Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M604460200 on June 23, 2006

J. Biol. Chem., Vol. 281, Issue 35, 25712-25722, September 1, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
281/35/25712    most recent
M604460200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Held, D. M.
Right arrow Articles by Burke, D. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Held, D. M.
Right arrow Articles by Burke, D. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Differential Susceptibility of HIV-1 Reverse Transcriptase to Inhibition by RNA Aptamers in Enzymatic Reactions Monitoring Specific Steps during Genome Replication*Formula

Daniel M. Held{ddagger}§, Jay D. Kissel{ddagger}, Dayal Saran§, Daniel Michalowski§, and Donald H. Burke§1

From the {ddagger}Department of Biology, Indiana University, Bloomington, Indiana 47405, the Department of Chemistry, Indiana University, Bloomington, Indiana 47405, and the §Department of Molecular Microbiology & Immunology and Department of Biochemistry, University of Missouri School of Medicine, Columbia, Missouri 65211

Received for publication, May 10, 2006 , and in revised form, June 22, 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Nucleic acid aptamers to HIV-1 reverse transcriptase (RT) are potent inhibitors of DNA polymerase function in vitro, and they have been shown to inhibit viral replication when expressed in cultured T-lymphoid lines. We monitored RT inhibition by five RNA pseudoknot RNA aptamers in a series of biochemical assays designed to mimic discrete steps of viral reverse transcription. Our results demonstrate potent aptamer inhibition (IC50 values in the low nanomolar range) of all RT functions assayed, including RNA- and DNA-primed DNA polymerization, strand displacement synthesis, and polymerase-independent RNase H activity. Additionally, we observe differences in the time dependence of aptamer inhibition. Polymerase-independent RNase H activity is the most resistant to long term aptamer suppression, and RNA-dependent DNA polymerization is the most susceptible. Finally, when DNA polymerization was monitored in the presence of an RNA aptamer in combination with each of four different small molecule inhibitors, significant synergy was observed between the aptamer and the two nucleoside analog RT inhibitors (azidothymidine triphosphate or ddCTP), whereas two non-nucleoside analog RT inhibitors showed either weak synergy (efavirenz) or antagonism (nevirapine). Together, these results support a model wherein aptamers suppress viral replication by cumulative inhibition of RT at every stage of genome replication.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The reverse transcriptase (RT)2 of HIV-1 catalyzes the multistep conversion of the single-stranded RNA viral genome into a double-stranded DNA copy for insertion into the host chromosome by the viral integrase. RT possesses both DNA- and RNA-dependent DNA polymerase functions, as well as RNase H activity to degrade the RNA strand in DNA/RNA heteroduplex replication intermediates. The enzyme is an asymmetric heterodimer composed of 66-kDa (p66) and 51-kDa (p51) subunits. The subunits associate initially as a p66 homodimer prior to removal of the C terminus of one of the two subunits by the viral protease (1, 2). The catalytic sites for both polymerase and RNase H function reside in the large subunit, whereas the small subunit contributes to primer/template binding and provides structural support for the large subunit (3, 4). Its essential role in viral replication and the early availability of anti-RT drugs have made RT a featured target for clinical treatment of HIV infection. Eleven of the twenty FDA-approved anti-HIV compounds are RT inhibitors, which are themselves grouped into two classes, nucleoside analog RT inhibitors (NRTIs) and non-nucleoside analog RT inhibitors (NNRTIs), based on their mode of action. The eight approved NRTIs are chain terminators that prevent the completion of viral genome replication following their incorporation by RT during DNA polymerization. The three NNRTIs, on the other hand, inhibit catalytic function directly by binding to RT near the polymerase active site and disrupting the local enzyme geometry (5-7).

Administration of combinations of two NRTIs along with an NNRTI or protease inhibitor has proven to be an effective method of suppressing viral titers in HIV-1 patients (termed highly active antiretroviral therapy, or HAART) (8, 9). However, drug toxicity, adherence issues, and the emergence of multidrug-resistant strains necessitate the continued search for novel classes of HIV inhibitory compounds. Nucleic acid aptamers are one such class of molecules to have demonstrated significant antiviral efficacy in recent years (10, 11). RNA and DNA aptamers generated by in vitro selections for binding to HIV-1 RT were first described as potent inhibitors of RT polymerase function over a decade ago (12-14). Subsequent biochemical probing (15) and crystallographic studies (4) of a canonical RNA aptamer revealed a pseudoknot fold, which binds to the enzyme at a site overlapping that of the primer/template substrate binding cleft. Wohrl and colleagues (16) used an RNA aptamer in a trap assay to block multiple turnover of single nucleotide incorporation by HIV-1 RT. Together, these observations led to introduction of the term "primer/template analog RT inhibitors" (TRTIs) to describe RT-inhibiting aptamers as a class (17).

It is important to establish the molecular basis for the antiviral action of nucleic acid aptamers. The most potent RNA aptamers inhibit polymerase function in vitro with IC50 values in the low nanomolar range (12, 14) and suppress viral replication when expressed in cultured lymphocytes (18-20). PCR-based analysis of DNA extracted from aptamer-protected cells suggests that aptamers disrupt reverse transcription at one or more steps early in the process, as evidenced by the inability to detect viral genomic DNA beyond the formation of the minus strand strong stop product (19). It is unclear whether viral escape from aptamer inhibition in these early stages would allow full replication, or if instead subsequent steps are similarly sensitive.

The process by which the HIV-1 RNA genome is copied to double-stranded DNA involves multiple steps requiring recognition of multiple nucleic acid substrates and performance of two distinct enzymatic activities by the viral RT (see Fig. 1A). Kinetic analyses of primer-template recognition by RT (21, 22) have clearly demonstrated that the enzyme performs DNA synthesis much more efficiently from DNA-primed templates than from RNA-primed templates. Because RNA aptamers are competitive inhibitors of primer/template substrate binding by the enzyme, we reasoned that nucleic acid substrate composition should directly affect the susceptibility of the enzyme to aptamer inhibition at different stages of genome replication. To better understand the point(s) at which RNA aptamers to RT most effectively inhibit HIV-1 reverse transcription, we performed a comprehensive biochemical analysis of RT inhibition by five RNA aptamers using in vitro assays that mimic various major steps of reverse transcription (see Fig. 1A). We demonstrate direct and potent inhibition of each RT function assayed, including RNase H activity. RNA-primed DNA polymerization is especially susceptible to aptamer inhibition to a degree not previously appreciated, as is distributive synthesis on both RNA and DNA templates. Our results suggest that the differential susceptibility of RT to aptamer inhibition is a direct function of primer-template backbone composition and enzymatic efficiency in accordance with previously established kinetic parameters. Furthermore, we propose that the multistep nature of HIV-1 reverse transcription enhances the susceptibility of RT to aptamer TRTIs because of the many binding and dissociation events required for completion of genome replication. Finally, we tested an aptamer in combination with two NNRTIs and two NRTIs and found that combinations that included the aptamer and an NRTI (AZTTP or ddCTP) display significant synergy for the inhibition of DNA polymerization by HIV-1 RT.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Reverse Transcriptase Cloning, Expression, and Purification DNA fragments encoding the large (p66) and small (p51) subunits of HIV-1 strain HXB2 reverse transcriptase were amplified by PCR from plasmid pHIV-gpt (23) (obtained from the National Institutes of Health AIDS Research and Reference Reagents Program (ARRRP)) and inserted into pET-200/D-TOPO expression vector (Invitrogen) according to the manufacturer's instructions and used to transform Escherichia coli strain BL21 StarTM (DE3) (Invitrogen). p66- and p51-expressing bacterial lines were grown separately in 500 ml of Luria Broth supplemented with 50 µg/ml kanamycin in a shaking incubator at 37 °C. Protein expression was induced with 0.5 mM isopropyl 1-thio-beta-D-galactopyranoside for 2-3 h once the cells reached an A600 of 0.4-0.6. Cells were harvested, and pellets were stored at -80 °C for one to several days before purification. Frozen cell pellets containing expressed p66 and p51 subunits were thawed and resuspended together in a total of 40 ml of ice-cold 10 mM imidazole, 500 mM NaCl, 40 mM MgCl2, 20 mM NaH2PO4, pH 7.4, 5% glycerol. The combined slurry was sonicated on ice to disrupt cell membranes and to release the soluble RT protein, and centrifuged 30 min at 14,000 rpm (Beckman JA-17 rotor) to pellet insoluble cell debris. Clarified lysate was passed over a nickel-nitrilotriacetic acid-agarose column (Qiagen), washed with 150-200 ml of wash buffer (20 mM imidazole, 500 mM NaCl, 20 mM NaH2PO4, pH 7.4, 0.01% Triton X-100), and eluted with 10 ml of elution buffer (500 mM imidazole, 500 mM NaCl, 20 mM NaH2PO4, pH 7.4). Imidazole-eluted RT was further purified on a Sephadex G-100 Superfine gel-filtration column equilibrated with wash buffer, and the recovered RT was concentrated on a second nickel-nitrilotriacetic acid column as described above. RT recovered from the second nickel-nitrilotriacetic acid column (6-8 ml) was dialyzed against a 1-liter solution of 400 mM NaCl, 32 mM NaH2PO4, pH 7.4, 20% glycerol, and 0.016% Triton X-100 at 4 °C once overnight and again for 24 h with one change of buffer. Following dialysis, a 0.6 volume of 100% glycerol was added to the recovered sample to bring the final glycerol concentration to 50%. Enzyme aliquots were stored at -20 °C. Absorbance at 280 nm was used to determine the final protein concentration using a molar absorbance value of 263010 M-1 cm-1. This value corresponds to the recombinant heterodimer, including N-terminal fusion tags, and was calculated as described (24), essentially by summing contributions to {epsilon}280 from tryptophan, tyrosine, and half cystine residues.

RNA Aptamers—RNA aptamers 70.5, 70.8, 80.55, and 80.93 were previously identified by in vitro selection from random pools (14). RNA for these four aptamers was generated by in vitro transcription from PCR templates using recombinant T7 RNA polymerase and purified on denaturing polyacrylamide gels. 70.5, 5'-gggaaaagguaagucauacacaagaUCCGAGGCAGAACGGGAAAAUCUGCGAAGUAACUGUGGAAUCCGUGACCUUUGACGUGAAAACCGCGAgggcauaagguauuuaauuccaua-3'; 70.8, 5'-gggaaaagguaagucauacacaagaCGAGACAAGUACCGAAAAAGAGAUCUGGCAGUGUCACAACCAGGAAAAAGACACGACGAACACGCCGCACgggcauaagguauuuaauuccaua-3'; 80.55, 5'-gggcauaagguauuaauuccauaAUGGCUCACCACAAGGGGAACGUUGAUGAAAUAGAGUUUAUCCCUUGGACUCACGCCGGCCGUGCUCCACACAAUCCAuugauucggaugcugccgguagcucaacucg-3'; and 80.93, 5'-gggcauaagguauuaauuccauaCCUCUCCACGACAAAUCCUUAUCGCAUGCAUGAGGGAGACCAGACAAGCAUGUACAAUCACCAAGUUAUGAUAGUUCGAGuugauucggaugcugccgguagcucaacucg-3'. Sequences derived from 70N or 80N primer binding sequences are shown in lowercase letters, and nucleotides of Stem I of the pseudoknots are underlined (see Fig. 1B). Aptamer T1.1 (5'-GGGAGAUUCCGUUUUCAGUCGGGAAAAACUGAA-3') is derived from an earlier in vitro selection for RT aptamers (12). The RNA sequence used here is identical to the variant used previously for co-crystallization with HIV-1 RT (4).

General Methods for Assessing Aptamer Inhibition of Reverse Transcriptase Activities—For each of the assays described below, RT-incorporated Cy3-labeled dCTP (Amersham Biosciences) or 5' Cy3-labeled DNA or RNA primers (Integrated DNA Technologies) were used to monitor RT enzymatic function. Each reaction was carried out in reaction buffer containing 75 mM KCl, 5 mM MgCl2, 50 mM Tris-HCl, pH 8.3, 10 mM dithiothreitol, and 100 ng/µl bovine serum albumin. Purified RT was used at a final concentration of 3 nM in all assays unless otherwise noted. Reaction times varied from three to 10 min depending on the rate of product formation in the absence of inhibitor; in general, reactions were allowed to proceed until maximum product formation was reached within the linear phase of the reaction (see Fig. 6A), because this allowed for a maximal dynamic range for assessing inhibition. Reactions were quenched at the specified time with two volumes of 95% formamide, 50 mM EDTA, and then heated for 2 min at 90 °C prior to electrophoresis on denaturing polyacrylamide gels. Gels were scanned for fluorescence using a Fujifilm FLA5000 imaging system, and RT activity data were collected using Fujifilm Multi Gauge V2.3 image analysis software. IC50 values for aptamer inhibition were obtained by fitting data to a sigmoidal dose-response curve with GraphPad Prism software using Equation 1,

Formula 1(Eq. 1)
where Y is the measured fraction product formation at a given inhibitor concentration, and X is the log of the inhibitor concentration. All enzyme activity inhibition assays from which IC50 values were calculated were performed in triplicate. Data were also fit to the quadratic Equation 2 to better reflect the similar aptamer and RT stoichiometries of the inhibition reactions,

Formula 2(Eq. 2)
where Y is the measured fraction product formation at a given inhibitor concentration (A), and B is the RT concentration for the experiment. Curves fit using both of the above equations yielded 50% maximal inhibition (IC50) at identical locations on the X axis.

DNA-primed DNA- and RNA-dependent DNA Polymerase Assays—An 18-nt DNA primer corresponding to the Formula 2 primer sequence (5'-Cy3-GTCCCTGTTCGGGCGCCA-3') was extended by a single nucleotide (ddCTP) on either a synthetic DNA or RNA 40-nt template corresponding to the HXB2 primer binding sequence (DNA version of the template: 5'-CAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGAC-3', nucleotides complementary to primer are underlined). Master mixes for 50 reactions were assembled by combining 30 nM primer, 45 nM template, and 0.02 mM ddCTP in reaction buffer, heated at 90 °C for 90 s, and cooled at room temperature for 10 min to anneal the primer/template. 5-µl aliquots were distributed into individual reaction tubes. 1 µl of serially diluted aptamer in reaction buffer was added to each reaction tube to yield final aptamer concentrations of 0, 0.3, 1, 3, 10, 30, or 100 nM. Reactions were initiated by the addition of 4 µlofRT and incubated at 37 °C for 3 min. Reactions were quenched and analyzed as described above. In a head-to-head comparison, we observe identical rates of product formation for reactions with dCTP and ddCTP (supplemental Fig. S1B).

RNA-primed RNA-dependent DNA Polymerase Assay— RNA-primed reactions from an RNA template were prepared and carried out essentially as the DNA-primed reactions except that dCTP (instead of ddCTP) was used at 5 mM, and the primer, template, and RT were used at 300, 450 and 30 nM, respectively, to account for the reduced affinity for RNA-primed complexes (22).

RNA-primed DNA-dependent DNA Polymerase Assay—The 18-nt RNA primer (without Cy3 label) used in the RNA-primed RNA-dependent DNA polymerase assay was extended to completion on the 40-nt DNA template used in the DNA-primed DNA-dependent DNA polymerase assay. Reactions were assembled by mixing 300 nM primer, 450 nM template, 0.1 mM each of dATP, dGTP, dTTP, and dCPT, and 0.02 mM Cy3-dCTP (Amersham Biosciences) in reaction buffer. Individual reaction aliquots (including aptamer) were prepared as described above. Reactions were quenched after 8 min at 37 °C, and full-length product formation was monitored according to incorporation of Cy3-labeled deoxycytidine.

Distributive and Strand Displacement DNA Synthesis Assays—The 5'-Cy3-labeled 18-nt DNA primer used in the DNA-primed DNA polymerase assays described above was extended to completion on either a 103-nt DNA template corresponding to the HXB2 5'-long terminal repeat) U5 and primer binding sequences (5'-AAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGAC-3') or a 106-nt RNA template of identical sequence (generated by in vitro transcription using T7 RNA polymerase) with three appended 5'-guanosines, which were added to the RNA sequence for efficient in vitro transcription. The DNA-dependent DNA polymerase assay was also performed in the presence of a 70-nt blocking DNA oligonucleotide (BO) (5'-CACACTGACTAAAAGGGTCTGAGGGATCTCTAGTTACCAGACTCACACAACAGACGGGCACACACTACTT-3') complementary to the 5' 70 nt of the template strand (underlined in sequence of template, above) to monitor strand displacement DNA synthesis. Reactions were assembled and initiated as described for the DNA-primed DNA polymerase assays above (0.02 mM dNTPs instead of ddCTP) and incubated at 37 °C for 10 min before quenching and electrophoresis. Titration with varying concentrations of BO shows the 60 µM BO to be essentially saturating. DNA-dependent DNA polymerization in the absence of BO proceeded to completion more rapidly than did strand displacement; these assays were quenched after 3 min at 37 °C.

Polymerase-independent RNase H Activity Assay—A 43-nt, fluorescently labeled RNA oligonucleotide corresponding to the 5'-end of the HXB2 RNA genome (5'-Cy3-GGUCUCUCUGGUUAGACCAGAUCUGAGCCUGGGAGCUCUCUGG-3') was subjected to RNase H cleavage by RT when annealed to a DNA oligonucleotide complementary to the 5' 53 nt of the HXB2 genomic RNA (5'-CCCTAGTTAGCCAGAGAGCTCCCAGGCTCAGATCTGGTCTAACCAGAGAGACC-3'). Reactions were assembled by mixing 30 nM RNA and 60 nM DNA complement in reaction buffer, and individual reaction aliquots (including aptamer) were prepared as described above. Reactions were initiated by the addition of 4µl of RT, incubated at 37 °C for 3 min, and quenched and analyzed as described for the above assays.


Figure 1
View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 1.
HIV-1 genome replication, representative enzymatic assays, and RNA aptamers. A, viral genome replication steps are outlined to the left, with numbered enzyme activity assays that simulate different steps during genome replication shown to the right. RNA is shown in red, DNA is shown in blue, and newly synthesized DNA is shown in cyan. Cy3-fluor is shown in green (1). A host cell Formula 2 anneals to the viral RNA primer binding sequence (PBS) to prime minus strand synthesis. DNA polymerization to the 5'-end of the RNA genome template terminates in a strong stop (2). RNase H degradation of the copied 5'-end of the RNA genome by RT frees the strong stop DNA product for minus strand transfer. 3a and 3b, strong stop DNA anneals to the 3'-end of the viral RNA to prime DNA synthesis. RNase H degradation of the RNA genome during minus strand synthesis leaves behind an RNA polypurine tract fragment, which primes plus strand synthesis (4). 5a and 5b, plus strand synthesis is templated by the minus strand DNA copy of the genome. Second strand transfer followed by strand displacement synthesis (6) allows complete extension of both DNA copies. B, five RNA aptamers that bind and inhibit HIV-1 reverse transcriptase. Aptamers are divided into two classes (14) based on structural similarity to the canonical T1.1 aptamer (12, 15). The complete sequence of aptamer T1.1 is shown; for the other aptamers, only the portion of the sequence believed to form a pseudoknot structure and the immediately flanking nucleotides are shown (see "Experimental Procedures" for the complete RNA sequences). Capital letters correspond to nucleotides derived from the random sequence region in the original pool; lowercase letters correspond to nucleotides derived from invariant primer-binding sequences in the original pool.

 
Aptamer Inhibition Time Courses—A 30-min time course for each of the above RT activity assays was performed in the absence or presence (10 or 30 nM) of aptamer T1.1. All assays were prepared using the conditions described above but scaled up to an 80-µl final volume, from which 10-µl aliquots were removed and added to 20 µl of quench solution at the indicated time points. Data collection was performed for each assay as described above. Curves were fit with GraphPad Prism software using Equation 3,

Formula 3(Eq. 3)
where Y is product formation over time (t), which proceeds to a defined maximum (Ymax) with a rate constant (k).

Aptamer/Small Molecule Synergy Assays—The 5'-Cy3-labeled 18-nt DNA primer described above was extended to completion on the 103-nt DNA template in the presence of increasing concentrations of nevirapine (NVP), efavirenz (EFV), azidothymidine triphosphate (AZTTP), or dideoxycytidine triphosphate (ddCTP) using the reaction conditions described above for distributive synthesis. Final RT concentration for these assays was increased from 3 to 10 nM to boost the signal. Inhibition was monitored using increasing concentrations of aptamer T1.1 in combination with the small molecule inhibitor at 100-fold excess (for NVP, AZTTP, or ddCTP) or 10-fold excess (EFV) over aptamer. IC50 values obtained from the combined aptamer/small molecule inhibition assays and from each individual inhibitor were inserted into the Berenbaum (25) equation (Equation 4) to calculate an interaction index (I50) value,

Formula 4(Eq. 4)
where D(1) and D(2) are the IC50 values for the two inhibitors when assayed in combination, and D50(1) and D50(2) are the IC50 values for each inhibitor when assayed individually.


Figure 2
View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 2.
Aptamer inhibition of single nucleotide incorporation by HIV-1 RT. DDDP-dp (A) and RDDP-dp (B) reactions in which primer-template complexes (30 nM/45 nM) were extended by a single nucleotide (ddCTP, 0.02 mM) for 3 min by RT (3 nM) in the presence of 0.3-100 nM RNA aptamers T1.1, 70.5, 70.8, 80.55, or 80.93. RDDP-rp (C) and DDDP-dp (D) reactions performed under otherwise identical conditions in which high concentrations of primer-template complexes (300 nM/450 nM p/t) were extended by a single nucleotide (5 mM dCTP, or 0.02 mM ddCTP, respectively) for 3 min by RT (30 nM) in the presence of 0.3-100 nM of the same five aptamers. Representative gel images (20% denaturing polyacrylamide) from each assay show no aptamer (first lane), increasing aptamer (middle six lanes), and no RT (last lane). Fraction product formation (single nucleotide incorporation) is normalized to the no-aptamer control (1.0) for each experiment.

 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
RNA Aptamer Inhibition of Reverse Transcriptase at Discrete Steps of Viral Genome Replication—RT inhibition was measured in eight assays representative of discrete major functions performed by RT during viral genome replication (Fig. 1A). To ensure that comparisons of IC50 values across the eight assays are meaningful, and to avoid sequence-specific effects that might skew the analysis, all DNA polymerization experiments employed a primer sequence corresponding to the 3' 18 nt of the host cell Formula 4 that primes viral genome replication during viral infection and a template sequence corresponding to the viral genome sequence immediately 5' of the primer binding sequence (Fig. 1A). Likewise, all assays were performed using identical RT, primer-template, and dNTP concentrations (unless noted), and for similar lengths of time such that in each case product formation was confined to the linear phase. To ascertain the generality of the results, five different RNA aptamers (Fig. 1B) were tested individually for RT inhibition in each assay. Two aptamers (70.5 and T1.1) conform to the sequence constraints that define the Family 1 (Tuerk-type) pseudoknots, and the other three (70.8, 80.55, and 80.93) form related but structurally distinct pseudoknots (12, 14, 15).

DNA- and RNA-primed Single Nucleotide Incorporation Assays—Over the course of genome replication, HIV-1 RT catalyzes both RNA-dependent DNA polymerization (RDDP) and DNA-dependent DNA polymerization (DDDP), extending from both RNA primers (-rp) and DNA primers (-dp). Half-maximal inhibition (IC50) of single nucleotide incorporation by RT in DDDP-dp and RDDP-dp reactions occurs at low nanomolar concentrations (5-43 nM) for each of the five aptamers (Fig. 2, A and B, and Table 1), consistent with values obtained from earlier studies performed with this class of RNA pseudoknots (12, 14, 19). Aptamer 80.93 gave roughly 2-fold weaker inhibition (higher IC50) relative to the other four aptamers in this assay and in most of the subsequent assays.


View this table:
[in this window]
[in a new window]
 
TABLE 1
Aptamer inhibition totals

 
As discussed below, RNA-primed reactions are less efficient than DNA-primed reactions. We performed single nucleotide incorporation by RT in RDDP-rp reactions to determine whether DNA polymerization from RNA-primed substrates is more sensitive to inhibition than is extension from DNA-primed substrates (Fig. 2C). Product formation was not detectable under the same assay conditions used for the DNA-primed substrates (3 nM RT, 30 nM primer, 45 nM template, 0.02 mM ddCTP), even in the absence of inhibitor. Therefore, these assays were performed at 10-fold higher RT and primer-template concentrations (30 nM RT, 300 nM primer, 450 nM template) and 250-fold higher nucleotide triphosphate (5 mM dCTP) concentration. Even under these conditions, net product formation in the absence of inhibitor was less efficient than product formation in the DDDP-dp reactions above. Despite these increases in substrate and enzyme concentrations, the observed IC50 values for aptamer inhibition of single nucleotide incorporation in RDDP-rp reactions remained comparable to those observed for inhibition of extension from the two DNA-primed substrates (Fig. 2 and Table 1). To enable direct comparison of IC50 values for the RNA-primed and DNA-primed reactions, single nucleotide incorporation by RT in DDDP-dp reactions was performed at the same high concentrations utilized in the RDDP-rp reaction. Under these conditions, the aptamers were only mildly inhibitory at the highest concentration tested (100 nM) (Fig. 2D). These results illustrate the higher sensitivity of RT to inhibition by aptamers during DNA polymerization from RNA-primed substrates.

RNA-primed DNA Polymerization on a DNA Template— The three polymerase activity assays described above used a 5'-end-labeled primer to monitor RT-catalyzed incorporation of a single nucleotide from each of three possible primer-template substrates (DDDP-dp, RDDP-dp, and RDDP-rp). This assay design proved untenable for RDDP-dp reactions due to RNase H-catalyzed cleavage of the 5'-end-labeled RNA/DNA heteroduplex 2 nt from the 3'-end of the labeled RNA strand. Note that RNase H-mediated primer removal requires binding of the RT in the opposite orientation, with the 3'-end of the DNA template positioned in the polymerase active site as if it were the primer, and the RNA oligonucleotide bound as the template strand. To monitor inhibition of DDDP-rp activity, we altered the assay design to detect Cy3-dCTP incorporation during full extension of the 40-nt DNA template (Fig. 3). IC50 values for inhibition of DDDP-rp activity by the five aptamers ranged from 45 to 146 nM, with aptamers T1.1, 80.55, and 70.5 being the most potent of the five. Overall, the IC50 values obtained for full extension of the 40-nt DNA template from the RNA primer were on average 3- to 7-fold higher than those for either of the DNA-primed single nucleotide incorporation assays (Table 1), likely owing to changes in substrate affinity upon partial extension (see "Discussion").


Figure 3
View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 3.
Aptamer inhibition of HIV-1 RT DNA polymerization in DDDP-rp reactions. Full extension of an unlabeled 18-nt RNA primer (300 nM) annealed to a 40-nt unlabeled DNA template (450 nM) by RT (30 nM) was monitored by incorporation of Cy3-dCTP (0.02 mM, plus 0.1 mM standard dNTPs) in the presence of 0.3-100 nM RNA aptamers T1.1, 70.5, 70.8, 80.55, or 80.93 (reactions were quenched after 8 min). A representative gel image (15% denaturing polyacrylamide) shows no aptamer (left lane), increasing aptamer (middle six lanes), and no RT (right lane). Fraction product formation (full primer extension) is normalized to the no-aptamer control (1.0) for each experiment.

 


Figure 4
View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 4.
Aptamer inhibition of full-length polymerization and strand displacement synthesis. The DNA polymerization activity of 3 nM RT was assayed in the presence of 0.3-100 nM RNA aptamers T1.1, 70.5, 70.8, 80.55, or 80.93 in RDDP-dp reactions (30 nM/180 nM) for 10 min (A), in DDDP-dp reactions (30 nM/45 nM) for 3 min (B), and in DDDP-dp reactions (30 nM/45 nM) with a 70-nt blocking oligonucleotide (BO) (60 nM) annealed to the 5' 70-nt of the template strand for 10 min (C). dNTP concentrations in all assays were 0.02 mM. Representative gel images (15% denaturing polyacrylamide) from each assay show no aptamer (first lane), increasing aptamer (middle six lanes), and no RT (last lane). Vertical black bar (C) indicates location of annealed BO. Fraction product formation (full primer extension) is normalized to the no-aptamer control (1.0) for each experiment.

 
RNA-dependent DNA Polymerization—Inhibition by RNA aptamers of DNA polymerization from an RNA template (106 nt) was monitored by full extension of a DNA primer (Fig. 4A). Aptamers T1.1, 70.5, 70.8, and 80.55 inhibited this activity with IC50 values ranging from 3 to 5 nM (Table 1). Aptamer 80.93 was roughly 3-fold less potent, consistent with it being the least potent of the five aptamers across all activities assayed. Overall, true reverse transcription (RNA-dependent DNA polymerization) was among the activities most potently inhibited by RNA aptamers described in this report (Table 1 and Fig. 6).


Figure 5
View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 5.
Aptamer inhibition of HIV-1 RT RNase H activity. An RNA/DNA substrate (30 nM/60 nM) was incubated with RT (3 nM) for 3 min in the presence of 0.3-100 nM RNA aptamers T1.1, 70.5, 70.8, 80.55, or 80.93. A representative gel image (15% denaturing polyacrylamide) shows no aptamer (first lane), increasing aptamer (middle six lanes), and no RT (last lane). Fraction substrate cleaved is normalized to the no-aptamer control (1.0) for each experiment.

 
DNA-dependent DNA Polymerization and Strand Displacement Synthesis—To complete the synthesis of full-length genomic cDNA, HIV-1 RT must displace ~637 nt of double-stranded DNA as it copies the long terminal repeat (26) (Fig. 1, step 6). Previous biochemical analysis of strand displacement synthesis revealed a roughly 12-fold reduction in polymerization rate and a decrease in RT processivity in the presence of a downstream duplex region several hundred nucleotides in length (27). To determine whether RT is more susceptible to aptamer inhibition during strand displacement synthesis, RT was challenged with aptamers during DDDP-dp reaction polymerization on a 103-nt template in the absence and presence of a 70-nt blocking oligonucleotide (BO, Fig. 4, B and C, respectively). Strand displacement synthesis assays were allowed to proceed for 10 min in the presence of BO, or 3 min in the absence of BO, to generate sufficient full-length product for reliable quantification of aptamer inhibition. In the presence of BO, extensive premature termination is evident immediately after the duplex is encountered, reducing yield to 15-20% of that observed without BO. Only weak pauses are observed after RT has extended through ~20 bp of duplex. In the absence of BO, premature termination is evident in the first several nucleotides synthesized, with an additional pause after a run of adenosines in the template immediately prior to the BO binding site. Product yields from both reactions were inhibited by all five aptamers. Interestingly, the aptamer dose response and the calculated IC50 values for normalized product formation were essentially identical for DNA synthesis in both the presence and absence of BO (Fig. 4C and Table 1). Similar results were obtained using a 103-nt BO complementary to all but the primer binding site (not shown).

Polymerase-independent RNase H Activity—Removal of the RNA strand of the RNA/DNA heteroduplex replication intermediate by HIV-1 RNase H can occur either concurrent with, or uncoupled from DNA polymerization (28, 29). By either route, RNase H substrate binding is functionally synonymous with primer-template binding and should therefore be subject to aptamer competition. Inhibition of polymerase-independent RNase H activity was monitored by incubating RT with a 5'-Cy3-labeled 43-nt RNA strand annealed to a 53-nt DNA in the absence of dNTPs (Fig. 5). The low nM IC50 values obtained for this assay (10-28 nM) are similar to the IC50 values measured for the six previously described DNA polymerase activity assays (Table 1), suggesting that these aptamers compete for RNase H substrate recognition to a degree comparable to that with which they compete with primer-template complexes.

Time Dependence of Aptamer Potency—The IC50 values listed in Table 1 are derived from aptamer inhibition assays with reaction times ranging from 3 to 10 min, because these time spans fall within the linear phase of product formation for each RT activity. Because these reaction times are brief relative to viral replication timescales, it is important to establish how well the inhibition observed in these assays translates into long term potency of these aptamers over sustained time periods. Therefore, the eight RT activity assays described above were performed in the absence of aptamer, or in the presence of aptamer T1.1 at two concentrations near the observed IC50 values (10 or 30 nM) (Fig. 6). To determine the ability of the aptamer to sustain an inhibitory effect, product formation was measured as a function of time and normalized within each assay to the product yield obtained at 30 min in the "no aptamer" control. In the absence of aptamer, the eight assays partitioned into three groups according to rates of product formation (Fig. 6). RNase H activity and single nucleotide incorporation in DDDP-dp reactions were completed most rapidly. DDDP-dp on the 103-nt template, strand displacement, and single nucleotide incorporation in RDDP-dp reactions formed a second group of less rapidly completed activities. DDDP-rp, RDDP-rp, and RDDP-dp on the 106-nt RNA template grouped as the least rapidly completed activities. When 10 nM aptamer was included in the reactions, RDDP-dp on the 106-nt template was potently inhibited, reaching <15% full-length product formation in 30 min. When the aptamer concentration was raised to 30 nM, only RNaseH activity and single nucleotide incorporation in DDDP-dp reactions proceeded beyond 50% completion by the end of the experiment. In contrast, single nucleotide incorporation in RDDP-dp and RDDP-rp reactions and full extension of the long templates (RDDP-dp 106, DDDP-dp 103, and strand displacement synthesis) were severely inhibited (≤25% product formation) by 30 nM aptamer over the entire 30 min. Note that the two RNA-primed DNA polymerization assays were potently inhibited by 30 nM T1.1 despite the fact that these two assays included 10-fold higher RT and primer-template concentrations than those utilized in the other five assays. These results highlight the sensitivity of these RNA-primed steps to aptamer inhibition.


Figure 6
View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 6.
Aptamer potency over time. Product formation by HIV-1 RT was monitored for each of the reactions described above in the absence of aptamer (A), or in the presence of 10 nM (B), or 30 nM aptamer T1.1 (C). All assays were performed under the same conditions used to determine IC50 values (see "Experimental Procedures" for individual assay conditions). RT activity for each assay is normalized relative to product formation at 30 min for the no-aptamer control.

 
Aptamer Synergy with Small Molecule Reverse Transcriptase Inhibitors—Small molecule RT inhibitors administered in combination have been used to demonstrate synergy in both biochemical and cell-based assays (30-34). Because RNA aptamer TRTIs bind to RT at a location that is distinct from the binding sites of either NNRTI or NRTI inhibitors, it is not obvious that there should be any interaction between aptamers and the small molecule RT inhibitors. To address the possibility of such functional interactions directly, DDDP-dp reactions on the 103-nt template were monitored in the presence of aptamer in combination with NNRTI or NRTI inhibitors. IC50 values were determined separately for aptamer T1.1, for two NRTI drugs (AZTTP and ddCTP), and for two NNRTI drugs (EFV and NVP) (Table 2). The IC50 value obtained for EFV (60 nM) was ~20-fold lower than the IC50 values obtained for the other three drugs (1.29-2.24 µM). Inhibition was then measured for serial dilutions of mixtures of these inhibitors at fixed 1:100 aptamer:small molecule ratios (1:10 for EFV). IC50 values obtained from these assays were used to calculate the interaction index for 50% inhibition of enzyme activity (I50), which is equal to 1 when two inhibitors are strictly additive (no interaction), less than 1 when the two inhibitors augment each other's potency (synergy), and greater than 1 when the two inhibitors interfere with each other's mode of action (antagonism). The two combinations of aptamer plus NRTI both demonstrate clear synergy in inhibiting DNA polymerization (IAZTTP = 0.52; IddCTP = 0.51). The combination of aptamer plus EFV is either additive/non-interacting or slightly synergistic (IEFV = 0.91) for inhibition of DNA polymerization by RT. In contrast, the combination of aptamer plus NVP appears to antagonize net inhibition (INVP = 1.57). Thus, contrary to expectation, pseudoknot RNA aptamers and small molecule RT inhibitors clearly affect one another's capacity for enzyme inhibition. Potential mechanistic interpretations and clinical implications of these results are discussed below.


View this table:
[in this window]
[in a new window]
 
TABLE 2
Aptamer/small molecule inhibitor synergy

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Differential Susceptibility of HIV-1 RT to Aptamer Inhibition at Different Stages of Genome Replication—Nucleic acid aptamer inhibitors have therapeutic potential as a TRTI class of anti-viral agents. To develop a better understanding of the mode of viral inhibition by anti-RT RNA aptamers, this work separately evaluates RT enzymatic inhibition in reactions that mimic major activities required for completion of HIV-1 genome replication. Anti-RT aptamers inhibit polymerase and RNase H functions via competitive inhibition with primer-template, as demonstrated by comparative binding studies (13, 14), pre-steady-state kinetic analysis (16), and extensive overlap between the aptamer binding site and the primer-template binding site in a low resolution co-crystal structure of RT in complex with RNA aptamer T1.1 (4). We provide further biochemical evidence for this model both here (Fig. 2, A versus D) and in a separate work3 by demonstrating that the relative concentrations of aptamer and primer-template quantitatively affect RT inhibition. Similar competitive inhibition of DNA polymerization has been demonstrated for RNA aptamers selected to bind RT from feline immunodeficiency virus (35). Aptamer TRTIs can, therefore, be expected to inhibit every step of reverse transcription during viral infection. Furthermore, because primer-template recognition (and therefore polymerase activity) varies according to nucleic acid composition, the potency of aptamer inhibition might also be expected to vary over the course of genome replication. Indeed, the results presented here suggest that every stage of replication is subject to aptamer inhibition, with the RNA-primed events being the most sensitive when considered on a per-nucleotide-incorporation basis. RNA-templated DNA polymerization is the most sensitive to prolonged aptamer inhibition.

Direct comparisons of IC50 values from one assay to another can be misleading unless the details of the individual assays are considered. For example, a cursory examination of Table 1 would suggest that the two RNA-primed events are the least sensitive to aptamer inhibition (highest IC50 values), rather than the most sensitive. However, we were only able to observe reliable single nucleotide product formation during the RDDP-rp assay upon a 10-fold increase in enzyme and primer-template concentrations relative to those used for the DNA-primed DNA polymerization assays (along with a 250-fold increase in dNTP concentration). These conditions should greatly increase the ability of primer-template to compete with the aptamer. When similar high concentrations of RT, primer-template, and dNTP were used to monitor single nucleotide incorporation in DDDP-dp reactions, little inhibition is evident even at 100 nM aptamer (Fig. 2D). Because Kd values for RT binding to both RNA aptamers (12, 14) and the DNA-primer/DNA-template substrate (22, 36-38) are both in the low nanomolar range, the 100 nM aptamer dose is unable to effectively prevent the 30 nM RT from extending most of the 300 nM primer-template in this experiment. In contrast, the fact that the observed IC50 values for both of the RNA-primed reactions (DDDP-rp and RDDP-rp) are in the same range as the other values in Table 1 suggests that aptamer inhibition of DNA polymerization from RNA-primed templates is significantly more potent than polymerization from DNA-primed templates.

Our results can be generally understood in terms of the reduced efficiency of the enzyme on RNA-primed templates. Pre-steady-state kinetic analyses of single nucleotide incorporation clearly reveal less efficient DNA polymerization from RNA-primed substrates than from DNA-primed substrates, irrespective of whether DNA or RNA templates were utilized. Affinity for the primer-template (Kmp/t) is ~200-fold weaker, affinity for dNTP (KmdNTP) is ~500-fold weaker, and the rate of polymerization (kcat) is ~30-fold slower (21, 22). This overall difference in enzyme efficiency persists for roughly the first six dNTP incorporations, by which point the polymerization properties become indistinguishable from those associated with DNA-primed templates. Thus, once an RNA primer is extended by a few nucleotides, its susceptibility to inhibition converts to that of a DNA-primed reaction. The stepwise transformation of a low affinity to a high affinity ternary complex likely accounts for the higher observed IC50 for the DDDP-rp primer extension assay relative to the single-nucleotide incorporation assay used for the RDDP-rp reaction. In the context of viral replication, the quantitative aspects of this interpretation may require slight refinement, depending on the degree to which the natural RNA primers (Formula 4 and PPT (polypurine tract)) used by the virus during infection are similarly displaced by the aptamers.

Sustained Inhibition of RNase H and DNA Polymerization by RNA Aptamers—Our results demonstrate for the first time the direct inhibition of polymerization-independent RNase H activity by pseudoknot RNA aptamers to HIV-1 RT. Other laboratories have described RNase H inhibition by DNA aptamers and thioaptamers selected specifically to bind the RNase H domain of HIV-1 RT (39-41), and RNA aptamer inhibition of the RNase H activity of RTs derived from avian myeloblastosis virus and Moloney murine leukemia virus by aptamers specifically targeted to these RTs (42). Interestingly, although the half-maximal inhibition of RNase H activity in the present study occurred at aptamer concentrations similar to those required to inhibit most of the other RT activities (Table 1), the time scale over which aptamers remain potent against RNase H was very brief (Fig. 6). A possible explanation for this phenomenon derives from the fact that the readout for RNA strand cleavage corresponds to loss of full-length RNA substrate that can result from a single binding/catalytic event. Thus, if aptamer fails to prevent substrate binding, the RNase H cleavage reaction proceeds immediately to completion. This circumstance is in sharp contrast to the four true DNA polymerization assays (DDDP-dp 103, strand displacement, RDDP-dp 106, and DDDP-rp), where product formation readout corresponds to full copying of the template strand, which may require multiple primer-template substrate rebinding events before RT completes a full-length strand extension. In these assays, unlike the RNase H activity assay, any substrate release by RT prior to complete strand extension offers the aptamer a second opportunity to bind and inhibit free RT.

Single nucleotide incorporation in DDDP-dp reactions is similarly resistant to aptamer inhibition over time, again resulting from product formation after a single binding/catalytic event. The RDDP-dp and RDDP-rp single nucleotide incorporation assays show greater susceptibility to sustained aptamer inhibition. The potency of inhibition during the RDDP-rp assay (again performed at 10-fold increased enzyme and primer-template, and 250-fold increased dNTP concentrations relative to the DDDP assays) is enhanced by the diminished affinity of this enzyme for this substrate relative to both aptamer and the DNA-primer/DNA-template substrate. In our hands, DNA polymerization (both single nucleotide incorporation and full copying of the 106-nt template) on the RNA templates was consistently less efficient than on the DNA templates (left lanes in Fig. 2 (A and B), left lanes in Fig. 4, A and B, and Fig. 6). This result is in contrast with previous reports of single nucleotide incorporation in RDDP-dp reactions with binding and polymerization kinetics either similar to (22) or slightly better than (16) those obtained in DDDP-dp reactions. Thus, the sustained inhibition of single nucleotide incorporation in the RDDP-dp reactions was somewhat more potent than anticipated.

Sustained potent inhibition of DNA polymerization by RNA aptamers is of key importance, because the majority of catalytic events performed by the enzyme during viral genome replication are consecutive dNTP incorporations on long templates. HIV-1 RT is a low processivity polymerase, with reports ranging from several tens to several hundreds of nucleotides polymerized per binding event (17, 43-46). The number of opportunities for aptamer binding and inhibition of RT during genome replication increases with the number of times the polymerase dissociates from the primer-template substrate. We therefore propose that the observed potent inhibition of primer extension over time is directly attributable to the semi-distributive nature of DNA polymerization by HIV-1 RT. This notion is consistent with the classification of RNA aptamers as TRTIs, which function in a manner analogous to a trapping nucleic acid (or other anionic polymer such as heparin) used in standard polymerase processivity assays.

Aptamer Synergy with Small Molecule Reverse Transcriptase Inhibitors—The decrease in AIDS-related mortality over the last 20 years, as anti-viral treatment strategies shifted from monotherapy to potent three-drug highly active antiviral therapy (47), reveals the importance of combinatorial approaches to inhibiting viral function. Therapeutic combinations targeting different viral proteins reduce the likelihood of selecting drug-resistant viruses. Combining inhibitors from different classes that target the same viral protein not only offers protection against resistance, it also affords the possibility of enhanced inhibition via synergistic effects (30-34). The two NNRTIs assayed here (NVP and EFV) have different effects on RT in the presence of aptamer T1.1 (Table 2). Aptamer T1.1 and NVP antagonize one another in a DDDP-dp inhibition assay, whereas T1.1 and EFV act additively or with weak synergy. In contrast, aptamer T1.1 and each of the two NRTIs tested (AZTTP and ddCTP) combine to exhibit a high degree of synergy for the inhibition of DNA polymerization by RT.

At least two models can explain our observations. In the first model, the presence of one compound may alter the ability of the other to bind RT. Because aptamer binding prevents the association of RT with primer-template, it seems unlikely that any of these small molecule drugs could directly inhibit the enzymatic activity of a given RT molecule as long as aptamer is bound; instead, small molecule binding may enhance (or in the case of NVP weaken) the affinity of RT for the aptamer. This model is consistent with recent reports of a small molecule RNase H inhibitor that binds near the polymerization active site and that is believed to act by repositioning the RNA-DNA heteroduplex relative to the RNase H active site.4 It is also consistent with reports of NNRTI-resistant RTs, which demonstrate diminished RNase H function (48, 49). In the second model, we propose that the non-extendible primer-template substrates that form upon incorporation of either AZT or ddC effectively increase the net concentration of TRTI inhibitors. Specifically, both the aptamer and NRTI-capped primer-template can bind RT and compete with non-capped primer-template substrates with similar low nanomolar binding affinities. Thus, the low affinity, small molecule inhibitor (chain-terminating NRTI) is transformed into a high affinity inhibitor by the RT. The magnitude of this effect increases during the course of the assay as capped product accumulates. It is not clear whether synergy by this mechanism could operate during viral infection, where the number of NRTI-capped products generated will be limited. Even so, a therapeutic strategy combining anti-RT aptamers with NRTI drugs (and potentially EFV) could augment the antiviral potency of both drug types.

Significance for Antiviral Inhibition by RNA Aptamers—Joshi and Prasad (19) monitored viral DNA synthesis in cells infected with virus in the presence of truncated versions of aptamers 70.8 and 70.15 (the latter aptamer was not evaluated here). Although they detected low levels of viral cDNA corresponding to minus strand strong stop synthesis, they were unable to detect cDNA from later replication steps. We specifically monitored aptamer inhibition of steps leading up to minus strand transfer, in addition to subsequent steps of reverse transcription to test whether early events are measurably more susceptible to aptamer inhibition than later genome replication events. Our results suggest that RNA-primed and RNA-templated DNA polymerization events are inhibited by RNA aptamers with notable potency (Fig. 6). RT becomes susceptible to aptamer TRTIs whenever it is not bound by primer-template, a circumstance that certainly occurs during priming and distributive DNA polymerization. There are at least six de novo priming events during HIV-1 genome replication: initiation of minus strand synthesis, re-initiation following first strand transfer, initiation of plus strand synthesis (from both the polypurine tract (PPT) and the internal central polypurine tract (cPPT)) re-initiation following second strand transfer, and initiation of strand displacement synthesis. Half of these are RNA-primed events. Thus, although RNA-primed DNA polymerization represents <0.1% of the total nucleotide incorporations performed by RT during genome replication, initiation of DNA synthesis from RNA primers may represent biologically substantial opportunities for aptamer inhibition. In addition, periodic dissociation of RT during DNA synthesis provides further opportunities for aptamer TRTIs to sequester free RT and disrupt genome replication. Therefore, despite the variability of aptamer potency summarized in Table 1 and Fig. 6, we propose that aptamer inhibition of RT function during viral infection is compounded over the many different steps required to convert the RNA genome to a double-stranded DNA copy. This cumulative inhibition appears to best explain the dramatic inhibition of viral replication previously observed in aptamer-expressing cultured T lymphocytes. Finally, we observed a high degree of synergy for the inhibition of the DNA polymerization function of RT when an aptamer was used in combination with either ddCTP or AZTTP, suggesting that the combination of TRTIs and NRTIs may provide a new and potent approach for the continuing development of multipronged antiviral therapies.


    FOOTNOTES
 
* This work was supported by National Institutes of Health Grant AI62513 (to D. H. B.) and by a Milton Taylor Graduate Fellowship in virology (to D. M. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Fig. S1 and additional references. Back

1 To whom correspondence should be addressed: 471h Life Sciences Center, 1201 E. Rollins Rd., Columbia, MO 65211. Tel.: 573-884-1316; Fax: 573-884-9676; E-mail: burkedh{at}missouri.edu.

2 The abbreviations used are: RT, reverse transcriptase; HIV-1, human immunodeficiency virus, type 1; NRTI, nucleoside analog RT inhibitor; NNRTI, non-nucleoside analog RT inhibitor; TRTI, primer/template analog RT inhibitor; AZTTP, azidothymidine triphosphate; nt, nucleotide(s); BO, blocking DNA oligonucleotide; NVP, nevirapine; EFV, efavirenz; RDDP, RNA-dependent DNA polymerization; DDDP, DNA-dependent DNA polymerization; -rp, RNA primers; -dp, DNA primers. Back

3 J. D. Kissel, D. M. Held, R. W. Hardy, and D. H. Burke, manuscript in preparation. Back

4 S. G. Sarafianos, personal communication. Back


    ACKNOWLEDGMENTS
 
We are grateful to Dr. Marc Johnson, Dr. Stefan Sarafianos, and Dr. Nirmala Bardiya for careful reading of the manuscript, and to Dr. David Nickens and Sarah Thacker for helpful suggestions and technical support.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Graves, M. C., Meidel, M. C., Pan, Y. C., Manneberg, M., Lahm, H. W., and Gruninger-Leitch, F. (1990) Biochem. Biophys. Res. Commun. 168, 30-36[CrossRef][Medline] [Order article via Infotrieve]
  2. Bathurst, I. C., Moen, L. K., Lujan, M. A., Gibson, H. L., Feucht, P. H., Pichuantes, S., Craik, C. S., Santi, D. V., and Barr, P. J. (1990) Biochem. Biophys. Res. Commun. 171, 589-595[CrossRef][Medline] [Order article via Infotrieve]
  3. Jacobo-Molina, A., Ding, J., Nanni, R. G., Clark, A. D., Jr., Lu, X., Tantillo, C., Williams, R. L., Kamer, G., Ferris, A. L., Clark, P., Hizi, A., Hughes, S. H., and Arnold, E. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6320-6324[Abstract/Free Full Text]
  4. Jaeger, J., Restle, T., and Steitz, T. A. (1998) EMBO J. 17, 4535-4542[CrossRef][Medline] [Order article via Infotrieve]
  5. Esnouf, R., Ren, J., Ross, C., Jones, Y., Stammers, D., and Stuart, D. (1995) Nat. Struct. Biol. 2, 303-308[CrossRef][Medline] [Order article via Infotrieve]
  6. Spence, R. A., Kati, W. M., Anderson, K. S., and Johnson, K. A. (1995) Science 267, 988-993[Abstract/Free Full Text]
  7. Temiz, N. A., and Bahar, I. (2002) Proteins 49, 61-70[CrossRef][Medline] [Order article via Infotrieve]
  8. Hogg, R. S., Yip, B., Kully, C., Craib, K. J., O'Shaughnessy, M. V., Schechter, M. T., and Montaner, J. S. (1999) CMAJ. 160, 659-665[Abstract]
  9. Yazdanpanah, Y., Sissoko, D., Egger, M., Mouton, Y., Zwahlen, M., and Chene, G. (2004) BMJ. 328, 249[Abstract/Free Full Text]
  10. Joshi, P. J., Fisher, T. S., and Prasad, V. R. (2003) Curr. Drug Targets Infect. Disord. 3, 383-400[CrossRef][Medline] [Order article via Infotrieve]
  11. Held, D. M., Kissel, J. D., Patterson, J. T., Nickens, D. G., and Burke, D. H. (2006) Front. Biosci. 11, 89-112[Medline] [Order article via Infotrieve]
  12. Tuerk, C., MacDougal, S., and Gold, L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6988-6992[Abstract/Free Full Text]
  13. Schneider, D. J., Feigon, J., Hostomsky, Z., and Gold, L. (1995) Biochemistry 34, 9599-9610[CrossRef][Medline] [Order article via Infotrieve]
  14. Burke, D. H., Scates, L., Andrews, K., and Gold, L. (1996) J. Mol. Biol. 264, 650-666[CrossRef][Medline] [Order article via Infotrieve]
  15. Green, L., Waugh, S., Binkley, J. P., Hostomska, Z., Hostomsky, Z., and Tuerk, C. (1995) J. Mol. Biol. 247, 60-68[CrossRef][Medline] [Order article via Infotrieve]
  16. Wohrl, B. M., Krebs, R., Goody, R. S., and Restle, T. (1999) J. Mol. Biol. 292, 333-344[CrossRef][Medline] [Order article via Infotrieve]
  17. Fisher, T. S., Joshi, P., and Prasad, V. R. (2002) J. Virol. 76, 4068-4072[Abstract/Free Full Text]
  18. Chaloin, L., Lehmann, M. J., Sczakiel, G., and Restle, T. (2002) Nucleic Acids Res. 30, 4001-4008[Abstract/Free Full Text]
  19. Joshi, P., and Prasad, V. R. (2002) J. Virol. 76, 6545-6557[Abstract/Free Full Text]
  20. Joshi, P. J., North, T. W., and Prasad, V. R. (2005) Mol. Ther. 11, 677-686[CrossRef][Medline] [Order article via Infotrieve]
  21. Lanchy, J. M., Ehresmann, C., Le Grice, S. F., Ehresmann, B., and Marquet, R. (1996) EMBO J. 15, 7178-7187[Medline] [Order article via Infotrieve]
  22. Thrall, S. H., Krebs, R., Wohrl, B. M., Cellai, L., Goody, R. S., and Restle, T. (1998) Biochemistry 37, 13349-13358[CrossRef][Medline] [Order article via Infotrieve]
  23. Page, K. A., Landau, N. R., and Littman, D. R. (1990) J. Virol. 64, 5270-5276[Abstract/Free Full Text]
  24. Gill, S. C., and von Hippel, P. H. (1989) Anal. Biochem. 182, 319-326[CrossRef][Medline] [Order article via Infotrieve]
  25. Berenbaum, M. C. (1977) Clin. Exp. Immunol. 28, 1-18[Medline] [Order article via Infotrieve]
  26. Ratner, L., Haseltine, W., Patarca, R., Livak, K. J., Starcich, B., Josephs, S. F., Doran, E. R., Rafalski, J. A., Whitehorn, E. A., Baumeister, K., Ivanoff, L., Petteway, S. R., Jr., Pearson, M. L., Lautenberger, J. A., Papas, T. S., Ghrayeb, J., Chang, N. T., Gallo, R. C., and Wong-Staal, F. (1985) Nature 313, 277-284[CrossRef][Medline] [Order article via Infotrieve]
  27. Fuentes, G. M., Rodriguez-Rodriguez, L., Palaniappan, C., Fay, P. J., and Bambara, R. A. (1996) J. Biol. Chem. 271, 1966-1971[Abstract/Free Full Text]
  28. DeStefano, J. J., Buiser, R. G., Mallaber, L. M., Myers, T. W., Bambara, R. A., and Fay, P. J. (1991) J. Biol. Chem. 266, 7423-7431[Abstract/Free Full Text]
  29. DeStefano, J. J., Mallaber, L. M., Fay, P. J., and Bambara, R. A. (1994) Nucleic Acids Res. 22, 3793-3800[Abstract/Free Full Text]
  30. Basavapathruni, A., Bailey, C. M., and Anderson, K. S. (2004) J. Biol. Chem. 279, 6221-6224[Abstract/Free Full Text]
  31. Chong, K. T., Pagano, P. J., and Hinshaw, R. R. (1994) Antimicrob. Agents Chemother. 38, 288-293[Abstract/Free Full Text]
  32. Witvrouw, M., Arranz, M. E., Pannecouque, C., Declercq, R., Jonckheere, H., Schmit, J. C., Vandamme, A. M., Diaz, J. A., Ingate, S. T., Desmyter, J., Esnouf, R., Van Meervelt, L., Vega, S., Balzarini, J., and De Clercq, E. (1998) Antimicrob. Agents Chemother. 42, 618-623[Abstract/Free Full Text]
  33. Maga, G., Ramunno, A., Nacci, V., Locatelli, G. A., Spadari, S., Fiorini, I., Baldanti, F., Paolucci, S., Zavattoni, M., Bergamini, A., Galletti, B., Muck, S., Hubscher, U., Giorgi, G., Guiso, G., Caccia, S., and Campiani, G. (2001) J. Biol. Chem. 276, 44653-44662[Abstract/Free Full Text]
  34. Cruchaga, C., Odriozola, L., Andreola, M., Tarrago-Litvak, L., and Martinez-Irujo, J. J. (2005) Biochemistry 44, 3535-3546[CrossRef][Medline] [Order article via Infotrieve]
  35. Chen, H., McBroom, D. G., Zhu, Y. Q., Gold, L., and North, T. W. (1996) Biochemistry 35, 6923-6930[CrossRef][Medline] [Order article via Infotrieve]
  36. Kati, W. M., Johnson, K. A., Jerva, L. F., and Anderson, K. S. (1992) J. Biol. Chem. 267, 25988-25997[Abstract/Free Full Text]
  37. Reardon, J. E. (1992) Biochemistry 31, 4473-4479[CrossRef][Medline] [Order article via Infotrieve]
  38. Divita, G., Muller, B., Immendorfer, U., Gautel, M., Rittinger, K., Restle, T., and Goody, R. S. (1993) Biochemistry 32, 7966-7971[CrossRef][Medline] [Order article via Infotrieve]
  39. Andreola, M. L., Pileur, F., Calmels, C., Ventura, M., Tarrago-Litvak, L., Toulme, J. J., and Litvak, S. (2001) Biochemistry 40, 10087-10094[CrossRef][Medline] [Order article via Infotrieve]
  40. Hannoush, R. N., Carriero, S., Min, K. L., and Damha, M. J. (2004) Chembiochemistry 5, 527-533
  41. Somasunderam, A., Ferguson, M. R., Rojo, D. R., Thiviyanathan, V., Li, X., O'Brien, W. A., and Gorenstein, D. G. (2005) Biochemistry 44, 10388-10395[CrossRef][Medline] [Order article via Infotrieve]
  42. Chen, H., and Gold, L. (1994) Biochemistry 33, 8746-8756[CrossRef][Medline] [Order article via Infotrieve]
  43. Huber, H. E., McCoy, J. M., Seehra, J. S., and Richardson, C. C. (1989) J. Biol. Chem. 264, 4669-4678[Abstract/Free Full Text]
  44. Klarmann, G. J., Schauber, C. A., and Preston, B. D. (1993) J. Biol. Chem. 268, 9793-9802[Abstract/Free Full Text]
  45. Bavand, M. R., Wagner, R., and Richmond, T. J. (1993) Biochemistry 32, 10543-10552[CrossRef][Medline] [Order article via Infotrieve]
  46. Avidan, O., and Hizi, A. (1998) Nucleic Acids Res. 26, 1713-1717[Abstract/Free Full Text]
  47. Schneider, M. F., Gange, S. J., Williams, C. M., Anastos, K., Greenblatt, R. M., Kingsley, L., Detels, R., and Munoz, A. (2005) Aids 19, 2009-2018[Medline] [Order article via Infotrieve]
  48. Archer, R. H., Dykes, C., Gerondelis, P., Lloyd, A., Fay, P., Reichman, R. C., Bambara, R. A., and Demeter, L. M. (2000) J. Virol. 74, 8390-8401[Abstract/Free Full Text]
  49. Gerondelis, P., Archer, R. H., Palaniappan, C., Reichman, R. C., Fay, P. J., Bambara, R. A., and Demeter, L. M. (1999) J. Virol. 73, 5803-5813[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
RNAHome page
S. Cao and S.-J. Chen
Predicting structures and stabilities for H-type pseudoknots with interhelix loops
RNA, April 1, 2009; 15(4): 696 - 706.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. Li, Y. Wang, A. Pothukuchy, A. Syrett, N. Husain, S. Gopalakrisha, P. Kosaraju, and A. D. Ellington
Aptamers that recognize drug-resistant HIV-1 reverse transcriptase
Nucleic Acids Res., December 1, 2008; 36(21): 6739 - 6751.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. Michalowski, R. Chitima-Matsiga, D. M. Held, and D. H. Burke
Novel bimodular DNA aptamers with guanosine quadruplexes inhibit phylogenetically diverse HIV-1 reverse transcriptases
Nucleic Acids Res., December 1, 2008; 36(22): 7124 - 7135.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. D. Kissel, D. M. Held, R. W. Hardy, and D. H. Burke
Active site binding and sequence requirements for inhibition of HIV-1 reverse transcriptase by the RT1 family of single-stranded DNA aptamers
Nucleic Acids Res., August 1, 2007; 35(15): 5039 - 5050.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. M. Held, J. D. Kissel, S. J. Thacker, D. Michalowski, D. Saran, J. Ji, R. W. Hardy, J. J. Rossi, and D. H. Burke
Cross-Clade Inhibition of Recombinant Human Immunodeficiency Virus Type 1 (HIV-1), HIV-2, and Simian Immunodeficiency Virus SIVcpz Reverse Transcriptases by RNA Pseudoknot Aptamers
J. Virol., May 15, 2007; 81(10): 5375 - 5384.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
W. James
Aptamers in the virologists' toolkit
J. Gen. Virol., February 1, 2007; 88(2): 351 - 364.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
281/35/25712    most recent
M604460200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Held, D. M.
Right arrow Articles by Burke, D. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Held, D. M.
Right arrow Articles by Burke, D. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement