muller, M., and Jaimovich, E. (2003) Endocrinology 144, 3586-3597[Abstract/Free Full Text]
- Garic-Stankovic, A., Hernandez, M. R., Chiang, P. J., Debelak-Kragtorp, K. A., Flentke, G. R., Armant, D. R., and Smith, S. M. (2005) Alcohol. Clin. Exp. Res. 29, 1237-1246[CrossRef][Medline]
[Order article via Infotrieve]
- Kajstura, J., Cigola, E., Malhotra, A., Li, P., Cheng, W., Meggs, L. G., and Anversa, P. (1997) J. Mol. Cell. Cardiol. 29, 859-870[CrossRef][Medline]
[Order article via Infotrieve]
- Adams, J. W., Sakata, Y., Davis, M. G., Sah, V. P., Wang, Y., Liggett, S. B., Chien, K. R., Brown, J. H., and Dorn, G. W., II (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 10140-10145[Abstract/Free Full Text]
- Jayaraman, T., and Marks, A. R. (1997) Mol. Cell. Biol. 17, 3005-3012[Abstract]
- Szalai, G., Krishnamurthy, R., and Hajnoczky, G. (1999) EMBO J. 18, 6349-6361[CrossRef][Medline]
[Order article via Infotrieve]
- Takei, K., Shin, R. M., Inoue, T., Kato, K., and Mikoshiba, K. (1998) Science 282, 1705-1708[Abstract/Free Full Text]
- Blackshaw, S., Sawa, A., Sharp, A. H., Ross, C. A., Snyder, S. H., and Khan, A. A. (2000) FASEB J. 14, 1375-1379[Abstract/Free Full Text]
- Minagawa, N., Kruglov, E. A., Dranoff, J. A., Robert, M. E., Gores, G. J., and Nathanson, M. H. (2005) J. Biol. Chem. 280, 33637-33644[Abstract/Free Full Text]
- Johenning, F. W., Wenk, M. R., Uhlen, P., Degray, B., Lee, E., De Camilli, P., and Ehrlich, B. E. (2004) Biochem. J. 382, 687-694[CrossRef][Medline]
[Order article via Infotrieve]
- Jacob, S. N., Choe, C. U., Uhlen, P., DeGray, B., Yeckel, M. F., and Ehrlich, B. E. (2005) J. Neurosci. 25, 2853-2864[Abstract/Free Full Text]
- Ramsden, M., Shin, T. M., and Pike, C. J. (2003) Neuroscience 122, 573-578[CrossRef][Medline]
[Order article via Infotrieve]
- Yerramilli-Rao, P., Garofalo, O., Whatley, S., Leigh, P. N., and Gallo, J. M. (1995) J. Neurol. Sci. 129, (suppl.) 131-135[Medline]
[Order article via Infotrieve]
- Matsumoto, A., Arai, Y., and Hyodo, S. (1993) J. Neuroendocrinol. 5, 357-363[Medline]
[Order article via Infotrieve]
- Marron, T. U., Guerini, V., Rusmini, P., Sau, D., Brevini, T. A., Martini, L., and Poletti, A. (2005) J. Neurochem. 92, 10-20[CrossRef][Medline]
[Order article via Infotrieve]
- Darrington, R. S., Butler, R., Leigh, P. N., McPhaul, M. J., and Gallo, J. M. (2002) Neuroreport 13, 2117-2120[CrossRef][Medline]
[Order article via Infotrieve]
- LaFevre-Bernt, M. A., and Ellerby, L. M. (2003) J. Biol. Chem. 278, 34918-34924[Abstract/Free