|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 281, Issue 39, 29042-29053, September 29, 2006
Regulation of Neuronal Morphology by Toca-1, an F-BAR/EFC Protein That Induces Plasma Membrane Invagination*From the Laboratory of Molecular Neurobiology, Graduate School of Biostudies, Kyoto University, Sakyo-ku, Kyoto 606-8501, Japan
Received for publication, April 27, 2006 , and in revised form, July 27, 2006.
Actin reorganization is important for regulation of neuronal morphology. Neural Wiskott-Aldrich syndrome protein (N-WASP) is an important regulator of actin polymerization and also known to be strongly expressed in brain. Recently, Toca-1 (transducer of Cdc42-dependent actin assembly) has been shown to be required for Cdc42 to activate N-WASP from biochemical experiments. Toca-1 has three functional domains: an F-BAR/EFC domain at the N terminus, an HR1 at the center, and an SH3 domain at the C terminus. The F-BAR/EFC domain induces tubular invagination of plasma membrane, while Toca-1 binds both N-WASP and Cdc42 through the SH3 domain and the HR1, respectively. However, the physiological role of Toca-1 is completely unknown. Here we have investigated the neural function of Toca-1. Toca-1 is strongly expressed in neurons including hippocampal neurons in developing brain at early times. Knockdown of Toca-1 in PC12 cells significantly enhances neurite elongation. Consistently, overexpression of Toca-1 suppresses neurite elongation through the F-BAR/EFC domain with a membrane invaginating property, suggesting an implication of membrane trafficking in the neural function of Toca-1. In addition, knockdown of N-WASP, to our surprise, also enhances neurite elongation in PC12 cells, which is in clear contrast to the previous report that dominant negative mutants of N-WASP suppress neurite extension in PC12 cells. On the other hand, knockdown of Toca-1 in cultured rat hippocampal neurons enhances axon branching a little but not axon elongation, while knockdown of N-WASP enhances both axon elongation and branching. These results suggest that a vesicle trafficking regulator Toca-1 regulates different aspects of neuronal morphology from N-WASP.
Actin reorganization is important for regulating morphology of various cells including neurons (1). Neurons extend axons during the early phase of neural development. In this process, growth cones at the growing tips of axons play a critical role by detecting the guidance cues and mediating motility. Neurons then form synaptic connections and form a complex neural network to function properly. Rho family GTPases are implicated in morphological changes of various cells by reorganizing actin cytoskeleton (1). Among them, Rho, Rac, and Cdc42 have been extensively investigated. In neurons, Rac and Cdc42 stimulate neurite extension, whereas Rho triggers growth cone collapse and neurite retraction. Wiskott-Aldrich syndrome protein (WASP)3 family members play essential roles in actin polymerization and have been much studied as a link between Rho family and actin cytoskeleton (2). WASP family members are characterized by their C-terminal VCA region (for verprolin homology (V) region, cofilin-homology (C) region, and acidic (A) region). They bind to both G-actin through the V region and Arp2/3 complex through the CA region, and activate Arp2/3 complex. The activated Arp2/3 complex nucleates de novo actin filaments and forms branched actin filament network. Five WASP family members have been described in mammals: WASP, N-WASP (Neural WASP), and three WASP-family verprolin-homologous (WAVE) proteins.
Among WASP family proteins, N-WASP is well known for its role in various actin reorganization processes, such as Cdc42-induced filopodia formation in fibroblasts (2). In the inactive state, N-WASP is in a closed form by an intramolecular interaction between the GTPase-binding domain (GBD) and the VCA region, therefore the VCA region is masked. Cdc42, phosphatidylinositol 4,5-bisphosphate (PIP2) and several SH3 domain-containing proteins including Grb2/Ash, Nck, and WISH bind to N-WASP through the GBD, the basic region and the proline-rich domain, respectively. Their binding unfolds inactive N-WASP and thereby activates N-WASP. The exposed VCA region activates Arp2/3 complex, stimulating actin polymerization through de novo actin nucleation (2-4). Thus, N-WASP acts as an integrator of multiple signaling pathways to direct actin polymerization (2). Indeed, an N-WASP mutant, which has a deletion in the cofilin homology (C) region and is impaired in its ability to activate Arp2/3 complex-mediated actin nucleation, reportedly suppresses neurite extension in PC12 cells and primary cultured rat hippocampal neurons (5), by working as a putative dominant negative mutant. It has also been reported that another putative dominant negative mutant of N-WASP, which has a mutation in the GBD and is unable to bind to Cdc42, also suppresses neurite extension in PC12 cells (5). Ho et al. (6) have recently reported that Toca-1 (transducer of Cdc42-dependent actin assembly) is necessary for Cdc42 to activate N-WASP from biochemical experiments. Toca-1 is a member of PCH (pombe Cdc15 homology) family proteins and has three functional domains: an F-BAR/EFC domain (for Fer/CIP4 homology (FCH) and BAR (Bin-Amphiphysin-Rvs)/extended Fer/CIP4 homology domain) at the N terminus, an HR1 (protein kinase C-related kinase homology region 1) at the center, and an SH3 domain at the C terminus. The N-terminal F-BAR/EFC domain of PCH family proteins binds directly to phosphatidylserine and PIP2, and thereby induces tubular invagination of the plasma membrane (7-9). Toca-1 binds both N-WASP and Cdc42 through the SH3 domain and the HR1, respectively (6). N-WASP forms a complex with WASP-interacting protein (WIP) in intracellular environment. WIP regulates N-WASP by recruiting N-WASP to sites where actin assembly occurs (10). Toca-1 was shown to promote actin nucleation by activating N-WASP-WIP complex in response to Cdc42 in vitro (6). Direct binding of Toca-1 to Cdc42 and N-WASP was shown to be required for this function of Toca-1, because both an SH3 mutant of Toca-1, Toca-1-K, and an HR1 mutant of Toca-1, Toca-1-IST failed to activate Cdc42-induced actin assembly (6). Toca-1-K with a conserved tryptophan in the SH3 domain mutated to lysine fails to bind to N-WASP, whereas Toca-1-IST with three conserved residues (MGD) in the HR1 substituted with IST is significantly impaired in its ability to bind to Cdc42 (6). However, the physiological role of Toca-1 is completely unknown. Here we studied neuronal function of Toca-1 because we found that Toca-1 is strongly expressed in developing neurons. Knockdown and overexpression experiments in PC12 cells showed that Toca-1 negatively regulates neurite elongation through the F-BAR/EFC domain. The F-BAR/EFC domain induces plasma membrane invagination (8), suggesting an implication of membrane trafficking in neurite elongation. Surprisingly, knockdown of N-WASP also enhances neurite elongation in PC12 cells, which is in clear contrast to the previous report using dominant negative mutants of N-WASP (5). Meanwhile, knockdown of Toca-1 in cultured rat hippocampal neurons enhances axon branching a little but not axon elongation, whereas knockdown of N-WASP enhances both axon elongation and branching. These results suggest that Toca-1 regulates different aspects of neuronal morphology from N-WASP probably through regulation of vesicle trafficking.
Plasmid Constructions and AntibodiesRat Toca-1 was cloned as described previously (11) using RT-PCR with rat brain RNA as a template. cDNAs encoding the full-length Toca-1L (amino acids 2-609), Toca-1S (amino acids 2-551), Toca-1L-K576 (amino acids 2-609), Toca-1L-IST (amino acids 2-609), Toca-1L- C (amino acids 2-371), Toca-1L- N (amino acids 389-609), and Toca-1L-QQ (amino acids 2-609) were subcloned into expression vector pCMV (Clontech, Mountain View, CA) encoding an initiating Met followed by the Myc epitope tag or enhanced green fluorescent protein (EGFP) sequence at the N terminus. cDNAs encoding the full-length RapostlinL (amino acids 2-620), and RapostlinS (amino acids 2-559) were subcloned into pcDNA3 (Invitrogen, Carlsbad, CA), encoding an initiating Met followed by the Myc epitope tag sequence at the N terminus. Rat N-WASP cDNA was a generous gift from Dr. T. Takenawa (University of Tokyo, Tokyo, Japan), and subcloned into pCMV-HA (Clontech). pCAG encoding enhanced yellow fluorescent protein (EYFP) was a generous gift from Drs. J. Miyazaki (Osaka University, Osaka, Japan) and T. Saito (Chiba University, Chiba, Japan). The target sequences used for short interfering RNA (siRNA) are as follows: Toca-1 siRNA-A, nucleotides 61-79, GGAATTGACTTCTTGGAAA; Toca-1 siRNA-B, nucleotides 1782-1800, AGATGTAACTCTAGAGAAA; Toca-1 siRNA-C, nucleotides 1358-1376, AGACCATGAATAACATTGA; N-WASP siRNA-A, nucleotides 95-115, GCAAGAAATGTGTGACTATGT; N-WASP siRNA-B, nucleotides 119-137, CAGCAGTGGTGCAGTTATA, and they were expressed using an siRNA expression vector pSilencer (Ambion, Austin, TX). As a control we used a nonspecific pSilencer vector encoding an siRNA sequence not found in the rat or human genome in BLAST search provided by the manufacturer as described previously (12).
An antibody against Toca-1 was raised against a bacterially expressed glutathione S-transferase-fused peptide corresponding to the amino acid residues 489-526 of Toca-1L (SDINHLVTQGRESPEGSYTDDANQEVRGPPQQHGHHSE). The specific antibody against Toca-1 was purified with a peptide (CANQEVRGPPQQHGHHS, the amino acid residues 510-525 of Toca-1L)-conjugated affinity column. The following antibodies were purchased from commercial sources: a mouse monoclonal antibody against Myc (Upstate%20Biotechnology">Upstate Biotechnology, Lake Placid, NY), mouse monoclonal antibodies against ImmunoblottingImmunoblotting was performed as described previously (11). Briefly, proteins were separated by SDS-10% PAGE and were electrophoretically transferred onto a polyvinylidene difluoride membrane (Millipore Corporation, Bedford, MA). The membrane was blocked with 3% low fat milk in Tris-buffered saline and then incubated with primary antibodies. The primary antibodies were detected with horseradish peroxidase-conjugated secondary antibodies (DAKO, Carpinteria, CA) and a chemiluminescence detection kit. Preparation of Rat Tissue HomogenatesVarious tissues of Wistar rats were homogenized with a Teflon homogenizer in homogenizing buffer (20 mM Tris-HCl, pH 7.4, 0.32 M sucrose, 10 mM MgCl2, 1 mM EDTA, 1 µg/ml aprotinin, 1 µg/ml leupeptin, 0.1 mM benzamidine, and 0.2 mM phenylmethylsulfonyl fluoride) as described previously (13). The homogenates were lysed with Laemmli sample buffer and analyzed by immunoblotting. RT-PCRTo investigate the expression of Toca-1 spicing variants, RT-PCR was performed from various postnatal day 8 (P8) rat tissues using a pair of primers, 5'-cgcaaagttatccccatcat-3' and 5'-gagccatgcctcattcttgt-3'. In Situ HybridizationAntisense and sense riboprobes for rat Toca-1 (nt 351-821) were synthesized and digoxigenin (DIG)-labeled by in vitro transcription with T7 and T3 RNA polymerases and DIG RNA labeling mix (Roche Applied Science) from EcoRI-, XhoI-digested pBluescript (Stratagene, La Jolla, CA) plasmid. In situ hybridization was performed as described previously (13, 14). Briefly, 30-40 µm-thick coronal or sagittal sections of P1 or embryonic day 18 (E18) rat brains were treated with 0.5 µg/ml proteinase K (Roche Applied Science) for 3-5 min at room temperature. The sections were then acetylated in acetic anhydride/triethanolamine-HCl for 10 min before hybridization. After prehybridization, the sections were incubated overnight at 55 °C with 500-1000 ng/ml DIG-labeled sense or antisense probe. The sections were then washed in 2x SSC at 55 °C three times for 1 h each. DIG-labeled probes were immunodetected using an alkaline phosphatase-conjugated antibody against DIG (Roche Applied Science) and then reacted with chromogenic substrates, 5-bromo-4-chloro-3-indolylphosphate and nitroblue tetrazolium. Cell Culture and Transfection293T cells and HeLa cells were grown in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 4 mM glutamine, 100 units/ml of penicillin, and 0.1 mg/ml of streptomycin under humidified air containing 5% CO2 at 37 °C. 293T cells (1 x 106 cells) cultured on 60-mm culture dishes were transfected with test plasmids using Lipofectamine plus (Invitrogen) according to the manufacturer's instructions. HeLa cells (3 x 104 cells) cultured in 24-well plates on glass coverslips (circular, 13 mm in diameter) were transfected with test plasmids using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Rat pheochromocytoma PC12 cells were grown in Dulbecco's modified Eagle's medium containing 10% horse serum, 5% fetal bovine serum, 4 mM glutamine, 100 units/ml of penicillin, and 0.1 mg/ml of streptomycin under humidified air containing 5% CO2 at 37 °C. PC12 cells cultured in 24-well plates at a density of 2 x 104 onto poly-D-lysine-coated glass coverslips (circular, 13 mm in diameter) were transfected with test plasmids using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. PC12 cells were differentiated with 50 ng/ml of nerve growth factor (NGF) (Promega, Madison, WI) in serum-free Dulbecco's modified Eagle's medium for 44 h after the transfection and then fixed. Hippocampal cultures were prepared from the hippocampi of E19 rats as described previously (13). Briefly, hippocampi of Wistar rat embryos were dissected in ice-cold calcium- and magnesium-free HBSS. The hippocampi were washed in HBSS and incubated in HBSS with 0.25% trypsin and 0.1% DNase for 10-15 min at 37 °C. After the incubation, the hippocampi were washed in HBSS, followed by trituration with Pasteur pipettes. The cells were seeded onto poly-D-lysine-coated glass coverslips (circular, 13 mm in diameter) at a density of 2 x 104 cells in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 4 mM glutamine, 100 units/ml of penicillin, and 0.1 mg/ml of streptomycin and cultured under humidified air containing 5% CO2 at 37 °C. After 5 h, the medium was replaced with Neurobasal medium (Invitrogen) with 2% B27 supplement (Invitrogen), 0.5 mM glutamine, and 100 units/ml of penicillin and cultured under humidified air containing 5% CO2 at 37 °C. For immunofluorescence analyses, hippocampal neurons were transfected with test plasmids at 1 day in vitro (1 DIV) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions and fixed at 4 DIV. For immunoblot analyses, hippocampal neurons were cultured on poly-D-lysine-coated 60-mm culture dishes, and transfected with test plasmids using Rat Neuron Nucleofector kit (Amaxa Biosystems, Cologne, Germany) following the manufacturer's instructions. Immunofluorescence MicroscopyTwenty-four hours after the transfection, HeLa cells on coverslips were fixed with 3.7% formaldehyde in phosphate-buffered saline (PBS) for 15 min and mounted in 90% glycerol containing 0.1% p-phenylenediamine dihydrochloride in PBS. Cells with membrane tubulation were counted as described previously (8, 9). Briefly, a cell that had at least one tubulation of overexpressed Toca-1 or its mutant was counted as a cell with membrane tubulation. PC12 cells and primary cultured rat hippocampal neurons on coverslips were fixed with 4% paraformaldehyde in PBS for 15 min. After residual paraformaldehyde had been quenched with 50 mM NH4Cl in PBS for 10 min, cells were permeabilized with 0.2% Triton X-100 in PBS for 10 min and incubated with 10% fetal bovine serum in PBS for 30 min. Cells were incubated with the antibody against Toca-1 in PBS for 1 h followed by incubation with an Alexa 594-conjugated goat antibody against rabbit IgG (Molecular Probes, Eugene, OR) in PBS for 1 h. Cells on coverslips were mounted in 90% glycerol containing 0.1% p-phenylenediamine dihydrochloride in PBS. The cells were photographed with a Leica (Nussloch, Germany) DC350F digital camera system equipped with a Nikon (Tokyo, Japan) Eclipse E800 microscope and analyzed with Image-Pro Plus image analysis software (Media Cybernetics). For quantification of neurite elongation in PC12 cells, cells with neurites were defined as cells that possessed at least one neurite longer than twice the diameter of the cell body as described previously (5, 12, 15). Axon length and branching in hippocampal neurons were quantified manually as described previously (16) using Image-Pro Plus image analysis software (Media Cybernetics). Briefly, one neurite that was immunostained with a mouse monoclonal antibody against Tau-1 (Chemicon, Temecula, CA) was analyzed as an axon for each neuron. And, only processes longer than 20 µm from axon branch points were counted as axon branches.
Toca-1 Is Strongly Expressed in BrainWhen we performed RT-PCR from rat brain to clone a rat ortholog of Toca-1, we found that Toca-1 has a splicing variant (Fig. 1A, panel a). Cloning and sequence analysis of the variant showed that this longer variant has an insertion of 58 residues, which we named as the insert region, between the F-BAR/EFC domain and the HR1. Therefore, we renamed Toca-1 as Toca-1S, and named the longer variant as Toca-1L. We have previously reported that Rapostlin/formin-binding protein 17 (FBP17; hereafter referred to as Rapostlin), a Toca-1 paralog, also has two splicing variants with and without the insert region between the F-BAR/EFC domain and the HR1: RapostlinL and RapostlinS, respectively (11, 17). The conserved splicing pattern suggests that the presence of the insert region may make a functional difference.
To characterize Toca-1, we raised an antibody against a peptide, corresponding to the amino acid residues 489-526 of Toca-1L and purified with a peptide, corresponding to the amino acid residues 510-525 of Toca-1L, which is a unique sequence of Toca-1 compared with the close paralog, Rapostlin (6, 17). The antibody recognized both of the Toca-1 splicing variants overexpressed in 293T cells and did not cross-react with Rapostlin (Fig. 1B). The specificity of the antibody was further supported by the result of the immunocytochemistry (Fig. 3C) and immunoblotting (Fig. 6B) of Toca-1 siRNA-transfected cells. To examine the tissue distribution of Toca-1, we carried out an immunoblot analysis using the antibody against Toca-1 (Fig. 1C). Toca-1 was expressed strongly in brain, kidney, and lung, but little expression was detected in other rat tissues examined, including heart, liver, thymus, and spleen. The reactive protein bands, especially those of brain, appeared to consist of at least double bands, suggesting the presence of splicing variants, although we could not rule out the possible influence of protein degradation. Because we could not distinguish Toca-1L and Toca-1S from each other by the immunoblot analysis (Fig. 1C), we performed RT-PCR from the rat tissues where the expression of Toca-1 was detected in Fig. 1C, namely, brain, lung, and kidney (Fig. 1D). In brain both Toca-1L and Toca-1S were expressed, while only Toca-1S was expressed in lung and kidney. Comparison of band intensity between Toca-1L and Toca-1S in brain suggested that Toca-1L is the major variant in brain. Because N-WASP is also expressed strongly in brain (18), Toca-1 may play an important role in neural function together with N-WASP. Toca-1 Is Expressed in Developing Brain at Early TimesTo further examine the distribution of Toca-1 in a rat brain, we performed in situ hybridization using a DIG-labeled Toca-1 antisense riboprobe for the rat brain section (Fig. 2A). Expression of Toca-1 mRNA was observed in hippocampal pyramidal neurons (Fig. 2A, panel b; control sense strand hybridization shown in Fig. 2A, panel c) and cortical neurons (Fig. 2A, panel d; control sense strand hybridization shown in Fig. 2A, panel e) with high intensity both in P1 (Fig. 2A, panel a) and E18 (Fig. 2A, panel f). Hybridization with the sense riboprobe revealed no signal (Fig. 2A, panels c and e and data not shown). Toca-1 mRNA-expression was also detected in other brain regions, including piriform cortex and thalamus (data not shown).
We also investigated the developmental changes of expression of Toca-1 (Fig. 2B). We performed an immunoblot analysis for rat brain lysates from E16 to adult. The expression of Toca-1 in brain was high during embryonic stages and gradually declined in postnatal days until the expression was scarcely detected in adult. The immunoreactivity was abolished by preabsorption of the antibody with antigenic peptide. The strong expression of Toca-1 in developing brain at early times suggests its role in the early phase of neural development.
Knockdown of Toca-1 by siRNA Significantly Enhances Neurite Elongation in PC12 CellsTo examine the physiological function of Toca-1, we generated short interfering RNA (siRNA) expression vectors against Toca-1 and N-WASP to down-regulate the expression of these proteins (Fig. 3A). For Toca-1, Toca-1 siRNA-A or -B effectively reduced the expression of exogenously expressed Myc-tagged Toca-1 expression, whereas nonspecific siRNA or Toca-1 siRNA-C had no effect on the amounts of Toca-1 expression (Fig. 3A, panel a). The expression levels of A rat pheochromocytoma cell line PC12 has been used widely as a model system to study neurite outgrowth because of its ability to differentiate into a neuron-like morphology in response to NGF. First, we confirmed the expression of Toca-1 in PC12 cells compared with 293T cells in an immunoblot analysis (Fig. 3B), concurrently with the prominent expression of Toca-1 in neurons in brain (Fig. 2). An immunocytochemical analysis of Toca-1 in NGF-differentiated PC12 cells showed that Toca-1 was localized diffusely in both cell bodies and neurites (Fig. 3C, panel a). Therefore, we examined the effect of siRNA-mediated knockdown of Toca-1 in PC12 cells to investigate the function of Toca-1 in neurite elongation (Fig. 3, C and D). PC12 cells were transiently cotransfected with EYFP and one of the aforementioned siRNA vectors against Toca-1 before differentiating with NGF, and we analyzed the neurite elongation of the transfected cells. Expression of Toca-1 siRNA-A or -B significantly enhanced NGF-induced neurite elongation in PC12 cells compared with that of nonspecific siRNA or the ineffective siRNA vector, Toca-1 siRNA-C (Fig. 3, C and D).
We examined the effect of knockdown of N-WASP in PC12 cells as well (Fig. 3, C and D). To our surprise, expression of N-WASP siRNA-A or -B significantly enhanced neurite elongation in PC12 cells in contrast to the previous report using dominant negative mutants of N-WASP (5). However, in support of our observation, overexpression of the CA domain of N-WASP, which blocks activation of Arp2/3 complex and also sequesters Arp2/3 complex, enhances axon elongation in primary cultured hippocampal neurons according to another report (19). Our observation concurs with the latter report (19) because N-WASP can exert its effect on actin polymerization only through Arp2/3 complex (2). Collectively, these results of knockdown experiments of Toca-1 and N-WASP in PC12 cells indicate that both proteins negatively regulate neurite elongation, but they do not necessarily mean that both proteins work in the same signaling pathway.
Overexpressed Toca-1 Suppresses Neurite Elongation of PC12 Cells in a Different Pathway from Cdc42 and N-WASPTo verify the suppressive effect of Toca-1 on neurite elongation, we transiently cotransfected Myc-tagged wild-type Toca-1, or a Toca-1 mutant with EYFP in PC12 cells (Fig. 4). First, to estimate the expression of these constructs, cell lysates from the transfected PC12 cells were subjected to immunoblotting (Fig. 4B). All Toca-1 constructs were expressed at similar levels except that the expression level of Toca-1L-
To map the region of Toca-1 involved in the negative regulation of neurite elongation, first we tested two Toca-1 mutants that were described previously (6). We used mutants of Toca-1L because the suppression of neurite elongation by Toca-1L was a little greater than that by Toca-1S (Fig. 4C). Toca-1L-K576 with a conserved tryptophan in the SH3 domain mutated to lysine fails to bind to N-WASP, while Toca-1L-IST with three conserved residues (MGD) in the HR1 substituted with IST is significantly impaired in its ability to bind to Cdc42 (6). Overexpression of Toca-1L-K576 or Toca-1L-IST suppressed neurite elongation in PC12 cells to a similar extent to that of wild-type Toca-1L (Fig. 4). Next, we transiently transfected Toca-1L- C or Toca-1L- N in PC12 cells (Fig. 4). Overexpression of Toca-1L- C suppressed neurite elongation similarly to that of wild-type Toca-1L. In contrast, neurite elongation of cells expressing Toca-1L- N was not affected despite the strong expression of Toca-1L- N (Fig. 4). These results show that the suppression of neurite elongation by overexpressed Toca-1 is mediated by its N terminus and does not require its interaction with Cdc42 or N-WASP.
Overexpressed Toca-1 Suppresses Neurite Elongation of PC12 Cells through the F-BAR/EFC Domain with a Membrane-invaginating PropertyPCH family proteins, when expressed at higher levels, induce tubular plasma membrane invagination through the N-terminal F-BAR/EFC domain (7-9). To examine whether Toca-1 induces plasma membrane invagination in living cells, we transiently transfected EGFP-tagged wild-type Toca-1, or Toca-1 mutant in HeLa cells (Fig. 5). The expression of these constructs was examined by immunoblotting of cell lysates from transfected cells (Fig. 5B). All Toca-1 constructs were found to be expressed at similar levels. Overexpression of Toca-1L induced plasma membrane invagination (Fig. 5, A and C), which is similar to what was observed by overexpression of Rapostlin (7-9). Overexpression of Toca-1S induced membrane invagination to a lower extent (Fig. 5, A and C) as reported previously (8), suggesting that the insert region enhances plasma membrane invagination. Overexpressed Toca-1L- Therefore, we postulated that overexpressed Toca-1 suppresses neurite elongation in PC12 cells through the F-BAR/EFC domain with a membrane invaginating property. To verify this hypothesis, we transiently transfected Toca-1L-QQ in PC12 cells. Toca-1L-QQ with conserved lysine residues in the F-BAR/EFC domain mutated to glutamine (Fig. 4A) had impaired ability to induce plasma membrane invagination (Fig. 5), similarly to what was observed for a corresponding mutant of Rapostlin (9). Overexpression of Toca-1L-QQ failed to suppress neurite elongation in PC12 cells despite its strong expression (Fig. 4). These results indicate that the neural function of Toca-1 is mediated by the F-BAR/EFC domain, which induces tubular plasma membrane invagination.
Knockdown of Toca-1 in Rat Hippocampal Neurons Enhances Axon Branching, whereas Knockdown of N-WASP Enhances Both Axon Elongation and BranchingPC12 cell line, which is routinely used as a model of neurons, does not have all the property of neurons. To examine the neuronal function of Toca-1 in more physiological conditions, we first examined its expression in hippocampal neurons. We prepared primary cultured rat hippocampal neurons and analyzed the expression of Toca-1 by immunoblotting (Fig. 6A). Toca-1 was strongly expressed in developing hippocampal neurons at early times, just as in developing brain (Fig. 2B). These data suggest that Toca-1 may be involved in the early phase of the development of hippocampal neurons, such as axon elongation.
Therefore, we studied the effect of Toca-1 on axon elongation of hippocampal neurons using siRNA-mediated knockdown of Toca-1 (Fig. 3A). We transiently cotransfected EYFP and one of the aforementioned siRNA vectors against Toca-1 in primary cultured rat hippocampal neurons, and we observed them at 4 DIV, because axon elongates mainly around this time in development (Figs. 6 and 7). The depletion of Toca-1 was confirmed by an immunoblot analysis (Fig. 6B). The level of endogenous Toca-1 was reduced in neurons expressing Toca-1 siRNA-A or -B, while the expression of nonspecific siRNA or Toca-1 siRNA-C had no effect on the amounts of endogenous Toca-1. The expression level of We also examined the effect of knockdown of N-WASP in primary cultured hippocampal neurons (Figs. 6 and 7). Expression of N-WASP siRNA-A or -B significantly enhanced not only axon branching (Fig. 7A) but also axon elongation (Fig. 7, B and C), consistently with the result of knockdown experiment in PC12 cells (Fig. 3, C and D). Together with these data, Toca-1 negatively regulates axon branching, while N-WASP negatively regulates both axon elongation and branching. The functional difference of these two proteins correlates well with their localization in a neuron: Toca-1 is localized diffusely along the axon, while N-WASP is enriched in the growth cone and distal portion of the elongating axon (19). These results indicate that Toca-1 does not always participate in the N-WASP signaling pathway.
Toca-1 was shown to be required for Cdc42 to activate N-WASP-WIP complex from biochemical experiments (6), but its physiological function was not determined. Here, we have shown that Toca-1 is expressed in neurons in developing brain at early times, and we have investigated its neuronal function. In PC12 cells, Toca-1 negatively regulates neurite elongation because knockdown of Toca-1 enhances neurite elongation and because overexpression of Toca-1 suppresses neurite elongation. The N-terminal F-BAR/EFC domain with a membrane invaginating property mediates the effect of Toca-1 in PC12 cells, and neither Cdc42-binding HR1 domain nor N-WASP-binding SH3 domain is involved. In primary cultured hippocampal neurons, Toca-1 negatively regulates axon branching but does not affect axon elongation. In contrast, knockdown of N-WASP enhances both axon elongation and branching thereby distinguishing the effects of Toca-1 and N-WASP. Thus, Toca-1 regulates different aspects of neuronal morphology from N-WASP. N-WASP is strongly expressed in neurons in brain as its name denotes, although weaker expressions are detected ubiquitously (18). Nevertheless, controversial results have been reported concerning the neuronal function of N-WASP (5, 19). One report suggested that N-WASP was essential for neurite extension, because a putative dominant negative mutant of N-WASP suppresses neurite extension in PC12 cells and hippocampal neurons (5). In contrast, in the other report, Strasser et al. (19) showed that the inhibition of Arp2/3 complex, a downstream target of N-WASP, enhances axon elongation without significantly altering overall growth cone morphology (19). They also showed that Arp2/3 is enriched in the central region of the growth cone and there is relatively little Arp2/3 at the peripheral region, where membrane protrusion occurs. These two reports (5, 19) are incompatible with each other, because N-WASP can exert its effect on actin polymerization only through Arp2/3 complex (2). Anyway, there has been no knockdown experiment that illuminates the role of N-WASP in neurite extension. Here, we showed that the depletion of N-WASP by siRNA-mediated knockdown enhances neurite elongation in PC12 cells and axon elongation and branching in primary cultured hippocampal neurons. These results are consistent with the latter experiment of the inhibition of Arp2/3 complex (19) and in contrast to the former experiment using a dominant negative mutant of N-WASP (5). So, how can we explain these apparently contradictory findings?
One possibility is that a dominant negative mutant of N-WASP may block various factors important for neurite elongation, and thereby exert more deleterious effects on neurite elongation than blocking only the N-WASP signaling pathway. Because N-WASP can directly interact with a plethora of regulatory molecules like Grb2 (2), a dominant negative mutant could sequester some of these molecules, which do not interact with N-WASP in neurons in physiological context. Alternatively, N-WASP may be required only for neurite initiation. In the siRNA-mediated knockdown experiment, endogenous N-WASP was supposed to be completely depleted after neurites were formed. Arp2/3 was also inhibited after neurites were formed in the aforementioned study (19). In contrast, the rapidly expressed dominant negative mutant of N-WASP could inhibit endogenous protein before neurites were formed (5). Anyway, the main function of N-WASP in the neurite and axon elongation process appears to be negative regulation. Ho et al. (6) reported that Toca-1 is necessary for Cdc42 to activate N-WASP from in vitro experiments. However, the physiological role of Toca-1 is totally unknown. Several lines of evidence including ours indicate that Toca-1 is not always required for Cdc42-dependent activation of N-WASP in vivo. First, Toca-1 is scarcely detected in adult brain compared with embryonic brain, whereas N-WASP is strongly expressed in adult brain (18), where it is supposed to be playing important roles. Second, in primary cultured rat hippocampal neurons, Toca-1 is localized diffusely along the axon, while N-WASP is enriched in the growth cone and distal portion of the elongating axon (19). Third, knockdown of Toca-1 in cultured hippocampal neurons enhances axon branching a little but not axon elongation, while knockdown of N-WASP enhances both axon elongation and branching. Last but not least, N-WASP-WIP complex can be fully activated by Cdc42 and PIP2, just as it can by Cdc42 and Toca-1 (10). Together with these data, Toca-1 is not necessary at least for some of the N-WASP-mediated signaling pathway, including axon elongation in hippocampal neurons. PIP2, or probably some other molecules may be able to mediate Cdc42-dependent activation of N-WASP-WIP complex in place of Toca-1 in these cases.
It is also important to note that overexpressed Toca-1 exerts its effect through the F-BAR/EFC domain with a plasma membrane deforming activity in PC12 cells. Other molecules, such as N-WASP and dynamin, which interact with Toca-1 through the SH3 domain (6, 8, 9), may coordinate membrane trafficking under physiological conditions unlike in an overexpression experiment. However, our observations suggest that Toca-1 regulates neuronal morphology mainly by regulating membrane trafficking through the F-BAR/EFC domain, which is implicated in plasma membrane invagination during endocytosis (Refs. 7-9; Fig. 8). Plasma membrane protrudes where a neurite elongates and branches. Toca-1-induced invagination is supposed to antagonize this protrusion process. In addition, a continuous supply of membrane is necessary for neurite elongation and branching, considering dramatic changes in cell surface area in these processes (20, 21). Toca-1 may negatively regulate membrane supply to neurites by promoting membrane endocytosis. Decreased suppression of protrusion and increased membrane supply by the depletion of Toca-1 lead to axon branching in hippocampal neurons and neurite elongation in PC12 cells. Knockdown of Toca-1 appeared to have little effect on neurite branching in PC12 cells (data not shown). The difference of the role of Toca-1 in hippocampal neurons and PC12 cells may be caused by inherent differences between cell types. Neurites of PC12 cells normally have few branches, while axons of hippocampal neurons branch extensively as they develop.
Interestingly, although Toca-1S that lacks the insert region significantly suppresses neurite elongation in PC12 cells and induces membrane invagination, the activity of Toca-1S is weaker than that of Toca-1L. On the other hand, Toca-1L- In contrast to the function of Toca-1, Arp2/3 negatively regulates axon elongation and branching by regulating microtubules in growth cones (19; Fig. 8). Arp2/3 is important for growth cone guidance, as well. Arp2/3 is enriched in the central region of the growth cone, where microtubules are abundant. These microtubules, which explore the peripheral region, play a critical role in growth cone guidance because the axon elongates in a direction where the microtubules invade (19). Similarly, in axon branching, microtubule invasion into a newly forming branch is necessary for development of the branch (22). Arp2/3-dependent actin structures negatively regulate microtubule dynamics that drives axon elongation and branching probably by serving as a type of barrier (19). Therefore, inhibition of Arp2/3 enhances microtubule dynamics by removing this regulation and in turn enhances axon elongation and branching. The inhibition of Arp2/3 also causes defects in growth cone guidance (19). N-WASP, the upstream activator of Arp2/3 complex, is supposed to regulate this Arp2/3-mediated regulation of microtubules in growth cones. Indeed, we showed that siRNA-mediated knockdown of N-WASP enhances neurite elongation in PC12 cells and axon elongation and branching in primary cultured hippocampal neurons. In conclusion, we showed that Toca-1 negatively regulates axon branching probably by regulating membrane trafficking through the F-BAR/EFC domain. On the other hand, Arp2/3, activated by N-WASP, negatively regulates both axon elongation and branching by regulating growth cone microtubules, as reported previously (19). Thus, Toca-1 may provide a novel functional link between axon branching and membrane trafficking in neurons. We have to await further examinations to elucidate the detailed mechanism by which Toca-1 regulates axon branching through regulation of membrane trafficking.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AB250295 [GenBank] and AB250296 [GenBank] .
* This work was supported in part by grants-in-aid for the Ministry of Education, Culture, Sports, Science, and Technology of Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by research fellowships of the Japan Society for the Promotion of Science for Young Scientists. 2 To whom correspondence should be addressed: Laboratory of Molecular Neurobiology, Graduate School of Biostudies, Kyoto University, Sakyo-ku, Kyoto 606-8501, Japan. Tel.: 81-75-753-4547; Fax: 81-75-753-7688; E-mail: mnegishi{at}pharm.kyoto-u.ac.jp.
3 The abbreviations used are: WASP, Wiskott-Aldrich syndrome protein; N-WASP, Neural WASP; F-BAR/EFC, Fer/CIP4 homology (FCH) and BAR (Bin-Amphiphysin-Rvs)/extended Fer/CIP4 homology; VCA, verprolin-homology, cofilin-homology, and acidic; GBD, GTPase-binding domain; PIP2, phosphatidylinositol 4,5-bisphosphate; PCH, pombe Cdc15 homology; HR1, protein kinase C-related kinase homology region 1; SH3, Src homology 3; WIP, WASP-interacting protein; EGFP, enhanced green fluorescent protein; EYFP, enhanced yellow fluorescent protein; siRNA, short interfering RNA; DIG, digoxigenin; NGF, nerve growth factor; DIV, day(s) in vitro; PBS, phosphate-buffered saline; nt, nucleotides.
We thank Dr. T. Takenawa of University of Tokyo for supplying cDNA of N-WASP, and Dr. J. Miyazaki of Osaka University and Dr. T. Saito of Chiba University for supplying pCAG encoding EYFP.
This article has been cited by other articles:
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||