HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 281, Issue 4, 2079-2086, January 27, 2006

This Article Abstract Full Text (PDF) All Versions of this Article: 281/4/2079    most recent M507816200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Shemon, A. N. Articles by Wiley, J. S. Search for Related Content PubMed PubMed Citation Articles by Shemon, A. N. Articles by Wiley, J. S. Social Bookmarking                      What's this?

A Thr³⁵⁷ to Ser Polymorphism in Homozygous and Compound Heterozygous Subjects Causes Absent or Reduced P2X₇ Function and Impairs ATP-induced Mycobacterial Killing by Macrophages^*

Anne N. Shemon, Ronald Sluyter, Suran L. Fernando, Alison L. Clarke¶, Lan-Phuong Dao-Ung, Kristen K. Skarratt, Bernadette M. Saunders||, Khai See Tan¶, Ben J. Gu, Stephen J. Fuller, Warwick J. Britton||, Steven Petrou¶, and James S. Wiley1

From the Department of Medicine, University of Sydney, Level 5, Spurrett Building, Nepean Hospital, Penrith, New South Wales 2750, the Centenary Institute of Cancer Medicine and Cell Biology, Camperdown, New South Wales 2042, the ^||Discipline of Medicine, Central Clinical School, University of Sydney, Sydney, New South Wales 2006, and the ^¶Howard Florey Institute, University of Melbourne, Victoria 3010, Australia

Received for publication, July 19, 2005 , and in revised form, October 13, 2005.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The P2X₇ receptor is a ligand-gated cation channel that is highly expressed on mononuclear leukocytes and that mediates ATP-induced apoptosis and killing of intracellular pathogens. There is a wide variation in P2X₇ receptor function between subjects, explained in part by four loss-of-function polymorphisms (R307Q, E496A, I568N, and a 5'-intronic splice site polymorphism), as well as rare mutations. In this study, we report the allele frequencies of 11 non-synonymous P2X₇ polymorphisms and describe a fifth loss-of-function polymorphism in the gene (1096C G), which changes Thr³⁵⁷ to Ser (T357S) with an allele frequency of 0.08 in the Caucasian population. P2X₇ function was measured by ATP-induced ethidium⁺ influx into peripheral blood lymphocytes and monocytes and, when compared with wild-type subjects, was reduced to 10–65% in heterozygotes, 1–18% in homozygotes, and 0–10% in compound heterozygotes carrying T357S and a second loss-of-function polymorphism. Overexpression of the T357S mutant P2X₇ in either HEK-293 cells or Xenopus oocytes gave P2X₇ function of 50% that of wild-type constructs. Differentiation of monocytes to macrophages, which also up-regulates P2X₇, restored P2X₇ function to near normal in cells heterozygous for T357S and to a value 50–65% of wild-type in cells homozygous for T357S or compound heterozygous for T357S/E496A. However, macrophages from subjects that are compound heterozygous for either T357S/R307Q or T357S/stop codon had near-to-absent P2X₇ function. These functional deficits induced by T357S were paralleled by impaired ATP-induced apoptosis and mycobacteria killing in macrophages from these subjects. Lymphocytes, monocytes, and macrophages from subjects homozygous for T357S or compound heterozygous for T357S and a second loss-of-function allele have reduced or absent P2X₇ receptor function.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The P2X₇ receptor and its genetic variants have been implicated in a variety of physiological and pathological processes, including the killing of intracellular pathogens by macrophages (1–4), inflammatory responses (5–9), and bone homeostasis (10). P2X₇ receptors are highly expressed on cells of hemopoietic origin, including cells of the monocytic-macrophage series, dendritic cells, mast cells, and lymphoid cells of all subtypes, which collectively lead to the concept of P2X₇ as a proinflammatory receptor (11). Activation of P2X₇ opens a cation-selective channel allowing an influx of Ca²⁺ and Na⁺ and efflux of K⁺ (12–16). Prolonged exposure to ATP induces a second permeability state (dilated channel or pore), which allows the influx of larger cations such as ethidium⁺ (314 Da) or YO-PRO-1²⁺ (375 Da) (12–14). It is currently unclear whether the two permeability states are an intrinsic property of the P2X₇ receptor or whether the second permeability pathway depends on recruitment of an unidentified protein to the surface of the host cell (17). Activation of this receptor initiates a cascade of downstream signaling events such as the stimulation of phospholipase D (PLD)² (18, 19) and the subsequent killing of mycobacteria and chlamydiae (1, 2, 20), processing and secretion of interleukin-1 and interleukin-18 (5, 7, 8), and the stimulation of membrane metalloproteases resulting in the shedding of CD23 and L-selectin (21–24). P2X₇ activation also stimulates intracellular caspases and kinases, which eventually leads to cytolysis of lymphocytes (25), monocytes/macrophages (26, 27), and dendritic cells (28).

The P2X₇ receptor has intracellular amino and carboxyl termini with two hydrophobic membrane-spanning domains, separated by a long glycosylated extracellular loop containing the proposed ATP-binding sites (29–32). The P2X₇ receptor forms trimeric complexes of identical subunits in the plasma membrane and is unable to oligomerize with other P2X receptors (33). It also differs from other P2X receptors in having a longer carboxyl terminus measuring 240 amino acids from the inner membrane face. The integral role of the carboxyl terminus in ATP-induced pore function has been confirmed, because truncation of this domain abrogates influx of the fluorescent dyes ethidium⁺ or YO-PRO-1²⁺ (13, 34). Our previous studies have identified two polymorphisms in the carboxyl terminus causing loss-of-function of the receptor, Glu⁴⁹⁶ to Ala (1513A C) and Ile⁵⁶⁸ to Asn (1729T A) with the former affecting receptor function and the latter affecting receptor trafficking (35, 36). Work from our group has identified a third loss-of-function polymorphism in the ATP-binding site of the extracellular loop of the receptor that changes Arg³⁰⁷ to Gln (946G A) so that ATP can no longer bind to the receptor (32). Two other genetic variations give loss-of-function of the P2RX7 gene. The first is an intronic polymorphism at the 5'-donor splice site at the exon 1-intron 1 boundary (151+1g t), which results in a null allele in 1–2% of Caucasian subjects (37), whereas in one subject an exonic mutation (699C T) introduces a stop codon in exon 7 of the P2RX7 gene (4). These polymorphisms and mutations, however, do not account for all observed cases of variation in P2X₇ function in humans.

In this study we report a fifth polymorphism within the human P2RX7 gene. This polymorphism (1096C G) changes Thr³⁵⁷ to Ser (T357S) in a region of the carboxyl terminus that has been proposed as a -arrestin-2 binding motif on the receptor (38). Freshly isolated lymphocytes and monocytes from subjects heterozygous for this polymorphism have 50% P2X₇ function compared with wild-type subjects, whereas lymphocytes and monocytes from subjects homozygous for T357S or compound heterozygous for T357S and a second loss-of-function polymorphism have near-to-absent P2X₇ function.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Materials—ATP, RPMI 1640 media, bovine serum albumin, L-glutamine, gentamicin, D-glucose, tryptone, yeast extract, kanamycin, Luria-Bertani agar powder, glycerol, 7-amino-actinomycin D, ethidium bromide, and salts were purchased from Sigma. HEPES, recombinant TaqDNA polymerase, fetal calf serum, trypsin-EDTA free solution, Lipofectamine^TM 2000 Reagent, and Opti-MEM I medium were from Invitrogen. Ficoll-Paque^TM (density 1.077) and GFX^TM PCR DNA and Gel Band Purification kit were purchased from Amersham Biosciences. Interferon- (IFN-) was from Roche Applied Science (Penzberg, Germany). DNA ladder (2-log) and NotI and BsmBI restriction endonucleases were purchased from New England Biolabs (Beverly, MA). The QuikChange® II site-directed mutagenesis kit was from Stratagene (La Jolla, CA). The pEGFP-N₁ vector was from BD Biosciences Clontech (Palo Alto, CA). The Mini-prep Plasmid and Wizard Genomic DNA Extraction kits were from Promega (Madison, WI), and the HiSpeed^TM plasmid purification kit was from Qiagen (Valencia, CA). Phycoerythrin-conjugated Annexin V and propidium iodide were from BD Biosciences.

Antibodies—Fluorescein isothiocyanate (FITC)- and phycoerythrin-conjugated anti-CD monoclonal antibodies (mAb) were from Dako (Carpentaria, CA). Murine anti-human P2X₇ receptor mAb (clone L4) (39) was conjugated to FITC (Sigma) as described before (40) or to Alexa-647 (Molecular Probes, Eugene, OR) according to the manufacturer's protocol.

Selection of Subjects—Blood was collected from 841 adult subjects of whom 712 were analyzed at nucleotide position 1096. Of the 712 subjects 554 were Caucasian, 94 were Asian, 49 were Indian sub-continental, and 15 were of other ethnicity. Of the 554 Caucasian subjects, 218 were normal, whereas the remainder were patients with either chronic lymphocytic leukemia (n = 110), lymphoma (n = 47), other lymphoproliferative disorders (n = 26), various infectious (n = 52), or autoimmune (n = 26) diseases. The remainder of the Caucasian subjects (n = 75) had a range of disorders, including non-hematological cancers and allergies. Studies were conducted with informed, written consent and approval from local human ethics committees.

Preparation of Leukocytes—Peripheral venous blood from adult subjects was diluted 1:1 (v/v) with RPMI 1640 medium or phosphate-buffered saline. Peripheral blood mononuclear cells (PBMCs) were isolated by density centrifugation over Ficoll-Paque, washed once in RPMI 1640 medium or phosphate-buffered saline and resuspended in NaCl medium (145 mM NaCl, 5 mM KCl, 10 mM HEPES, 5 mMD-glucose, and 1 mg/ml bovine serum albumin, pH 7.5) or RPMI 1640 medium containing 10% fetal calf serum, 2 mML-glutamine, and 5 µg/ml gentamicin (complete RPMI 1640 medium). For the generation of macrophages, PBMCs suspended in complete RPMI 1640 medium were incubated for 2 h in plastic flasks and then gently washed to remove non-adherent cells. The adherent monocytes were differentiated to macrophages by culturing for 7 days at 37 °C in 95% air/5% CO₂ in complete RPMI 1640 medium. In the final 24 h of culture macrophages were activated by adding 100 units/ml IFN-.

DNA Extraction—Genomic DNA was extracted from peripheral whole blood as previously described (32). Plasmid DNA was extracted from XL1-Blue supercompetent cells transformed with wild-type or mutant P2X₇ cDNA using either the Mini-prep Plasmid DNA Extraction or HiSpeed^TM plasmid purification kits according to manufacturers' protocols.

Single Nucleotide Polymorphism Detection—Twelve primers were used to amplify the 13 exons of the human P2RX7 gene from genomic DNA (GenBank^TM accession number NT_009775 [GenBank] .8), and the PCR products were sequenced as described (32). For detection of the 1096C G polymorphism in a large number of samples, genomic DNA was analyzed using the high throughput TaqMan assay using an ABI Prism 7900HT Sequence Detection System (Applied Biosystems) at the SUPAMAC Facility (Royal Prince Alfred Hospital, Sydney, New South Wales, Australia) using the following primer and probe set (5'3'): forward primer: GGGAGCGACAGCAGTTACTG; reverse primer: CAGCGCTTGTCTGCATTCTC; Probe: VIC CTCATCGACACTTACTC MGB NFQ; Probe: FAM TCATCGACAGTTACTC MGB NFQ. The identification of the 1096C G polymorphism was verified by conventional sequencing.

Site-directed Mutagenesis—The C terminus of P2X₇ was tagged with EGFP by sub-cloning the human P2X₇ receptor into the NheI/NotI cloning sites of the pEGFP-N₁ vector as described previously (41). The single amino acid change at 1096C G (Thr³⁵⁷ to Ser) was introduced using the QuikChange® II site-directed mutagenesis kit with the wild-type human P2X₇ in the pEGFP vector as the template. The point mutation was constructed using a pair of complimentary mutagenic primers described below consisting of a mutagenic codon flanked by sequences homologous to the wild-type strand of the template. After digestion by DpnI, intact mutation-containing DNA was transformed into XL1-Blue supercompetent cells. All mutations were confirmed by sequencing. Purified mutagenic oligonucleotides (PROLIGO, Sydney, New South Wales, Australia) were as follows (base changes are in boldface type and underlined): Thr³⁵⁷ to Ser forward: GACTTCCTCATCGACAGTTACTCCAGTAACTGC; Thr³⁵⁷ to Ser reverse: GCAGTTACTGGAGTAACTGTCGATGAGGAAGTC.

Transfection of HEK-293 Cells—HEK-293 cells were maintained in complete RPMI 1640 medium. Empty pEGFP vector cDNA, wild-type P2X₇-EGFP cDNA, and mutant P2X₇-EGFP cDNA were incubated in serum free Opti-MEM® I medium for 5 min followed by incubation with Lipofectamine^TM 2000 reagent for 20 min at room temperature. The solution was added to a sub-confluent monolayer of HEK-293 cells (4 x 10⁶ in 3 ml of Opti-MEM® I medium containing 5% fetal calf serum but no antibiotics) and transfected for 2 days at 37 °C in 95% air/5% CO₂. Cells were harvested by mechanical scraping and washed in HEPES-buffered NaCl medium.

Immunofluorescent Staining and Flow Cytometry—PBMCs or transfected HEK-293 cells were labeled with fluorochrome-conjugated mAb, washed, and analyzed on a FACSCalibur flow cytometer (BD Biosciences). Surface P2X₇ expression (FITC labeling) on subsets of PBMCs was measured by gating on CD19⁺ and CD3⁺ lymphocytes and on CD14⁺ monocytes. Dead cells were excluded using 7-amino-actinomycin D staining. For HEK-293 cells, EGFP expression was used to determine the total P2X₇ expression, whereas surface P2X₇ expression (Alexa-647 labeling) was measured by gating on EGFP-positive HEK-293 cells. Negative control values were subtracted for each subset to determine the mean channel of fluorescence intensity or the percentage of cells positive for surface P2X₇ expression.

Ethidium⁺ Influx Measurements—ATP-induced ethidium⁺ influx into PBMCs, macrophages, and EGFP-positive HEK-293 cells in KCl medium (150 mM KCl, 10 mM HEPES, 5 mM D-glucose, and 1 mg/ml bovine serum albumin, pH 7.5) was measured using time-resolved flow cytometry as described (32), with the FL-2 (ethidium⁺) channel voltage reduced for macrophages as described (36).

Ba²⁺ Influx Measurements—ATP-induced Ba²⁺ influx into PBMCs in KCl medium was measured using time-resolved flow cytometry as described (32).

Electrophysiology—Oocytes from adult female Xenopus laevis were surgically removed and prepared as outlined previously (42) and plated in 96-well plates. cDNA encoding wild-type P2X₇-EGFP or mutant P2X₇-EGFP (0.7 µg/µl) was injected (20 nl) into the nuclei of Stage 5 or 6 oocytes using the Roboocyte Robot (Multi Channel Systems, Reutlingen, Germany) and stored at 18 °C for 2 days prior to experimentation. Oocytes were studied with the two-electrode voltage clamp technique using the Roboocyte Robot. Oocytes were impaled with two glass electrodes containing 1.5 M potassium acetate and 0.5 M KCl and held at a membrane potential of –70 mV. Oocytes were continually perfused with a ND96 solution (96 mM NaCl, 2 mM KCl, 0.1 mM CaCl₂, 5 mM HEPES, pH 7.5) using a Gilson 222 XL Liquid Handler and Gilson Minipulse 3 Peristaltic Pump (Gilson Inc., Middleton, WI). ATP (200 µM) dissolved in bath solution was applied to the oocytes for 20 s. Following ATP (200 µM) application, the oocytes were again perfused with bath solution for 2 min to allow for the full recovery of the current to baseline levels.

Mycobacterial Killing and Macrophage Apoptosis—IFN- activated macrophages were infected with Mycobacterium bovis bacille Calmette-Guerin (BCG)-GFP (43) for 4 h at a multiplicity of infection of 1:1 (day 0) then washed twice to remove extracellular bacteria. On day 2, cells were pulsed with 3 mM ATP in complete RPMI 1640 medium for 20 min, washed, and incubated overnight at 37 °C in 95% air/5% CO₂. On day 3, half the wells were lysed with 0.1% Triton-X for 30 min to release viable bacilli. Serial dilutions of cell lysates were plated onto 7H11 agar and incubated at 37 °C for 3–4 weeks to determine the load of viable mycobacteria. The remaining wells were stained for phycoerythrin-conjugated Annexin V and propidium iodide to measure apoptosis as per manufacturer's protocol and analyzed on a FACSCalibur flow cytometer (3). Apoptotic cells included both early apoptotic (Annexin V⁺/propidium iodide^–) and late stage apoptotic (Annexin V⁺/propidium iodide⁺) cells.

Presentation of Data and Statistics—Data are presented as mean ± S.E. Differences between groups were compared using the two-tailed Student's unpaired t test.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
A Single Nucleotide Polymorphism at Position 1096 of the P2RX7 Gene—In addition to the known loss-of-function polymorphisms at nucleotide positions 155+1, 946, 1513, and 1729 in the human P2RX7 gene (32, 35–37), additional non-synonymous polymorphisms have been identified by our group at positions 253, 474, 489, 835, 853, 1068, 1096, and 1405 (Table 1). The polymorphisms at positions 489 and 1068 have been previously described (29, 44–46), whereas the other additional polymorphisms, with the exception of the 474G A polymorphism, have all been reported previously.³ In addition, we have identified six synonymous polymorphisms at positions 488, 530, 558, 1448, 1628, and 1772, four of which have been reported on-line.³ The synonymous polymorphisms at positions 1448 and 1628 were found in linkage with the 1096G polymorphism reported in this study.

A number of subjects with low or absent P2X₇ function carried the 1096C G allele in exon 11 of the P2RX7 gene with an allele frequency of 0.10 (Table 1). A similar frequency was observed when only Caucasian subjects were included in the analysis. In 4 of 554 Caucasian subjects a homozygous nucleotide substitution (1096C G) was found, whereas 83 subjects were heterozygous at this position. The values give an overall allele frequency of this single nucleotide polymorphism of 0.08 in the Caucasian population, and analysis shows the values are in Hardy-Weinberg equilibrium (expected homozygotes = 3.73). The four subjects homozygous for the 1096G polymorphism were wild-type for the 155+1, 946, 1513, and 1729 alleles. The 1096C G substitution predicts a single amino acid change of threonine 357 to serine (T357S) in the carboxyl terminus of the P2X₇ receptor. 17 of 542 Caucasian subjects (3%) were compound heterozygotes for T357S as well as E496A, the latter being the most prevalent loss-of-function polymorphism with an allele frequency of 0.16 (47). Four of these compound heterozygotes were available for functional studies. In addition, two of the subjects heterozygous for the T357S polymorphism were also heterozygous for other loss-of-function polymorphisms (R307Q and the 5'-intronic splice site at nucleotide 151+1t, respectively), and another carried a stop codon mutation in exon 7 (nucleotide 699C T); all of whom were available for functional studies.

Reduced P2X₇ Function in Lymphocytes and Monocytes from Subjects with the Thr³⁵⁷ to Ser (T357S) Polymorphism—ATP-induced ethidium⁺ influx was measured in monocytes and lymphocyte subsets pre-labeled with antibodies to enable gating as previously described (40). Subjects heterozygous for the T357S polymorphism had reduced ATP-induced ethidium⁺ influx compared with subjects wild-type for all known polymorphisms (Fig. 1 and Table 2). P2X₇ function in all PBMC subsets was even lower in subjects homozygous for the T357S polymorphism with values between 5 and 20% of wild-type (Table 2 and Fig. 1). The most severe loss-of-function was seen in all seven compound heterozygote subjects that were tested in whom P2X₇ function in all PBMC subsets was absent or reduced below 5% of wild-type (Table 2). The reduced function observed in PBMCs carrying the T357S polymorphism was not due to lack of surface P2X₇ expression as the receptor was present on PBMC subsets from these subjects (results not shown).

View larger version (21K): [in this window] [in a new window]   FIGURE 1. ATP-induced ethidium+ influx into lymphocytes and monocytes. PBMCs from normal subjects of various genotypes (WT/WT, wild-type; WT/T357S, T357S heterozygote; T357S/T357S, T357S homozygote; and T357S/E496A, compound heterozygote) were labeled with FITC-conjugated anti-CD mAb and suspended in KCl medium at 37 °C. Ethidium+ (25 µM) was added followed 40 s later by the addition of 1 mM ATP (arrow). The mean channel of cell-associated fluorescence intensity was measured at 5-s intervals for: A, B-lymphocytes (gated on CD19+ cells); B, T-lymphocytes (gated on CD3+ cells); and C, monocytes (gated on CD14+ cells) by time-resolved flow cytometry. Basal ethidium+ influx measured in the absence of ATP is also shown.

Reduced P2X₇ Function of Thr³⁵⁷ to Ser (T357S)-mutated P2X₇ in HEK-293 Cells—Transfection experiments confirmed that the T357S polymorphism reduced P2X₇ function. cDNA for wild-type P2X₇ receptor and a mutant carrying the 1096C G substitution, both in an EGFP vector, were transfected into HEK-293 cells, and ATP-induced ethidium⁺ influx into EGFP-positive cells was measured by time-resolved flow cytometry. ATP produced a large influx of ethidium⁺ into cells transfected with wild-type P2X₇ cDNA (mean arbitrary units of ethidium⁺ influx of 6,023 ± 1,008, n = 4; Fig. 3). In contrast, ATP-induced ethidium⁺ influx into cells transfected with the T357S-mutated cDNA was only 41% that of the wild-type value (mean arbitrary units of ethidium⁺ influx of 2,460 ± 532, n = 4; p = 0.01; Fig. 3). Cells transfected with the empty EGFP vector had negligible ATP-induced ethidium⁺ influx (mean arbitrary units of ethidium⁺ influx of 29 ± 33, n = 4; Fig. 3). The reduced function was not due to differences in P2X₇ expression in the transfected HEK-293 cells. Total P2X₇ expression was indirectly determined by EGFP fluorescence while the expression of surface P2X₇ alone was determined by Alexa-647 conjugated anti-P2X₇ mAb measured by flow cytometry. The expression of total EGFP and P2X₇ on the surface of EGFP-positive cells was similar for both wild-type P2X₇ and T357S-mutated P2X₇ (data not shown).

View larger version (23K): [in this window] [in a new window]   FIGURE 2. ATP-induced Ba2+ influx into T-lymphocytes. PBMCs from wild-type (WT/WT) or homozygous (T357S/T357S) subjects were incubated with 1µg/ml Fura-Red for 30 min at 37 °C and washed once. Cells were labeled with FITC-conjugated anti-CD3 mAb and resuspended in KCl medium at 37 °C. Ba2+ (1 mM) was added followed 40 s later by the addition of 1 mM ATP (arrow). The mean channel of cell-associated fluorescence intensity was measured at 2-s intervals for T-lymphocytes (gated on CD3+). Basal Ba2+ influx measured in the absence of ATP is also shown. One representative experiment of two is shown.

View larger version (15K): [in this window] [in a new window]   FIGURE 3. ATP-induced ethidium+ influx into transfected HEK-293 cells. HEK-293 cells transfected for 48 h with vector-EGFP, wild-type P2X7-EGFP, or T357S-mutated P2X7-EGFP cDNA were suspended in KCl medium at 37 °C. Ethidium+ (25 µM) was added followed 40 s later by the addition of 1 mM ATP (arrow). The mean channel of cell-associated fluorescence intensity was measured at 5-s intervals for EGFP-positive cells by time-resolved flow cytometry. Ethidium+ influx in the absence of ATP was negligible (data not shown). One representative experiment of four is shown.

Reduced P2X₇ Function in Macrophages from Subjects with the Thr³⁵⁷ to Ser (T357S) Polymorphism—Differentiation of monocytes into macrophages increases the expression and function of P2X₇ by many-fold (36, 48, 49). Peripheral blood monocytes were cultured for 7 days (with IFN- present for the final 24 h) and P2X₇ function was measured by ATP-induced ethidium⁺ influx into the CD14⁺ macrophage population. Macrophages from subjects who were wild-type for all known loss-of-function polymorphisms displayed an ATP-induced ethidium⁺ influx of 39,222 ± 2,947 mean arbitrary units of ethidium⁺ influx (n = 7; Fig. 5, A and B; Table 3). ATP-induced ethidium⁺ influx into macrophages from a subject heterozygous for T357S (mean arbitrary units of ethidium⁺ influx of 25,185) was 36% lower than of wild-type macrophages, whereas ATP-induced ethidium⁺ influx into macrophages from a homozygous subject (mean arbitrary units of ethidium⁺ influx of 16,792) was 57% lower than that of wild-type macrophages (Fig. 5A).

View larger version (9K): [in this window] [in a new window]   FIGURE 4. ATP-induced currents in oocytes. Comparison of mean current responses in oocytes to 200 µM ATP of wild-type P2X7-EGFP (n = 35) and T357S-mutated P2X7-EGFP (n = 23) receptors shows that the mean current for the wild-type receptor is significantly larger than that observed for the mutant receptor.

Reduced ATP-induced Apoptosis in Macrophages from Subjects with the Thr³⁵⁷ to Ser (T357S) Polymorphism—We have previously reported that ATP-induced apoptosis as well as killing of intracellular mycobacteria (BCG) is impaired in subjects carrying loss-of-function polymorphisms in the P2RX7 gene (3, 4). We studied seven subjects with the T357S polymorphism, including one homozygote and four compound heterozygotes for the ability of ATP to induce apoptosis of their macrophages and to kill intracellular mycobacteria. Adherent monocyte-derived macrophages from these subjects and from controls who were wild-type for all known loss-of-function polymorphisms were infected with BCG for 48 h and then pulsed with ATP for 20 min. Following removal of ATP and overnight incubation, the percentage of apoptotic macrophages was determined (Table 3). In wild-type individuals, the addition of ATP on average led to a 24% increase in apoptotic cells compared with unstimulated macrophages. ATP-induced apoptosis in macrophages either heterozygous or homozygous for the T357S polymorphism was reduced by 43 and 74%, respectively. This reduction in ATP-induced apoptosis was even greater in macrophages heterozygous for both T357S and one other loss-of-function allele, which on average was 92% lower than that of wild-type values.

View larger version (28K): [in this window] [in a new window]   FIGURE 5. ATP-induced ethidium+ influx into macrophages. Monocyte-derived macrophages (activated with IFN-) from (A and B) wild-type (WT/WT) subjects; A, T357S heterozygote (WT/T357S) or homozygote (T357S/T357S) subjects, or B, compound heterozygote subjects (as indicated) were labeled with FITC-conjugated anti-CD14 mAb and suspended in KCl medium at 37 °C. Ethidium+ (25 µM) was added followed 40 s later by the addition of 1 mM ATP (arrow). The mean channel of cell-associated fluorescence was measured at 5-s intervals by time-resolved flow cytometry. The voltage setting for ethidium+ was reduced to gain the full scale of influx increase. Basal ethidium+ influx measured in the absence of ATP is also shown.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The present data confirm the highly polymorphic structure of the P2RX7 gene and identify a fifth loss-of-function allele at position 1096 of cDNA. Within the coding region of the P2RX7 gene we have identified 11 polymorphisms that change an amino acid residue, an average of one base change per 160 bp of cDNA. In addition, we have identified a 5'-intronic splice site polymorphism in 1–2% of Caucasian subjects with no identifiable product from the affected allele, presumably due to nonsense-mediated RNA decay (37). The present as well as previous studies from our group have identified five polymorphisms, including T357S, which lead to reduction or loss of P2X₇ function, whereas another three (at amino acids 155, 348, and 460) have a negligible effect on ATP-induced ethidium⁺ influx in transfected HEK-293 cells (31).⁴ The effect of the amino acid 155 polymorphism is however controversial with a recent study proposing that the predicted amino acid change, His¹⁵⁵ to Tyr, confers a gain of function (46). In addition, we have found two exonic mutations in single individuals that abolish function of the mutant allele, one within the trafficking domain of the receptor (Arg⁵⁷⁴ to His) and a second in exon 7 of the gene (699C T in cDNA) that produces a premature stop codon (4). The splice site polymorphism as well as the uncommon R307Q and I568N polymorphisms confer complete loss of P2X₇ function in fresh PBMCs and have biological significance in heterozygous dosage (30, 33–34). In contrast, the two most common polymorphisms at residues 496 and 357 of the protein result in complete loss of P2X₇ function only when present in homozygote dosage or in combination with another loss-of-function polymorphism as a compound heterozygote (32, 35, 37) (Table 1). Because the T357S variation is present in 11% of the population and E496A is found in over one quarter of Caucasian subjects (47) (Table 1), the combination of T357S/E496A is found in 3% of subjects and is the single most common cause of near-to-absent P2X₇ function in fresh PBMCs. Collectively, when the prevalence of all five loss-of-function polymorphisms are taken into account 51% of Caucasian subjects are wild-type at these five alleles, 40% are heterozygous, and 9% of the Caucasian population carry at least two loss-of-function alleles.

A major finding of this study is that the T357S substitution reduced P2X₇ receptor function, although the effect of this polymorphism in heterozygous dosage was modest. P2X₇ function, as measured by ethidium⁺ influx in freshly isolated PBMCs, was reduced by 80% or was absent in subjects homozygous or compound heterozygous, respectively, for the T357S polymorphism (Fig. 1 and Table 2). Ba²⁺ influx was also absent in freshly isolated PBMCs from homozygous subjects (Fig. 2). Results in the present and our previous studies (32, 35, 36) show that the loss-of-function imparted by deleterious polymorphisms are more severe in freshly isolated human mononuclear cells. Thus forced overexpression of the T357S-mutated P2X₇ in HEK-293 cells or Xenopus oocytes allows the impairment of P2X₇ function to be partially reversed (Figs. 3 and 4). In both these heterologous systems the function of mutant P2X₇ was 50% of wild-type, which is a strikingly different value to the <1% of wild-type function observed in fresh human lymphocytes homozygous for the T357S polymorphism (compare Fig. 1, A and B, to Figs. 3 and 4). Our data also show that impaired P2X₇ function in monocytes from a subject homozygous for T357S was partially corrected upon differentiation of monocytes to macrophages, a process that up-regulates P2X₇ expression by at least one order of magnitude (36, 48, 49). We and others have previously shown that the ability of ATP to induce formation of ethidium⁺-permeable pores in cells that natively express P2X₇ receptors is modulated by receptor subunit density at the cell surface (14, 49). Collectively, data from macrophages and both heterologous systems indicate that P2X₇ function can be partially restored by increased expression of the T357S-mutated P2X₇ receptor on the cell surface. Although the T357S P2X₇ variant shows partial function at high receptor density, certain combinations of loss-of-function alleles lead to a complete loss of P2X₇ function not only in fresh PBMCs but also in cultured macrophages. Thus Fig. 5 shows that P2X₇ function was totally ablated in macrophages from a subject who was a compound heterozygote for both T357S and R307Q, as well as from the subject with T357S and a stop codon on the other allele. In contrast, P2X₇ function in macrophages from subjects compound heterozygous for both T357S and E496A was on average 53% of that from wild-type subjects.

The threonine to serine polymorphism is at position 357 and lies in the carboxyl terminus several residues from the putative second transmembrane domain. Thr³⁵⁷ forms part of a threonine-serine cluster (³⁵⁷TYSS³⁶⁰), which has been proposed as a binding motif for -arrestin-2 in a human endocervical carcinoma cell line and HEK-293 cells (38). Although threonine residues on P2X₇ are known to be phosphorylated (38),⁵ and analysis of the human P2X₇ receptor using the PhosphoBase version 2.0 program⁶ revealed several threonine residues, including Thr³⁵⁷, as potential phosphorylation sites,⁷ it is currently unknown if Thr³⁵⁷ is actually phosphorylated. Serine, which is structurally similar to threonine, can also be phosphorylated. However, despite these similarities the substitution of serine for threonine at position 357 reduced ATP-induced currents in Xenopus oocytes by 40% (Fig. 4) despite injecting equal amounts of cDNA, whereas this same substitution reduced ATP-induced ethidium⁺ influx in HEK-293 cells by 60% (Fig. 3) despite similar surface expression of P2X₇ (data not shown). A similar reduction in ATP-induced ethidium⁺ influx was also observed in monocyte-derived macrophages homozygous for the T357S polymorphism. This reduction in P2X₇ function was even greater in fresh lymphocytes and monocytes. There are few reports describing the effect of threonine to serine substitutions on ion channel function. However, substitution of threonine in place of serine at residue 906 in the human Na_v1.4 channel slowed entry into and recovery from the slow inactivation state resulting in a change-of-function (50). It remains to be determined if the effect of T357S on P2X₇ function is due to changes in phosphorylation, altered interactions with -arrestin-2, changes in free energy barriers impeding pore dilatation, or a modification in tertiary protein structure.

Activation of the P2X₇ receptor on macrophages has been shown to lead to the subsequent apoptotic death of this cell type (26, 27). Our data (Table 3) confirm P2X₇-induced apoptosis of human macrophages, because brief exposure to ATP gave a 24% increase in the percentage of apoptotic wild-type macrophages measured 16 h later. Loss-of-function polymorphisms in the P2X₇ receptor reduced this value of ATP-induced apoptosis to half the wild-type value for T357S heterozygotes and to one-fourth of wild-type values for the single subject who was homozygous for T357S. Comparison of these values (Table 3) with the monocyte (Table 2) and macrophage P2X₇ function (Table 3) for the same polymorphisms reveals a strong correlation between receptor activation and the downstream effects on apoptotic death of the cell.

Our current data are consistent with our previous studies (3, 4) demonstrating that loss-of-function polymorphisms lead not only to reduced ATP-induced apoptosis but also to impaired ATP-induced killing of an intracellular mycobacterium (BCG) by macrophages. However, unlike the R307Q, E496A, and I568N polymorphisms, which in heterozygous dosage impair killing of mycobacteria on average by 56% (4), the T357S polymorphism in heterozygous dosage had no significant effect, whereas homozygous dosage gave only modest (15%) reduction in killing. By contrast, killing of mycobacteria was markedly reduced in macrophages heterozygous for T357S when combined with another loss-of-function polymorphism, collectively supporting the gene dosage effect observed with P2X₇ loss-of-function polymorphisms (4). The relatively normal killing of BCG in T357S heterozygous or homozygous macrophages despite impaired ATP-induced apoptosis in these same cells may somehow reflect the many steps required for killing of mycobacteria. Alternatively, the T357S polymorphism may not impair ATP-induced PLD stimulation, which is necessary for the killing of intracellular pathogens. In murine thymocytes, the Pro⁴⁵¹ to Leu polymorphism within the P2X₇ receptor impairs ATP-induced cation fluxes, phosphatidylserine exposure, and cell death but not ATP-induced PLD stimulation (51, 52). Moreover, transfection of HEK-293 cells with cDNA encoding this mutated murine P2X₇ gives values for ATP-induced YO-PRO-1²⁺ uptake around half that for wild-type P2X₇ (51). This difference is remarkably similar to our observations with ATP-induced ethidium⁺ uptake into HEK-293 cells transfected with T357S-mutated human P2X₇ cDNA (Fig. 2). Further studies are required to determine if T357S impairs ATP-induced PLD stimulation or other processes downstream of P2X₇ activation.

Our results in Table 3 further define which combinations of loss-of-function polymorphisms completely ablate P2X₇ function in cultured human macrophages. Compound heterozygotes with T357S together with either R307Q (the ATP-binding defect) or defects producing a null allele (nucleotides 151+1t or 699T) gave absent P2X₇ function (<1% of wild-type) and nearly absent (<5%) ATP-induced apoptosis and mycobacterial killing by macrophages (Table 3). Macrophages are central to the innate immune response, and complete abolition of P2X₇ function may be a susceptibility factor in a range of intracellular infections, including tuberculosis, chlamydia, and toxoplasmosis. Our data confirm that the T357S polymorphism in homozygous dosage or in combination with another loss-of-function polymorphism has major effects on macrophage function and should be included in studies of susceptibility to infections by intracellular pathogens.

	FOOTNOTES

 
^* This work was supported by the National Health and Medical Research Council of Australia, the Leukemia Foundation of New South Wales, the Community Health Anti Tuberculosis Association, the Cecilia Kilkeary Foundation, the New South Wales Department of Health, a Faculty of Medicine Postgraduate Award (to A. N. S.) from the University of Sydney, a National Health and Medical Research Council of Australia Postgraduate Award (to S. L. F.), and a Sesqui Fellowship (to B. J. G.) from the University of Sydney. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom correspondence should be addressed. Tel.: 61-2-4734-3277; Fax: 61-2-4734-3432; E-mail: wileyj{at}medicine.usyd.edu.au.

² The abbreviations used are: PLD, phospholipase D; IFN-, interferon-; GFP, green fluorescent protein; EGFP, enhanced GFP; FITC, fluorescein isothiocyanate; mAb, monoclonal antibody; PBMC, peripheral blood mononuclear cell; BCG, bacille Calmette-Guerin.

³ www.ncbi.nlm.nih.gov/projects/SNP.

⁴ B. J. Gu and J. S. Wiley, unpublished observations.

⁵ A. N. Shemon, R. Sluyter, and J. S. Wiley, unpublished observations.

⁶ www.cbs.dtu.dk/services/NetPhos.

⁷ A. N. Shemon, unpublished observations.

	ACKNOWLEDGMENTS

 
We gratefully acknowledge Jennifer G. Georgiou for additional genotyping.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Fairbairn, I. P., Stober, C. B., Kumararatne, D. S., and Lammas, D. A. (2001) J. Immunol. 167, 3300–3307[Abstract/Free Full Text]
2. Coutinho-Silva, R., Stahl, L., Raymond, M. N., Jungas, T., Verbeke, P., Burnstock, G., Darville, T., and Ojcius, D. M. (2003) Immunity 19, 403–412[CrossRef][Medline] [Order article via Infotrieve]
3. Saunders, B. M., Fernando, S. L., Sluyter, R., Britton, W. J., and Wiley, J. S. (2003) J. Immunol. 171, 5442–5446[Abstract/Free Full Text]
4. Fernando, S. L., Saunders, B. M., Sluyter, R., Skarratt, K. K., Wiley, J. S., and Britton, W. J. (2005) J. Infect. Dis. 192, 149–155[CrossRef][Medline] [Order article via Infotrieve]
5. Solle, M., Labasi, J., Perregaux, D. G., Stam, E., Petrushova, N., Koller, B. H., Griffiths, R. J., and Gabel, C. A. (2001) J. Biol. Chem. 276, 125–132[Abstract/Free Full Text]
6. Labasi, J. M., Petrushova, N., Donovan, C., McCurdy, S., Lira, P., Payette, M. M., Brissette, W., Wicks, J. R., Audoly, L., and Gabel, C. A. (2002) J. Immunol. 168, 6436–6445[Abstract/Free Full Text]
7. Sluyter, R., Shemon, A. N., and Wiley, J. S. (2004) J. Immunol. 172, 3399–3405[Abstract/Free Full Text]
8. Sluyter, R., Dalitz, J. G., and Wiley, J. S. (2004) Genes. Immun. 5, 588–591[CrossRef][Medline] [Order article via Infotrieve]
9. Denlinger, L. C., Angelini, G., Schell, K., Green, D. N., Guadarrama, A. G., Prabhu, U., Coursin, D. B., Bertics, P. J., and Hogan, K. (2005) J. Immunol. 174, 4424–4431[Abstract/Free Full Text]
10. Ke, H. Z., Qi, H., Weidema, A. F., Zhang, Q., Panupinthu, N., Crawford, D. T., Grasser, W. A., Paralkar, V. M., Li, M., Audoly, L. P., Gabel, C. A., Jee, W. S. S., Dixon, S. J., Sims, S. M., and Thompson, D. D. (2003) Mol. Endocrinol. 17, 1356–1367[Abstract/Free Full Text]
11. Di Virgilio, F., Chiozzi, P., Ferrari, D., Falzoni, S., Sanz, J. M., Morelli, A., Torboli, M., Bolognesi, G., and Baricordi, O. R. (2001) Blood 97, 587–600[Abstract/Free Full Text]
12. Nuttle, L. C., and Dubyak, G. R. (1994) J. Biol. Chem. 269, 13988–13996[Abstract/Free Full Text]
13. Surprenant, A., Rassendren, F., Kawashima, E., North, R. A., and Buell, G. (1996) Science 272, 735–738[Abstract]
14. Wiley, J. S., Gargett, C. E., Zhang, W., Snook, M. B., and Jamieson, G. P. (1998) Am. J. Physiol. 275, C1224–C1231[Medline] [Order article via Infotrieve]
15. Shemon, A. N., Sluyter, R., Conigrave, A. D., and Wiley, J. S. (2004) Br. J. Pharmacol. 142, 1015–1019[CrossRef][Medline] [Order article via Infotrieve]
16. Sluyter, R., Shemon, A. N., Barden, J. A., and Wiley, J. S. (2004) J. Biol. Chem. 279, 44749–44755[Abstract/Free Full Text]
17. Jiang, L. H., Rassendren, F., Mackenzie, A., Zhang, Y. H., Surprenant, A., and North, R. A. (2005) Am. J. Physiol. 289, C1295–C1302[CrossRef]
18. El-Moatassim, C., and Dubyak, G. R. (1993) J. Biol. Chem. 268, 15571–15578[Abstract/Free Full Text]
19. Gargett, C. E., Cornish, E. J., and Wiley, J. S. (1996) Biochem. J. 313, 529–535[Medline] [Order article via Infotrieve]
20. Kusner, D. J., and Adams, J. (2000) J. Immunol. 164, 379–388[Abstract/Free Full Text]
21. Gu, B. J., Bendall, L. J., and Wiley, J. S. (1998) Blood 92, 946–951[Abstract/Free Full Text]
22. Jamieson, G. P., Snook, M. B., Thurlow, P. J., and Wiley, J. S. (1996) J. Cell. Physiol. 166, 637–642[CrossRef][Medline] [Order article via Infotrieve]
23. Sluyter, R., and Wiley, J. S. (2002) Int. Immunol. 14, 1415–1421[Abstract/Free Full Text]
24. Georgiou, J. D., Skarratt, K. K., Fuller, S. J., Martin, C. J., Christopherson, R. I., Wiley, J. S., and Sluyter, R. (2005) J. Invest. Dermatol. 125, 482–490[CrossRef][Medline] [Order article via Infotrieve]
25. Di Virgilio, F., Bronte, V., Collavo, D., and Zanovello, P. (1989) J. Immunol. 143, 1955–1960[Abstract]
26. Ferrari, D., Los, M., Bauer, M. K. A., Vandenabeele, P., Wesselborg, S., and Schulze-Osthoff, K. (1999) FEBS Lett. 447, 71–75[CrossRef][Medline] [Order article via Infotrieve]
27. Humphreys, B. D., Rice, J., Kertesy, S. B., and Dubyak, G. R. (2000) J. Biol. Chem. 275, 26792–26798[Abstract/Free Full Text]
28. Coutinho-Silva, R., Persechini, P. M., Bisaggio, R. D., Perfettini, J. L., Neto, A. C., Kanellopoulos, J. M., Motta-Ly, I., Dautry-Varsat, A., and Ojcius, D. M. (1999) Am. J. Physiol. 276, C1139–C1147[Medline] [Order article via Infotrieve]
29. Rassendren, F., Buell, G. N., Virginio, C., Collo, G., North, R. A., and Surprenant, A. (1997) J. Biol. Chem. 272, 5482–5486[Abstract/Free Full Text]
30. Kahk, B. S. (2001) Nat. Rev. Neurosci. 2, 165–174[Medline] [Order article via Infotrieve]
31. Worthington, R. A., Smart, M. L., Gu, B. J., Williams, D. A., Petrou, S., Wiley, J. S., and Barden, J. A. (2002) FEBS Lett. 512, 43–46[CrossRef][Medline] [Order article via Infotrieve]
32. Gu, B. J., Sluyter, R., Skarratt, K. K., Shemon, A. N., Dao-Ung, L. P., Fuller, S. J., Barden, J. A., Clarke, A. L., Petrou, S., and Wiley, J. S. (2004) J. Biol. Chem. 279, 31287–31295[Abstract/Free Full Text]
33. Torres, G. E., Egan, T. M., and Voigt, M. M. (1999) J. Biol. Chem. 274, 6653–6659[Abstract/Free Full Text]
34. Smart, M. L., Gu, B. J., Panchal, R. G., Wiley, J. S., Cromer, B., Williams, D. A., and Petrou, S. (2003) J. Biol. Chem. 278, 8853–8860[Abstract/Free Full Text]
35. Gu, B. J., Zhang, W., Worthington, R. A., Sluyter, R., Dao-Ung, P., Petrou, S., Barden, J. A., and Wiley, J. S. (2001) J. Biol. Chem. 276, 11136–11142
36. Wiley, J. S., Dao-Ung, L. P., Li, C., Shemon, A. N., Gu, B. J., Smart, M. L., Fuller, S. J., Barden, J. A., Petrou, S., and Sluyter, R. (2003) J. Biol. Chem. 278, 17108–17113[Abstract/Free Full Text]
37. Skarratt, K. K., Fuller, S. J., Sluyter, R., Dao-Ung, L. P., Gu, B. J., and Wiley, J. S. (2005) FEBS Lett. 579, 2675–2678[CrossRef][Medline] [Order article via Infotrieve]
38. Feng, Y. H., Wang, L., Wang, Q., Li, X., Zeng, R., and Gorodeski, G. (2005) Am. J. Physiol. 288, C1342–C1356
39. Buell, G., Chessell, I. P., Michel, A. D., Colo, G., Salazzo, M., Herren, S., Gretener, D., Grahames, C., Kaur, R., Koscovilbois, M. H., and Humphrey, P. P. A. (1998) Blood 92, 3521–3528[Abstract/Free Full Text]
40. Gu, B. J., Zhang, W. Y., Bendall, L. J., Chessell, I. P., Buell, G. N., and Wiley, J. S. (2000) Am. J. Physiol. 279, C1189–C1197
41. Smart, M. L., Panchal, R. G., Bowser, D. N., Williams, D. A., and Petrou, S. (2002) Am. J. Physiol. 283, C77–C84
42. Petrou, S., Ugur, M., Drummond, R. M., Singer, J. J., and V. Walsh Jr., J. (1997) FEBS Lett. 411, 339–345[CrossRef][Medline] [Order article via Infotrieve]
43. Triccas, J. A., Berthet, F. X., Pelicic, V., and Gicquel, B. (1999) Microbiology 145, 2923–2930[Abstract/Free Full Text]
44. Buell, G., Talabot, F., Gos, A., Lorenz, J., Lai, E., Morris, M. A., and Antonarakis, S. E. (1998) Receptors Channels 5, 347–354[Medline] [Order article via Infotrieve]
45. Wiley, J. S., Gu, B. J., Zhang, W., Worthington, R. A., Dao-Ung, P., Shemon, A. N., Sluyter, R., Liang, S., and Barden, J. A. (2001) Drug Develop. Res. 53, 72–76[CrossRef]
46. Cabrini, G., Falzoni, S., Forchap, S. L., Pellegatti, P., Balboni, A., Agostini, P., Cuneo, A., Castoldi, G., Baricordi, O. R., and Di Virgilio, F. (2005) J. Immunol. 175, 82–89[Abstract/Free Full Text]
47. Dao-Ung, L. P., Fuller, S. J., Sluyter, R., Skarratt, K. K., Thunberg, U., Tobin, G., Byth, K., Ban, M., Rosenquist, R., Stewart, G. J., and Wiley, J. S. (2004) Br. J. Haematol. 125, 815–817[CrossRef][Medline] [Order article via Infotrieve]
48. Hickman, S. E., el Khoury, J., Greenberg, S., Schieren, I., and Silverstein, S. C. (1994) Blood 84, 2452–2456[Abstract/Free Full Text]
49. Gudipaty, L., Humphreys, B. D., Buell, G., and Dubyak, G. R. (2001) Am. J. Physiol. 280, C943–C953
50. Kuzmenkin, A., Jurkat-Rott, K., Lehmann-Horn, F., and Mitrovic, N. (2003) Pflug. Arch. Eur. J. Physiol. 447, 71–77[CrossRef][Medline] [Order article via Infotrieve]
51. Adriouch, S., Dox, C., Welge, V., Seman, M., Koch-Nolte, F., and Haag, F. (2002) J. Immunol. 169, 4108–4112[Abstract/Free Full Text]
52. Le Stunff, H., Auger, R., Kanellopoulos, J. M., and Raymond, M. N. (2004) J. Biol. Chem. 279, 16918–16926[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

G. Burnstock Unresolved issues and controversies in purinergic signalling J. Physiol., July 15, 2008; 586(14): 3307 - 3312.