Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M605045200 on July 26, 2006

J. Biol. Chem., Vol. 281, Issue 39, 28508-28517, September 29, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/39/28508    most recent
M605045200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goda, E.
Right arrow Articles by Nishihara, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goda, E.
Right arrow Articles by Nishihara, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Identification and Characterization of a Novel Drosophila 3'-Phosphoadenosine 5'-Phosphosulfate Transporter*

Emi Goda{ddagger}§1, Shin Kamiyama{ddagger}1, Takaaki Uno{ddagger}, Hideki Yoshida{ddagger}§, Morio Ueyama{ddagger}§, Akiko Kinoshita-Toyoda§, Hidenao Toyoda§, Ryu Ueda§||, and Shoko Nishihara{ddagger}§2

From the {ddagger}Laboratory of Cell Biology, Department of Bioinformatics, Soka University, 1-236 Tangi-cho, Hachioji, Tokyo 192-8577, §Core Research for Evolutional Science and Technology of Japan Science and Technology Agency, Kawaguchi Center Building, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012, Department of Analytical Chemistry, Faculty of Pharmaceutical Sciences, Chiba University, 1-33 Yayoi-cho, Inage, Chiba 263-8522, and ||Invertebrate Genetics Laboratory, National Institute of Genetics, 1111 Yata, Mishima, Shizuoka 441-8540, Japan

Received for publication, May 25, 2006 , and in revised form, July 25, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Sulfation of macromolecules requires the translocation of a high energy form of nucleotide sulfate, i.e. 3'-phosphoadenosine 5'-phosphosulfate (PAPS), from the cytosol into the Golgi apparatus. In this study, we identified a novel Drosophila PAPS transporter gene dPAPST2 by conducting data base searches and screening the PAPS transport activity among the putative nucleotide sugar transporter genes in Drosophila. The amino acid sequence of dPAPST2 showed 50.5 and 21.5% homology to the human PAPST2 and SLALOM, respectively. The heterologous expression of dPAPST2 in yeast revealed that the dPAPST2 protein is a PAPS transporter with an apparent Km value of 2.3 µM. The RNA interference of dPAPST2 in cell line and flies showed that the dPAPST2 gene is essential for the sulfation of cellular proteins and the viability of the fly. In RNA interference flies, an analysis of the genetic interaction between dPAPST2 and genes that contribute to glycosaminoglycan synthesis suggested that dPAPST2 is involved in the glycosaminoglycan synthesis and the subsequent signaling. The dPAPST2 and sll genes showed a similar ubiquitous distribution. These results indicate that dPAPST2 may be involved in Hedgehog and Decapentaplegic signaling by controlling the sulfation of heparan sulfate.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Sulfation of proteins, proteoglycans, and lipids is involved in a variety of biological phenomena. It requires certain processes that provide a donor substrate for sulfotransferases. First, the free sulfate incorporated into the cell must be converted into a high energy form of nucleotide sulfate, namely 3'-phosphoadenosine 5'-phosphosulfate (PAPS),3 by PAPS synthases. Next, the PAPS must be translocated from the cytosol into the Golgi apparatus by PAPS transporters. These components that are involved in the PAPS providing pathways also play a crucial role in controlling the sulfation process; however, the sulfotransferases have long been believed to be the rate-limiting components (1).

A recent analysis of Drosophila mutants with defects in the sulfation pathway revealed the significance of heparan sulfate (HS) sulfation on growth factor signaling during development (for reviews see Refs. 1–3). A mutation in a gene encoding Drosophila N-deacetylase/N-sulfotransferase (sulfateless, sfl) causes defects in Wingless (4) and fibroblast growth factor signaling (5). Recently, we identified the PAPS transporter genes, human PAPST1 and the Drosophila ortholog slalom (sll) (6). Lüders et al. (7) demonstrated that sll is involved in growth factor signaling pathways during patterning and morphogenesis similar to sfl. The cell surface HS is involved in a variety of developmental signaling pathways, and the functions of HS are known to depend on its sulfation state (8, 9). A mutation in the sll gene resulted in defects in multiple signaling pathways, including those of Wingless and Hedgehog signaling (7). The sll gene is also required for the determination of the embryonic dorsal/ventral axis, possibly for the activation of the signaling cascade that is initiated by the product of the putative sulfotransferase gene pipe (7, 10).

In the Drosophila embryonic salivary glands, both sll and the PAPS synthase gene (papss) are required for the production of sulfated macromolecules (7, 11, 12). The Drosophila genome contains a single PAPS synthase gene, whereas two isoforms of this gene have been identified in mammals (13, 14). On the other hand, the Drosophila PAPS transporter gene sll belongs to a large family of nucleotide sugar transporters, which includes a number of putative genes. This study aimed at identifying a novel Drosophila gene involved in the sulfation pathway. We detected a gene, dPAPST2, by conducting data base searches and screening the transport activity among the putative nucleotide sugar transporter genes in Drosophila. The heterologous expression of this gene in yeast revealed that the dPAPST2 protein is a novel PAPS transporter. The dPAPST2 gene interacted genetically with the following genes that are involved in the synthesis of HS: the Drosophila genes encoding beta1,4-galactosyltransferase 7 (dbeta4GalT7), heparan sulfate 6-O-sulfotransferase (dHS6ST), heparan sulfate 3-O-sulfotransferase B (dHs3st-B), and peptide O-xylosyltransferase (dOXT) (15–19). In this study, we demonstrated the possibility that dPAPST2 plays a role in the sulfation of HS.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—GDP-[2-3H]mannose (15 Ci/mmol), UDP-[1-3H]glucose (15 Ci/mmol), UDP-N-acetyl-[6-3H]D-galactosamine (15 Ci/mmol), UDP-[14C(U)]D-glucuronic acid (15 Ci/mmol), and carrier-free [35S]Na2SO4 (10 m Ci/ml) were purchased from American Radiolabeled Chemicals Inc. (St. Louis, MO). GDP-[1-3H]fucose (6.95 Ci/mmol), UDP-[4,5-3H]galactose (48.3 Ci/mmol), CMP-[9-3H]sialic acid (33.6 Ci/mmol), UDP-N-acetyl-[6-3H]D-glucosamine (39.7 Ci/mmol), and [35S]-PAPS (1.82 Ci/mmol) were purchased from PerkinElmer Life Sciences. Zymolyase 100T was obtained from Seikagaku Kogyo Co. Ltd. (Tokyo, Japan). All other reagents were of the highest purity commercially available.

Isolation of a Novel Drosophila PAPS Transporter cDNA—A Drosophila putative nucleotide sugar transporter gene was identified and cloned using the same procedures as those described previously (6). We performed a TBLASTN search for the amino acid sequence of the sll open reading frame and identified a Drosophila gene (GenBankTM accession number, AY069640 [GenBank] ). In order to prepare attB-flanked PCR product, the recombination sites for the GATEWAYTM cloning system (Invitrogen) were created by performing two steps of attB adaptor PCR. The first gene-specific PCR used the expression sequence tag clone LD40702 as a template for dPAPST2 amplification and the dPAPST2 primer set (forward primer, 5'-AAAAAGCAGGCTTCAGCAGAATGACCGATAATAAG-3'; reverse primer, 5'-AGAAAGCTGGGTCAACTTCGATGAGGAATTTGC-3'). The second PCR was performed by using the products of the first PCR as the template (forward primer, 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3'; reverse primer, 5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3'). The PCR amplifications were performed using Platinum® Pfx DNA polymerase (Invitrogen). To create an entry clone for the subsequent subcloning, the attB-flanked PCR product was cloned into the pDONRTM201 vector according to the manufacturer's protocol.

The entry clone was subcloned into appropriate vectors by using the GATEWAYTM cloning system according to the manufacturer's protocol. Three copies of the HA epitope tag were inserted into the expression vectors at the position corresponding to the carboxyl terminus of the expressed protein.

Subcellular Fractionation of Yeast and Transport Assay—The yeast Saccharomyces cerevisiae strain W303-1a (MATa, ade2-1, ura3-1, his3-11, 15, trp1-1, leu2-3, 112, and can1-100) was transformed by using the lithium acetate procedure (20). For the selection of transformants, the transformed yeast cells were grown at 30 °C in a synthetic defined uracil-deficient medium. Subcellular fractionation and nucleotide sugar transport assays were performed as described previously (6, 21). Two hundred micrograms of the protein from each Golgi-enriched P100 membrane fraction obtained was incubated at 30 °C for 5 min in 100 µl of reaction buffer (20 mM Tris-HCl, pH 7.5, 0.25 M sucrose, 5.0 mM MgCl2, 1.0 mM MnCl2, and 10 mM 2-mercaptoethanol) containing 1 µM radiolabeled substrate. After incubation, the radioactive substrate incorporated into the microsomes was trapped using a 0.45-µm nitrocellulose filter, and the radioactivity was measured by liquid scintillation. For each sample, the activity was calculated as the difference between the observed value and the background value obtained from the same assay at 30 °C for 0 min.

Western Blot Analysis—Fifty micrograms of the protein from each sample was added to 3x SDS sample buffer (New England Biolabs Inc., Beverly, MA) and then incubated at room temperature for 2 h. The samples were fractionated on a 2–15% gradient SDS-polyacrylamide gel (Daiichi Pure Chemicals Co., Ltd., Tokyo, Japan). The separated proteins were electrotransferred onto a polyvinylidene difluoride membrane. The HA-tagged proteins were immunostained with mouse anti-HA mAb and horseradish peroxidase-conjugated anti-mouse IgG mAb. The bound horseradish peroxidase was detected using ECLplus (Amersham Biosciences) according to the manufacturer's protocol.

RNA Interference Flies—RNA interference (RNAi) fly lines were obtained as reported previously (6, 18, 22). The cDNA sequences of dPAPST2 (nucleotide position 446–946 of the coding sequence), dHs3st-B (nucleotide position 568–1067 of the coding sequence), sll (nucleotide position 78–577 of the coding sequence), dbeta4GalT7 (nucleotide position 14–495 of the coding sequence), dHS6ST (nucleotide position 1–499 of the coding sequence), dOXT (nucleotide position 1052–1551 of the coding sequence of NM_139448 [GenBank] ), and papss (nucleotide position 139–638 of the coding sequence of NM_168824 [GenBank] ) were amplified by PCR using a cDNA library derived from Drosophila melanogaster or each expression sequence tag clone.

Each PCR fragment was inserted as an inverted repeat (IR) sequence into the pSC1 vector. The IR-containing fragments were then subcloned into the transformation vector pUAST, and these vectors were introduced into Drosophila embryos of the w1118 mutant stock that were used as hosts to construct UAS-IR fly lines according to the procedure reported by Spradling (23). Each line was mated with the appropriate driver fly lines, and the F1 progeny was raised at 28 °C to observe the phenotypes.

Quantitative Analysis of the dPAPST2 Transcript by Real Time PCR—RNA was extracted from the third instar larvae of each fly line by using the Trizol reagent (Invitrogen). Firststrand cDNA was synthesized using a Superscript II first-strand synthesis kit (Invitrogen). Real time PCR was performed using qPCR Mastermix QuickGoldStar (Eurogentec, Seraing, Belgium) and the ABI PRISM 7700 sequence detection system (Applied Biosystems, Foster, CA). The gene-specific primer pairs and TaqMan probes that were used for each gene are as follows. For the quantitation of dPAPST2, 5'-CTCGCAGCGGAAGTCCTC-3' forward primer, 5'-AGGTCAAAGCAAAGGATACGGA-3' reverse primer, and the 5'-ACGTCGGAATCTCCGCCGGAA-3' probe were used. For the quantitation of sll, 5'-GGCCCAGTTGTGTTTACGATAAT-3' forward primer, 5'-GGTAGATGAAGCAGGAGAGCATAAT-3' reverse primer, and the 5'-CCACCGCCTGACGCAGTGTCAT-3' probe were used. For the quantitation of ribosomal protein L32 (RpL32), 5'-GCAAGCCCAAGGGTATCGA-3' forward primer, 5'-CGATGTTGGGCATCAGATACTG-3' reverse primer, and the 5'-AACAGAGTGCGTCGCCGCTTCA-3' probe were used. The probes were labeled with a reporter dye FAM and a quencher dye TAMRA at the 5'-ends and at the 3'-ends, respectively. Relative amounts of the dPAPST2 and sll transcripts were normalized to those of the RpL32 transcripts in the same cDNA.


Figure 1
View larger version (48K):
[in this window]
[in a new window]
  		FIGURE 1.
Amino acid sequence analysis of dPAPST2. A, phylogenetic tree of dPAPST2 and other transporters. The phylogenetic tree was constructed based on the amino acid sequences by using the ClustalX program. The Drosophila putative genes are identified from the Flybase symbol name. The branch length indicates the evolutionary distance between the members. The scale at the bottom represents the evolutionary distance. h, human; d, Drosophila; and Tp, transporter. B, alignment of amino acid sequences of PAPST1, SLL, PAPST2, and dPAPST2. The amino acid sequence analysis was performed using the ClustalX program. The introduced gaps are shown by hyphens. The asterisks indicate identical amino acids among all the proteins. The colons indicate fully conserved amino acids defined by a score of >0.5. The dots indicate fully conserved amino acids defined by a score of ≤0.5. The boldface letters indicate possible N-glycosylation sites in the sequences. The underlined amino acids are putative transmembrane regions obtained using the SOSui program developed by Mitsui Knowledge Industry Co., Ltd. (Tokyo, Japan).

 
RNAi of Cell Lines—Double-stranded RNA (dsRNA) for each gene was synthesized by T7 transcription. The following sequences were selected as the template DNA for transcription: dPAPST2, nucleotide position 446–946 of the coding sequence; sll, nucleotide position 78–577 of the coding sequence; and enhanced green fluorescent protein (EGFP), nucleotide position 1–500 of the coding sequence. The primers for the amplification of the transcription template DNA contained a T7 promoter sequence (GAATTAATACGACTCACTATAGGGAGA) that was followed by a 20-nucleotide long gene-specific sequence. The transcription template DNA was amplified by PCR, and dsRNA was synthesized using a MEGASCRIPT T7 transcription kit (Ambion, Austin, TX) according to the manufacturer's protocol.

Twenty four hours prior to the transfection, Schneider 2 (S2) cells were subcultured in 10-cm dishes at a concentration of 1 x 107 cells/dish in Schneider's medium containing 10% fetal bovine serum. The cells were transfected with 10 µg/ml of each dsRNA by using the Cellfectin reagent (Invitrogen). RNA was extracted using the Trizol reagent (Invitrogen), and first-strand cDNA was synthesized using a Superscript II first-strand synthesis kit (Invitrogen).

Metabolic Labeling—Forty eight hours after transfection and 48 h prior to analysis, the cells were subcultured in 10-cm dishes at a concentration of 1 x 107 cells/dish in inorganic sulfate-free Schneider's medium containing 10% fetal bovine serum and 100 µCi/ml carrier-free [35S]Na2SO4. The cells were rinsed twice with phosphate-buffered saline, suspended in 4 volumes of lysis buffer (10 mM Tris-HCl, pH 7.4, 0.5% Nonidet P-40, 1 mM EDTA, and 0.5 mM phenylmethylsulfonyl fluoride), and incubated on ice for 1 h. The solution was centrifuged at 15,000 x g for 30 min, and the supernatants were used as cell lysates. Fifty micrograms of the protein in each sample was precipitated with 10% trichloroacetic acid and washed with 5% trichloroacetic acid, followed by cold acetone. The precipitate was dried and dissolved in 0.5 N NaOH for scintillation counting.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Identification of dPAPST2—In order to identify a novel PAPS transporter gene, we performed a BLAST search of Drosophila data bases by using the sll gene sequence as the query sequence. We selected four Drosophila candidate genes (CG7853, CG5802, CG14511, and CG3774) that showed high homology to sll (Fig. 1A), and we cloned the open reading frame of each cDNA. On screening the PAPS transport activity, a cDNA sequence (GenBankTM accession number, AY069640 [GenBank] ), possessing the symbol name CG7853 in Flybase, was identified as a second member of the PAPS transporter gene family (details described below). Because the sll gene is an ortholog of the human PAPST1 gene (6), we named the identified gene dPAPST2. We cloned the full-length open reading frame from the expression sequence tag clone LD40702, as described under "Experimental Procedures." The dPAPST2 gene contains an open reading frame of 1188 bp encoding a protein of 396 amino acids. Very recently, we found that the putative transporter gene SLC35B3 encodes a PAPS transporter in humans, and we named it PAPST2 (24). The phylogenetic tree of Drosophila and human transporter genes (Fig. 1A) indicated that dPAPST2 is an ortholog of the human PAPST2. The alignment of the amino acid sequences of dPAPST2, SLL, human PAPST1, and human PAPST2 is shown in Fig. 1B. dPAPST2 showed 21.5 and 50.5% homology to SLL and PAPST2, respectively. A hydrophobicity analysis of the amino acid sequences predicted that dPAPST2 is a type III transmembrane protein with nine transmembrane domains (Fig. 1B).

dPAPST2 Is a Novel Drosophila PAPS Transporter Gene— The substrate specificity of the dPAPST2 protein was determined in a manner similar to that of SLL, as reported previously (6). HA-tagged dPAPST2 was inserted into the YEp352GAP-II yeast expression vector and expressed in S. cerevisiae. The HA-tagged dPAPST2 protein was detected in the yeast Golgi-enriched P100 membrane fraction (Fig. 2A).

The P100 membrane fraction was used to measure the transport activity of the dPAPST2 protein for nucleotide sugars and PAPS. As shown in Fig. 2B, the dPAPST2 protein exhibited PAPS transport activity (1.7 ± 0.2 versus 3.1 ± 0.3 pmol/mg protein, respectively, mean ± S.E. from six independent experiments; p < 0.05, Student's t test). On the other hand, no significant difference was observed for other nucleotide sugars. These results suggest that the dPAPST2 protein is a PAPS-specific transporter similar to SLL. The saturated PAPS transport activity of dPAPST2 had an apparent Km value that was estimated to be 2.3 µM (Fig. 2C).

Spatiotemporal Expression Profiles of dPAPST2 and sll in the Fly—The developmental expression profiles and tissue distributions of dPAPST2 and sll mRNAs were investigated by a quantitative analysis using real time PCR (Fig. 3, A and B). As shown in Fig. 3A, during development, the expressions of dPAPST2 and sll were altered in a similar manner. Both genes showed higher expression levels in the early embryonic stage than in the other stages. The tissue distributions of the dPAPST2 and sll mRNAs in third instar larvae and adult flies are shown in Fig. 3B. The dPAPST2 and sll genes showed a similar ubiquitous distribution. The expression of sll mRNA was several folds that of dPAPST2 mRNA in all the tested organs (note the different scales in the panels in Fig. 3).


Figure 2
View larger version (38K):
[in this window]
[in a new window]
  		FIGURE 2.
Transport activity of dPAPST2 with different nucleotide sugar substrates and PAPS by yeast expression. A, Western blot analysis of HA-tagged dPAPST2 by using an anti-HA mAb. Each P100 membrane fraction (50 µg) prepared from yeast cells expressing the mock vector (lanes 1 and 2) and HA-tagged dPAPST2 (lanes 3 and 4) was applied to a 5–20% gradient gel. The arrow indicates HA-tagged dPAPST2. B, substrate specificity of the dPAPST2 protein. Each P100 membrane fraction (200 µg) was incubated at 30 °C for 5 min in 100 µl of reaction buffer containing 1 µM substrate, and the incorporated radioactivity was measured. Values shown are the mean ± S.E. obtained from six independent experiments. Mock, open bars; PAPST2, solid bars. C, substrate concentration dependence. Each P100 membrane fraction (200 µg) was incubated at 30 °C for 5 min in 100 µl of reaction buffer containing different concentrations of [35S]PAPS, and the incorporated radioactivity was measured. The specific incorporation was calculated by subtracting the value obtained in the mock transfection from each of the corresponding values. The right panel shows the double-reciprocal plots used to determine the Km value.

 


Figure 3
View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 3.
Spatiotemporal expression profile of dPAPST2. A, the levels of the dPAPST2 and sll transcripts in each developmental stage were determined using real time PCR. The amount of each transcript was normalized to that of the RpL32 transcript, which was measured in the same cDNA. Upper panel, dPAPST2; lower panel, sll. (m), male; (f), female. B, distributions of the dPAPST2 and sll transcripts in tissues of the third instar larvae and genital organs of the adult fly. Upper panel, dPAPST2; lower panel, sll. CNS, central nervous system.

 
dPAPST2 Is Involved in the Sulfation of Cellular Proteins—To confirm whether dPAPST2 serves as a PAPS transporter in Drosophila cells, we reduced dPAPST2 expression in the Drosophila cell line S2 by using RNAi. The S2 cells were transfected with a 500-nucleotide-long dsRNA that targets the dPAPST2 or sll gene. For the negative control, we used a dsRNA that targets the EGFP gene.

The cells that were treated with each dsRNA were analyzed 96 h after transfection. As shown in Fig. 4A, the treatment with dPAPST2 and sll dsRNAs reduced the level of the corresponding transcript by 77 and 57%, respectively. No alteration was observed in the level of the nontarget gene transcript (Fig. 4A). Both transcripts of dPAPST2 and sll decreased in the double-knockdown cells.

The PAPS transport activity in the Golgi-enriched fraction that was prepared from each knockdown cell cultures is shown in Fig. 4B. By treatment with the dPAPST2 and sll dsRNAs, the activity in the Golgi-enriched fraction decreased to 69 and 44% that of the control, respectively. The total sulfate incorporation into the cellular proteins was determined by metabolic labeling with [35S]sulfate. As shown in Fig. 4C, the radioactivity incorporated into the cellular proteins decreased in the cells treated with dPAPST2 dsRNA (79% that of the control). The double-knockdown cells showed the lowest incorporation value. These results suggest that the dPAPST2 protein acts as a PAPS transporter in Drosophila cells and thus is involved in the sulfation of cellular proteins.

dPAPST2 Is an Essential Gene for the Viability of the Fly—In a previous report, we demonstrated that the function of the sll gene is essential for the viability of Drosophila (6). To determine the necessity of the dPAPST2 gene, we analyzed the inducible RNAi knockdown of this gene in the fly by using the GAL4-UAS system (6, 18). We constructed two UAS-dPAPST2-IR fly lines, namely UAS-dPAPST2-IR[1] and UAS-dPAPST2-IR[2]; the lines contained a UAS-controlled dPAPST2 IR transgene in chromosomes III and II, respectively. These lines were crossed with a GAL4 driver fly line, namely Act5C-GAL4, to express the yeast transcription factor GAL4 under the control of the cytoplasmic actin promoter. The F1 fly lines Act5C-GAL4/+;UAS-dPAPST2-IR[1]/+ and Act5C-GAL4/UAS-dPAPST2-IR[2], respectively, are expected to induce dPAPST2 gene silencing in all cells at all developmental stages of the fly.


Figure 4
View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 4.
The dPAPST2 protein acts as a PAPS transporter in Drosophila S2 cells. Drosophila S2 cells were transfected with the dsRNA of EGFP, dPAPST2, or sll at a total concentration of 10 µg/ml. A, expression levels of the sll and dPAPST2 transcripts in the knockdown cells. The relative amounts of each transcript were normalized to those of the RpL32 transcript, which was measured in the same cDNA. The indicated values are the means ± S.E. obtained from three independent experiments. sll, left panel; dPAPST2, right panel. B, PAPS transport activity of Golgi-enriched fraction prepared from knockdown cells. Each Golgi-enriched fraction (50 µg of protein) was incubated at 30 °C for 5 min in 100 µl of the reaction buffer containing 1 µM [35S]PAPS, and the incorporated radioactivity was measured. Values shown are the mean ± S.E. obtained from three independent experiments. C, metabolic labeling of the knockdown cells. Forty eight hours after transfection, cells were metabolically labeled with [35S]sulfate and cultured for 48 h. The protein (50 µg) in the cell lysate was precipitated with 10% trichloroacetic acid, and the radioactivity was measured. Values shown are the mean ± S.E. obtained from three independent experiments.

 
As shown in Table 1, both the Act5C-GAL4/+;UAS-dPAPST2-IR[1]/+ and Act5C-GAL4/UAS-dPAPST2-IR[2] lines exhibited semi-lethality. The efficiency of gene silencing in the third instar larvae was determined by real time PCR. The level of the dPAPST2 transcript in the Act5C-GAL4/+;UAS-dPAPST2-IR[1]/+ and Act5C-GAL4/UAS-dPAPST2-IR[2] lines was only 16.6 and 19.5% that in the wild-type fly, respectively (Fig. 5A). On the other hand, the level of the sll transcript in each line was not affected (91.8 and 118.8%, respectively), thereby indicating the specific silencing of dPAPST2 gene expression (Fig. 5B). These results demonstrated that dPAPST2 is a PAPS transporter gene essential for the viability of the fly, and it is not an accessory factor for the functioning of the sll gene.


View this table:
[in this window]
[in a new window]
  		TABLE 1
Viability of dPAPST2 RNAi flies

 


Figure 5
View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 5.
Quantitative analysis of dPAPST2 and sll mRNAs in dPAPST2 RNAi mutant flies by real time PCR. The levels of the dPAPST2 (A) and sll (B) transcripts in Act5C-GAL4/+;UAS-dPAPST2-IR[1]/+ and Act5C-GAL4/UAS-dPAPST2-IR [2] RNAi fly lines were measured in the third instar larvae by using real time PCR. The relative amount of each transcript was divided by that in the wild type, namely the F1 progeny of w1118 crossed with the Act5C-GAL4 driver fly. Values shown are the mean ± S.E. obtained from three independent experiments.

 
dPAPST2 Genetically Interacts with the Drosophila dbeta4GalT7 Gene in the Wing—We further investigated the biological functions of dPAPST2 in the fly. First, we crossed the UAS-dPAPST2-IR fly lines with seven GAL4-driver lines, and each of the driver lines had a different promoter that is expressed exclusively in the wing. However, no visible phenotype was detected in the wings of all tested flies. On the other hand, a papss RNAi fly line, engrailed (en)-GAL4/UAS-papss-IR showed the small-wing phenotype in the posterior compartment where en is exclusively expressed (Table 2 and Fig. 6, B and F). Interestingly, the dbeta4GalT7 RNAi mutant fly line en-GAL4/+;UAS-dbeta4GalT7-IR/+ also showed the small-wing phenotype in the posterior compartment (Table 2 and Fig. 6, C and F). Nakamura et al. (17) reported that the dbeta4GalT7-knockdown fly showed the small-wing phenotype in the posterior compartment and reduced the HS and chondroitin sulfate biosynthesis. Human and Drosophila beta4GalT7 proteins are involved in the synthesis of glycosaminoglycans (GAGs) by transferring a Gal to the Xyl-O-Ser in the tetrasaccharide structure of the protein-linkage region of GAGs. To investigate whether dPAPST2 is involved in the synthesis of GAGs, we tested for a genetic interaction between dPAPST2 and dbeta4GalT7.


View this table:
[in this window]
[in a new window]
  		TABLE 2
Genetic interaction between dPAPST2 and dß4GalT7

 


Figure 6
View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 6.
Genetic interaction between dPAPST2 and dbeta4GalT7 in the wing. A–E show a representative wing of a fly with each genotype. A, wild type. B, en-GAL4/UAS-papss-IR. C, en-GAL4/+;UAS-dbeta4GalT7-IR/+.D, en-GAL4/UAS-lacZ;UAS-dbeta4GalT7-IR/+. E, en-GAL4/+;UAS-dbeta4GalT7-IR/UAS-dPAPST2-IR[1]. All lines were raised at 28 °C. Wings displayed in A and D had no aberrant phenotype. Wings displayed in B, C, and E exhibited the small-wing phenotype in the posterior compartment. The position of the anterior-posterior compartment boundary is indicated with dashed lines. F, relative area of the posterior compartment in the wing. The area of each posterior compartment was calculated using the public domain NIH image program (developed by the National Institutes of Health), and it was divided by the total area of the same wing. A–E on the x axis indicate each genotype described above. Values shown are the mean ± S.E. of the indicated number of wings.

 
To slightly weaken the phenotype of dbeta4GalT7-knockdown flies, we constructed a dbeta4GalT7 RNAi fly line that decreased the binding of GAL4 to the UAS-dbeta4GalT7-IR transgene. Because of competition for the UAS promoter, all the F1 progeny of a cross between en-GAL4/SM1;UAS-dbeta4GalT7-IR/TM3 and UAS-lacZ/UAS-lacZ (i.e. en-GAL4/UAS-lacZ;UAS-dbeta4GalT7-IR/+) showed no aberrant phenotype in the wing (Table 2 and Fig. 6, D and F). On the other hand, 14.6 and 5.9% of the double-knockdown fly lines en-GAL4/+;UAS-dPAPST2-IR[1]/UAS-dbeta4GalT7-IR and en-GAL4/UAS-dPAPST2-IR[2]; UAS-dbeta4GalT7-IR/+, respectively, which were generated by the cross between en-GAL4/SM1;UAS-dbeta4GalT7-IR/TM3 and lines UAS-dPAPST2-IR[1]/UAS-dPAPST2-IR[1] or UAS-dPAPST2-IR[2]/UAS-dPAPST2-IR[2], respectively, exhibited small-wing phenotype in the posterior compartment (Table 2 and Fig. 6, E and F). These results imply that dPAPST2 knockdown enhanced the phenotype of dbeta4GalT7 knockdown and suggest that dPAPST2 is involved in the synthesis of GAGs by transporting PAPS into the Golgi apparatus.

dPAPST2 Genetically Interacts with the dHS6ST, dHs3st-B, and dOXT Genes in the Eye—To confirm the involvement of dPAPST2 in the sulfation of GAGs, we also examined the genetic interaction between the dPAPST2 gene and another gene that is involved in the synthesis of HS; we focused on the sulfotransferase gene dHS6ST. The dHS6ST protein catalyzes the 6-O sulfation of the GAG chain of HS in Drosophila. We used a different GAL4 driver line, glass multiple reporter (GMR)-GAL4, that expresses the GAL4 protein in the developing eye under the control of the GMR promoter. The dHS6ST RNAi fly line driven by GMR-GAL4, namely GMR-GAL4/+; UAS-dHS6ST-IR/+, showed a weak rough-eye phenotype with disrupted ommatidial assembly (Fig. 7C). Similar to the en-GAL4 driver, the GMR-GAL4/+;UAS-dHS6ST-IR/UAS-EGFP showed a normal phenotype (Fig. 7D). Here the double-knockdown fly line GMR-GAL4/+;UAS-dHS6ST-IR/UAS-dPAPST2[1] exhibited an enhanced rough-eye phenotype with disrupted ommatidial assembly and fused ommatidia (Fig. 7E), indicating the presence of genetic interaction between dPAPST2 and dHS6ST. In addition, dPAPST2 also interacted with two Drosophila genes involved in HS synthesis, namely dOXT and dHs3st-B, in the developing eye (Fig. 7, F–I). These results suggest that dPAPST2 is involved in the sulfation of HS by transporting PAPS into the Golgi apparatus. The relationship among these components is illustrated in Fig. 8.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
This study identified a novel Drosophila gene involved in the sulfation of proteoglycans. This gene, dPAPST2, was identified to be a PAPS transporter gene that is essential for the viability of the fly. An analysis of the genetic interaction between dPAPST2 and the genes that are involved in the GAG synthesis revealed that the dPAPST2 gene is involved in the synthesis of HS.

In a previous study, we identified another PAPS transporter gene, sll, in Drosophila (6). The dPAPST2 and SLL proteins have similar functional properties, i.e. PAPS-specific transport activity with comparable Km values (2.3 and 1.2 µM, respectively) and involvement in the sulfation of HS. It has been presumed that Drosophila has a relatively lesser number of nucleotide sugar transporter genes than mammals. For example, the Drosophila UDP-Gal/UDP-GalNAc transporter gene dmUGT is considered to be a single ortholog of three distinct human nucleotide sugar transporter genes, namely the UGT, UDP-GlcNAc transporter, and CMP-sialic acid transporter genes (Fig. 1A). Furthermore, Drosophila fringe connection is the only gene that corresponds to the two human nucleotide sugar transporter genes hfrc1 and UGTrel7 (21, 25). On the other hand, Drosophila sll and dPAPST2 correspond to each of the human orthologous genes PAPST1 and PAPST2, respectively (Fig. 1A); this suggests their early divergence in evolution. It is known that Drosophila possesses sulfated HS similar to vertebrates (26), and the sulfation of HS plays an important role in the development of Drosophila. There is a possibility that the existence of plural PAPS transporter genes in Drosophila may be reflected in the significance of diversity in sulfated HS.


Figure 7
View larger version (93K):
[in this window]
[in a new window]
  		FIGURE 7.
Genetic interaction among dPAPST2, dHS6ST, dHs3st-B, and dOXT in the eye. Eyes of adult flies were observed under a JEOL 5600LV scanning electron microscope (Japan Electron Optics Laboratory. Co., Ltd., Tokyo, Japan). A–E show a representative eye of a fly with each genotype. A, wild type. B, GMR-GAL4/+;UAS-dPAPST2-IR[1]/+. C, GMR-GAL4/+;UAS-dHS6ST-IR/+. D, GMR-GAL4/+;UAS-dHS6ST-IR/UAS-EGFP. E, GMR-GAL4/+;UAS-dHS6ST-IR/UAS-dPAPST2-IR[1]. F, GMR-GAL4/UAS-dHs3st-B-IR;UAS-EGFP/+. G, GMR-GAL4/UAS-dHs3st-B-IR;UAS-dPAPST2-IR[1]/+. H, GMR-GAL4/+;UAS-dOXT-IR/UAS-EGFP. I, GMR-GAL4/+;UAS-dOXT-IR/UAS-dPAPST2-IR[1]. All lines were raised at 28 °C. Eyes displayed in A, B, D, F, and H had no aberrant phenotype. Eyes displayed in C, E, G, and I exhibited the rough-eye phenotype. The scale at the bottom of A represents 100 µm.

 
The PAPS transport activity of the dPAPST2 protein was measured using a yeast expression system. The yeast S. cerevisiae has been widely used to examine the function of nucleotide sugar transporters because the Golgi-enriched fraction of this strain has limited endogenous nucleotide sugar transport activity, with the exception of GDP-Man transport activity. However, the yeast Golgi-enriched fraction had relatively high endogenous PAPS transport activity; therefore, the true activity and kinetics of the dPAPST2 protein, excluding other factors, remain uncertain. Alternatively, it may be suitable to use an artificial vesicle with zero background for the measurement of PAPS transport activity; however, such systems have certain disadvantages such as altered Km values (27). On the other hand, the silencing of the dPAPST2 gene in the S2 cells reduced the PAPS transport activity in the Golgi apparatus (Fig. 4B) and the total sulfate incorporation into cellular proteins (Fig. 4C). Furthermore, the lethality of the dPAPST2-knockdown fly lines Act5C-GAL4/+;UAS-dPAPST2-IR[1]/+ and Act5C-GAL4/UAS-dPAPST2-IR[2] also indicates that dPAPST2 is an essential gene for the viability of the fly and is not a modulator of sll function. The details of the sulfation state of HS in dPAPST2-knockdown flies needs to be evaluated in future investigations.

Mutations in the genes involved in the synthesis of proteoglycans, including those encoding core proteins (4, 28, 29), nucleotide sugar transporter (30, 31), glycosyltransferases (32–34), and sulfotransferases (4, 5, 15), are responsible for the defects in the growth factor signaling function of the fly. Lüders et al. (7) reported that sll is involved in Wingless and Hedgehog signaling during development. On the other hand, we were unable to observe any specific phenotype of the growth factor signaling in the dPAPST2-knockdown flies. Because the expression of dPAPST2 is less than half that of sll in Drosophila tissues (Fig. 3), the reduction in the dPAPST2 level might be complemented by the function of SLL. On the other hand, dPAPST2 interacted genetically with dbeta4GalT7, indicating the involvement of dPAPST2 in the synthesis of GAGs. In Drosophila, the dbeta4GalT7 protein plays a role in normal Hedgehog signaling by contributing to the synthesis of the linkage region of GAGs (17). A number of reports have mentioned that HS is required in Hedgehog and Decapentaplegic signaling (33–36). The smallwing phenotype of dbeta4GalT7 RNAi flies is considered to occur following the impairment of Decapentaplegic signaling (17), which primarily regulates the growth of the wing along the anterior-posterior axis (37). In addition, dPAPST2 also interacted genetically with the dHS6ST, dHs3st-B, and dOXT genes in the developing eye. These genes have been characterized and are involved in the synthesis of sulfated GAGs in Drosophila (15, 16, 19). During photoreceptor differentiation, the Hedgehog protein controls the progression of the morphogenetic furrow, and Decapentaplegic signaling follows the Hedgehog signaling within and ahead of the morphogenetic furrow (38, 39). dPAPST2 is expressed in the wing and eye discs in the third instar larvae of Drosophila (Fig. 3B). Because the sulfation of HS is crucial for the signaling, dPAPST2 may be involved in Hedgehog and Decapentaplegic signaling by controlling HS sulfation (Fig. 8).


Figure 8
View larger version (45K):
[in this window]
[in a new window]
  		FIGURE 8.
Schematic representation of the functions of genes involved in HS sulfation. Developmental signaling functions of cell surface HS depends on its sulfation state. Sulfate is transferred from PAPS to defined positions on the sugar residues of the GAG of HS by sulfotransferases. PAPS is synthesized by PAPS synthase in the cytosol or nucleus in the presence of sulfate ions and ATP. Subsequently, PAPS is translocated from the cytosol into the Golgi lumen by PAPS transporters to supply the donor substrate for sulfotransferases. dOXT and dbeta4GalT7 contribute to the synthesis of the linkage region of GAGs. Each Drosophila gene is identified based on its Flybase symbol name.

 
Drosophila has many sulfated molecules, including proteoglycans (26), glycoproteins, and glycolipids (40). The lethality of the fly lines Act5C-GAL4/+;UAS-dPAPST2-IR[1]/+ and Act5C-GAL4/UAS-dPAPST2-IR[2] also suggests the presence of dPAPST2-predominant tissue(s) or the distinct role of dPAPST2 from that of sll, although they exhibit similar ubiquitous distribution in the adult fly. The SLL, PAPSS, and PIPE proteins are involved in the production of an Alcian blue-positive sulfated macromolecule, which is not HS, in the embryonic salivary glands (12). The expression of dPAPST2 in the central nervous system may suggest the involvement of this gene in the synthesis of sulfated glycolipids or the HNK-1 epitope. Identifying the glycoconjugates that are influenced by dPAPST2 will provide clues to elucidate the role of the PAPS transporter gene in the fly.


   FOOTNOTES
 
* This work was supported by the Core Research for Evolutional Science and Technology of the Japan Science and Technology Agency. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the DDBJ/GenBankTM/EBI Data Bank with accession number(s) AB242867 [GenBank] . Back

1 Both authors contributed equally to this work. Back

2 To whom correspondence should be addressed. Tel.: 81-426-91-8140; Fax: 81-426-91-8140; E-mail: shoko{at}t.soka.ac.jp.

3 The abbreviations used are: PAPS, 3'-phosphoadenosine 5'-phosphosulfate; dHS6ST, Drosophila heparan sulfate 6-O-sulfotransferase; dHs3st-B, Drosophila heparan sulfate 3-O-sulfotransferase B; dOXT, Drosophila peptide O-xylosyltransferase; dbeta4GalT7, Drosophilabeta1,4-galactosyltransferase 7; EGFP, enhanced green fluorescent protein; en, engrailed; GAG, glycosaminoglycan; GMR, glass multiple reporter; HA, influenza hemagglutinin epitope; HS, heparan sulfate; IR, inverted repeat; mAb, monoclonal antibody; papss, PAPS synthase; RpL32, ribosomal protein L32; RNAi, RNA interference; S2, Schneider 2; sll, slalom; dsRNA, double-stranded RNA. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kamiyama, S., and Nishihara, S. (2004) Trends Glycosci. Glycotechnol. 16, 109–123
  2. Selleck, S. B., and Nakato, H. (2004) Trends Glycosci. Glycotechnol. 16, 95–108
  3. Lin, X., and Perrimon, N. (2000) Matrix Biol. 19, 303–307[CrossRef][Medline] [Order article via Infotrieve]
  4. Lin, X., and Perrimon, N. (1999) Nature 400, 281–284[CrossRef][Medline] [Order article via Infotrieve]
  5. Lin, X., Buff, E. M., Perrimon, N., and Michelson, A. M. (1999) Development (Camb.) 126, 3715–3723[Abstract]
  6. Kamiyama, S., Suda, T., Ueda, R., Suzuki, M., Okubo, R., Kikuchi, N., Chiba, Y., Goto, S., Toyoda, H., Saigo, K., Watanabe, M., Narimatsu, H., Jigami, Y., and Nishihara, S. (2003) J. Biol. Chem. 278, 25958–25963[Abstract/Free Full Text]
  7. Lüders, F., Segawa, H., Stein, D., Selva, E. M., Perrimon, N., Turco, S. J., and Häcker, U. (2003) EMBO J. 22, 3635–3644[CrossRef][Medline] [Order article via Infotrieve]
  8. Rapraeger, A. C., Krufka, A., and Olwin, B. B. (1991) Science 252, 1705–1708[Abstract/Free Full Text]
  9. Olwin, B. B., and Rapraeger, A. (1992) J. Cell Biol. 118, 631–639[Abstract/Free Full Text]
  10. Sen, J., Goltz, J. S., Stevens, L., and Stein, D. (1998) Cell 95, 471–481[CrossRef][Medline] [Order article via Infotrieve]
  11. Jullien, D., Crozatier, M., and Kas, E. (1997) Mech. Dev. 68, 179–186[CrossRef][Medline] [Order article via Infotrieve]
  12. Zhu, X., Sen, J., Stevens, L., Goltz, J. S., and Stein, D. (2005) Development (Camb.) 132, 3813–3822[Abstract/Free Full Text]
  13. Li, H., Deyrup, A., Mensch, J. R., Jr., Domowicz, M., Konstantinidis, A. K., and Schwartz, N. B. (1995) J. Biol. Chem. 270, 29453–29459[Abstract/Free Full Text]
  14. Kurima, K., Warman, M. L., Krishnan, S., Domowicz, M., Krueger, R. C., Jr., Deyrup, A., and Schwartz, N. B. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 8681–8685[Abstract/Free Full Text]
  15. Kamimura, K., Fujise, M., Villa, F., Izumi, S., Habuchi, H., Kimata, K., and Nakato, H. (2001) J. Biol. Chem. 276, 17014–17021[Abstract/Free Full Text]
  16. Kamimura, K., Rhodes, J. M., Ueda, R., McNeely, M., Shukla, D., Kimata, K., Spear, P. G., Shworak, N. W., and Nakato, H. (2004) J. Cell Biol. 166, 1069–1079[Abstract/Free Full Text]
  17. Nakamura, Y., Haines, N., Chen, J., Okajima, T., Furukawa, K., Urano, T., Stanley, P., and Irvine, K. D. (2002) J. Biol. Chem. 277, 46280–46288[Abstract/Free Full Text]
  18. Takemae, H., Ueda, R., Okubo, R., Nakato, H., Izumi, S., Saigo, K., and Nishihara, S. (2003) J. Biol. Chem. 278, 15571–15578[Abstract/Free Full Text]
  19. Wilson, I. B. (2002) J. Biol. Chem. 277, 21207–21212[Abstract/Free Full Text]
  20. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) J. Bacteriol. 153, 163–168[Abstract/Free Full Text]
  21. Suda, T., Kamiyama, S., Suzuki, M., Kikuchi, N., Nakayama, K., Narimatsu, H., Jigami, Y., Aoki, T., and Nishihara, S. (2004) J. Biol. Chem. 279, 26469–26474[Abstract/Free Full Text]
  22. Ichimiya, T., Manya, H., Ohmae, Y., Yoshida, H., Takahashi, K., Ueda, R., Endo, T., and Nishihara, S. (2004) J. Biol. Chem. 279, 42638–42647[Abstract/Free Full Text]
  23. Spradling, A. C. (1986) in Drosophila: A Practical Approach (Roberts, D. B., ed) pp. 175–197, IRL Press at Oxford University Press, Oxford
  24. Kamiyama, S., Sasaki, N., Goda, E., Ui-Tei, K., Saigo, K., Narimatsu, H., Jigami, Y., Kannagi, R., Irimura, T., and Nishihara, S. (2006) J. Biol. Chem. 281, 10945–10953[Abstract/Free Full Text]
  25. Muraoka, M., Kawakita, M., and Ishida, N. (2001) FEBS Lett. 495, 87–93[CrossRef][Medline] [Order article via Infotrieve]
  26. Toyoda, H., Kinoshita-Toyoda, A., and Selleck, S. B. (2000) J. Biol. Chem. 275, 2269–2275[Abstract/Free Full Text]
  27. Tiralongo, J., Ashikov, A., Routier, F., Eckhardt, M., Bakker, H., Gerardy-Schahn, R., and von Itzstein, M. (2006) Glycobiology 16, 73–81[Abstract/Free Full Text]
  28. Tsuda, M., Kamimura, K., Nakato, H., Archer, M., Staatz, W., Fox, B., Humphrey, M., Olson, S., Futch, T., Kaluza, V., Siegfried, E., Stam, L., and Selleck, S. B. (1999) Nature 400, 276–280[CrossRef][Medline] [Order article via Infotrieve]
  29. Baeg, G. H., Lin, X., Khare, N., Baumgartner, S., and Perrimon, N. (2001) Development (Camb.) 128, 87–94[Abstract]
  30. Selva, E. M., Hong, K., Baeg, G. H., Beverley, S. M., Turco, S. J., Perrimon, N., and Häcker, U. (2001) Nat. Cell Biol. 3, 809–815[CrossRef][Medline] [Order article via Infotrieve]
  31. Goto, S., Taniguchi, M., Muraoka, M., Toyoda, H., Sado, Y., Kawakita, M., and Hayashi, S. (2001) Nat. Cell Biol. 3, 816–822[CrossRef][Medline] [Order article via Infotrieve]
  32. Bellaiche, Y., The, I., and Perrimon, N. (1998) Nature 394, 85–88[CrossRef][Medline] [Order article via Infotrieve]
  33. The, I., Bellaiche, Y., and Perrimon, N. (1999) Mol. Cell 4, 633–639[CrossRef][Medline] [Order article via Infotrieve]
  34. Takei, Y., Ozawa, Y., Sato, M., Watanabe, A., and Tabata, T. (2004) Development (Camb.) 131, 73–82[Abstract/Free Full Text]
  35. Tabata, T., and Takei, Y. (2004) Development (Camb.) 131, 703–712[Abstract/Free Full Text]
  36. Lin, X. (2004) Development (Camb.) 131, 6009–6021[Abstract/Free Full Text]
  37. Brook, W. J., Diaz-Benjumea, F. J., and Cohen, S. M. (1996) Annu. Rev. Cell Dev. Biol. 12, 161–180[CrossRef][Medline] [Order article via Infotrieve]
  38. Heberlein, U., Wolff, T., and Rubin, G. M. (1993) Cell 75, 913–926[CrossRef][Medline] [Order article via Infotrieve]
  39. Fu, W., and Baker, N. E. (2003) Development (Camb.) 130, 5229–5239[Abstract/Free Full Text]
  40. Dennis, R. D., Martini, R., and Schachner, M. (1991) Cell Tissue Res. 265, 589–600[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Plant CellHome page
S. G. Mugford, N. Yoshimoto, M. Reichelt, M. Wirtz, L. Hill, S. T. Mugford, Y. Nakazato, M. Noji, H. Takahashi, R. Kramell, et al.
Disruption of Adenosine-5'-Phosphosulfate Kinase in Arabidopsis Reduces Levels of Sulfated Secondary Metabolites
PLANT CELL, March 1, 2009; 21(3): 910 - 927.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Ueyama, H. Takemae, Y. Ohmae, H. Yoshida, H. Toyoda, R. Ueda, and S. Nishihara
Functional Analysis of Proteoglycan Galactosyltransferase II RNA Interference Mutant Flies
J. Biol. Chem., March 7, 2008; 283(10): 6076 - 6084.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/39/28508    most recent
M605045200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goda, E.
Right arrow Articles by Nishihara, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goda, E.
Right arrow Articles by Nishihara, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement