Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M600579200 on August 4, 2006

J. Biol. Chem., Vol. 281, Issue 40, 29479-29490, October 6, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/40/29479    most recent
M600579200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, G.
Right arrow Articles by Mulder, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, G.
Right arrow Articles by Mulder, K. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Requirement of Smad3 and CREB-1 in Mediating Transforming Growth Factor-beta (TGFbeta) Induction of TGFbeta3 Secretion*

Guangming Liu, Wei Ding, Jill Neiman, and Kathleen M. Mulder1

From the Department of Pharmacology, Penn State College of Medicine, Hershey, Pennsylvania 17033

Received for publication, January 19, 2006 , and in revised form, August 2, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Because increased transforming growth factor-beta (TGFbeta) production by tumor cells contributes to cancer progression through paracrine mechanisms, identification of critical points that can be targeted to block TGFbeta production is important. Previous studies have identified the precise signaling components and promoter elements required for TGFbeta induction of TGFbeta1 expression in epithelial cells (Yue, J., and Mulder, K. M. (2000) J. Biol. Chem. 275, 30765–30773). To determine how regulation of TGFbeta3 expression differs from that of TGFbeta1, we identified the precise signaling pathways and transcription factor-binding sites that are required for TGFbeta3 gene expression. By using mutational analysis in electrophoresis mobility shift assays (EMSAs), we demonstrated that the c-AMP-responsive element (CRE) site in the TGFbeta3 promoter was required for TGFbeta-inducible TGFbeta3 expression. Electrophoresis mobility supershift assays indicated that CRE-binding protein 1 (CREB1) and Smad3 were the major components present in this TGFbeta-inducible complex. Furthermore, by using chromatin immunoprecipitation assays, we demonstrated that CREB-1, ATF-2, and c-Jun bound constitutively at the TGFbeta3 promoter (–100 to +1), whereas Smad3 bound at this site only after TGFbeta stimulation. In addition, inhibition of JNK and p38 suppressed TGFbeta induction of TGFbeta3 transactivation, whereas inhibition of ERK and protein kinase A had no effect. Small interfering RNA-CREB1 and small interfering RNA-Smad3 significantly inhibited TGFbeta stimulation of TGFbeta3 promoter reporter activity and TGFbeta3 production. Our results indicate that TGFbeta activation of the TGFbeta3 promoter CRE site, which leads to TGFbeta3 production, is required for TGFbetaRII, JNK, p38, and Smad3 but was independent of protein kinase A, ERK, and Smad4.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
TGFbeta2 is the prototype of a large superfamily of multifunctional cytokines that are differentially expressed and function in a wide range of target cells (1). TGFbeta suppresses the proliferation of normal cells. However, in malignant cells TGFbeta production often enhances tumor progression, especially once the cells have lost the negative growth control signals imparted by TGFbeta. Therefore, identification of critical points that can be targeted to block TGFbeta production in cancer cells is important (2, 3). A better understanding of the mechanisms underlying TGFbeta auto-regulated secretion will assist in the identification of these critical branch points.

The TGFbeta family has the following three homologous forms: TGFbeta1, TGFbeta2, and TGFbeta3. Although the three TGFbetas share 60–80% identity, they are encoded by distinct genes, and their expression is controlled by a different regulatory sequence or promoter (4–6). They also show different physiological and pathological activities in certain cell types and systems (7–17). Because the expression of TGFbeta is controlled by an auto-feedback loop (18), TGFbeta is an important mechanism for amplifying its own expression and production. Because of the critical role that TGFbeta plays in regulating a broad range of physiological and pathological effects, such as proliferation, cell cycle arrest, apoptosis, angiogenesis, metastasis, and invasiveness in cells and tissues, any changes in the signaling pathways mediating TGFbeta3 autoregulation may lead to severe abnormalities. It is therefore important to understand the mechanisms underlying TGFbeta autoregulation, as well as the signal transduction pathways mediating TGFbeta-induced TGFbeta3 expression.

The autoregulation of TGFbeta appears to be mediated through specific sites in the promoter regions of the distinct isoforms (19). Although these sites have been examined for the TGFbeta1 promoter (19), little is known about the relevant regions in the TGFbeta3 promoter. The promoter area of the TGFbeta3 gene has little structural or functional similarity to the TGFbeta1 promoter. Similarly, transcriptional regulation of this gene has significantly diverged from that of the other TGFbetas (6). It has been reported that a region proximal to the TATA box in the 5'-flanking region of the TGFbeta3 gene might be important in regulating TGFbeta3 expression (6), but no conclusive studies have defined the critical sites required for TGFbeta induction of TGFbeta3 expression.

Here we have determined that the TGFbeta-inducible region of the TGFbeta3 promoter contains three transcription factor binding consensus sites: a CRE at –45 to –39 (GACGTCA), an SBE at –49 to –46 (CAGA), and an activator protein-2 (AP-2) site at –57 to –50 (CCCCAGGC). We have investigated the transcriptional regulation of each of these TGFbeta3 gene promoter regions in response to TGFbeta exposure, and we have demonstrated that the CRE site is the critical site. We have also defined the signal transduction pathways mediating TGFbeta induction of TGFbeta3 secretion, and we demonstrate that Smad3 and CREB-1 are the critical transcription factors involved. Although we have shown previously that JNKs and ERKs were the critical mediators of TGFbeta1 production in untransformed epithelial cells (19), here we show that JNKs and p38, but not PKA and ERKs, are the critical upstream mediators of TGFbeta3 production. Our studies provide new insights into the TGFbeta auto-feedback regulatory mechanisms that are required for one of the key biological responses to TGFbeta, namely stimulation of its own secretion. In this case, however, the results are specific for production of TGFbeta3. Furthermore, our results demonstrate that blocking these critical points reduces TGFbeta3 production, and as such, our findings suggest important intervention strategies for controlling tumor growth mediated by excessive tumor cell-secreted TGFbeta3 in the tumor microenvironment.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—The untransformed rat intestinal epithelial cell line 4-1 (IEC4-1, TGFbeta-sensitive) was isolated as described previously (20, 21). Cells were routinely maintained in SMIGS medium, consisting of McCoy's 5A (Invitrogen), supplemented with amino acids, pyruvate, antibiotics (streptomycin, penicillin), insulin (4 µg/ml), glucose (4.5 mg/ml), and 5% fetal bovine serum. IEC4-1 cells, stably transfected with dominant-negative TGFbetaRII (DN RII) and empty vector, were prepared as described previously (22). The transfectants were maintained in SMIGS medium in the presence of 5 µg/ml blasticidin, as a selection marker. CCL64-L20 and CCL64-Smad3C mink lung epithelial cells and human HaCaT cells were routinely maintained in Dulbecco's modified Eagle's medium plus 10% fetal bovine serum as described previously (19, 23).

Electrophoretic Mobility Shift Assays (EMSAs)—EMSAs were performed as described (24). Nuclear protein extracts were prepared from either IEC4-1 or CCL64 cells by a method described previously (24). Briefly, the cells were cultured in 10-cm dishes and treated with TGFbeta3 (10 ng/ml) for 1 h. The cells were then disrupted in 500 µl of lysis buffer A (25 mM HEPES (pH 7.8), 50 mM KCl, 0.5% Nonidet P-40, 100 µM dithiothreitol, 10 µg/ml leupeptin, 25 µg/ml aprotinin, and 1 mM phenylmethylsulfonyl fluoride). After a 1-min centrifugation (16,000 x g, 4 °C), the pellet containing the nuclei was washed once with 500 µl of buffer B (buffer A without Nonidet P-40), resuspended in 120 µl of extraction buffer (buffer B but with 500 mM KCl and 10% glycerol), and incubated with shaking at 4 °C for 30 min. The nuclear extracts were stored at –70 °C until analysis. The DNA binding reaction (for EMSA) was carried out at room temperature for 30 min in a mixture containing 4 µg of nuclear protein, 1 µg of poly(dI-dC), and 15,000 cpm of 32P-labeled double-stranded oligonucleotide. The samples were fractionated through a 5% polyacrylamide gel. Gels were dried and exposed to x-ray film for further analysis.

The oligonucleotides used for probe labeling were as follows: Tbeta3-P61/35, –61CCCACCCCAGGCCAGAGACGTCATGGG–35; mutated AP-2 in Tbeta3-P61/35, –61CCCACCCtcaGCCAGAGACGTCATGGG–35; mutated SBE in Tbeta3-P61/35, –61CCCACCCCAGGCCgtAGACGTCATGGG–35; mutated CRE in Tbeta3-P61/35, –61CCCACCCCAGGCCAGAGACactATGGG–35; TGFbeta 2/E-Box promoter –59 to –35 motif, –59GAAGGCAGACACGTGGTTCAGAGAG–35; SBE consensus binding motif GTCTAGAC. The SBE consensus oligonucleotide was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). All other oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA). Electrophoretic mobility supershift assays were performed by preincubating 4 µg of nuclear protein with 4 µg of the relevant specific antibody against CREB (Santa Cruz Biotechnology), Smad3 (Zymed Laboratories Inc.), or Smad4 (Santa Cruz Biotechnology), or control normal rabbit IgG (Santa Cruz Biotechnology) at 4 °C for 2 h and then processing the samples as described above. The gels were dried and exposed to x-ray film. Densitometry analyses were performed for all EMSAs to confirm the significance of the differences indicated.

Chromatin Immunoprecipitation (ChIP) Assays—ChIP assays (25, 26) were performed using the ChIP assay kit from Upstate%20Biotechnology">Upstate Biotechnology, Inc. (Lake Placid, NY). In brief, HaCaT cells were incubated in the absence or presence of TGFbeta3 (10 ng/ml) for 1 h. The cells were then cross-linked with formaldehyde. Nuclear extracts were sonicated to obtain ~250-bp fragments of DNA. The resulting DNA was immunoprecipitated overnight with antibodies to CREB-1, CREB-2, ATF-2, c-Jun, JunD, Smad3, or Smad4 (Santa Cruz Biotechnology) and salmon sperm/agarose beads (catalog number 16-157; Upstate%20Biotechnology">Upstate Biotechnology, Inc.). The resulting DNA sample incubated with IgG or with no antibody was used as a negative control. The supernatant from a sample was used as total DNA input. The DNA was dissolved in 30µl of water, and 2µl was employed for PCR analysis using the primers for the TGFbeta3 promoter region containing AP-2, SBE, and CRE sites (5'-GTGCAGCAAAAGAGGCTGCGTGCG-3' and 5'-TCTATTTCTCTCTGCTGAAAT-3'). The products were resolved in a 3% agarose gel and visualized with ethidium bromide.

siRNA Transfections—siRNA-CREB-1 was purchased from Santa Cruz Biotechnology. siRNA-Smad3 was purchased from Cellogenetics, Inc. (Baltimore). The siRNA products were annealed duplexes of RNA. Transfection of siRNAs into cells was performed according to the manufacturer's instructions. A nontargeting siRNA was used as a control for nonsequence-specific effects of the transfected siRNAs (Dharmacon, Inc., Dallas).

Construction of TGFbeta3 Promoter Luciferase Reporter Plasmid—The Tbeta3-P221/110-Luc encodes a TGFbeta3 promoter region from –221 to +110. The nucleotide sequence was PCR-amplified. The primers used were as follows: sense, 5'-actcgaACGCGTtgtggcaggagtgattccaaga-3' (the capital letters indicate an MluI restrict enzyme digestion site), and antisense, 5'-gcacgcAGATCTcttggacttgactctctgctcc-3' (the capital letters indicate a BglII restrict enzyme digestion site). The PCR products and the basic pGL3 luciferase reporter vector (Promega, Madison, WI) were digested using MluI and BglII, and the products were gel-purified and inserted into the vector using Quick Ligase (New England Biolabs, Beverly, MA). The sequence of the resulting Tbeta3-P221/110-Luc luciferase reporter plasmid was confirmed by sequencing in both directions. The CRE-mutated Tbeta3-P221/110-Luc luciferase reporter plasmid (Mut-Tbeta3-P221/110-Luc) was constructed using QuikChange® site-directed mutagenesis kit (Stratagene, La Jolla, CA). The primers used were as follows: sense, 5'-CCACCCCAGGCCAGAGACactATGGGAGGGAGGTATA-3', and antisense, 5'-TATACCTCCCTCCCATagtGTCTCTGGCCTGGGGTGG-3' (the lowercase letters indicate mutated CRE site).

Luciferase Reporter Assays—IEC4-1 and CCL64 cells were seeded in 24-well plates and grown to 70–80% confluence. Cells were transfected with 0.4 µg of Tbeta3-P221/110-Luc, siRNA plasmids at the indicated concentrations, and 0.1 µg of Renilla luciferase control reporter (pRL-SV40) per well, using LipofectamineTM 2000 (Invitrogen), as described in the user manual. TGFbeta3 (10 ng/ml) was added 24 h after transfections, and luciferase activities were measured at 24 h after TGFbeta3 treatment. Transfection efficiencies were determined by co-transfecting with Renilla luciferase. IEC4-1 cells were also co-transfected with Tbeta3-P221/110-Luc and a dominant-negative Smad4 plasmid (19) at the concentrations indicated.

Real Time Quantitative RT-PCR—RNA was isolated from HaCaT cells and their siRNA-CREB-1 and siRNA-Smad3 transfectants as described above using TRIzol reagent by Invitrogen. Total cDNA was prepared by RT-PCR using random hexamer primers purchased from Invitrogen and the isolated RNA as the template. Real time RT-PCR was performed using SYBR Green I agent from Qiagen Inc. (Valencia, CA), with the cDNA prepared above as the template. 18 S rRNA was used as an internal control. The TGFbeta3 primers used were as follows: sense, 5'-TGTGTGCGCCCCCTCTA-3'; antisense, 5'-GGTTCATGGACCCACTTCCA-3'.

Quantitation of TGFbeta3—The quantitative determination of TGFbeta3 was performed. IEC4-1 cells, and their siRNA-CREB-1 or siRNA-Smad3 transfectants, were seeded in 12-well plates and grown in the absence or presence of TGFbeta1 for 72 h. Conditioned medium (CM) was then collected for quantitative determination of TGFbeta3 using an ELISA kit (DuoSet ELISA Development System, R&D Systems, Inc., Minneapolis, MN). The system specifically detects TGFbeta3 with no cross-reactivity or interference with TGFbeta1. The cells were trypsinized and counted. "Total" TGFbeta3 was quantitated according to the manufacturer's instructions. Briefly, the samples were acid-activated using 1 N HCl to activate latent TGFbeta3 and then neutralized by addition of 1.2 N NaOH, 0.5 M HEPES solution to convert all TGFbeta3 to the form detectable using the antibody in the ELISA kit.

Western Blotting—IEC4-1 cells were transfected with the siRNA plasmids indicated, and the cells were lysed and prepared 36 h after transfection. Western blotting for CREB-1, Smad3, and phosphorylated CREB-1 proteins was carried out using specific antibodies, according to the supplier's recommendations. Anti-CREB-1 antibody (9192) and anti-phospho-CREB-1 antibody (9191) were from Cell Signaling Technology (Beverly, MA). Anti-Smad3 antibody (51-1500) was Zymed Laboratories Inc.

Statistical Analysis—Data were analyzed and statistically significant differences determined using the Student's t test. The results are expressed as the mean ± S.E.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
The CRE Consensus Site in Tbeta3-P61/35 Is Critical for TGFbeta3 Responsiveness—It has been reported that a sequence from –490 to +100 in the 5'-flanking region of the TGFbeta3 gene might be important in regulating TGFbeta3 expression (6). This region contains two ubiquitously expressed Sp-1 transcription factor DNA-binding sites (–420 to –415 and –363 to –358), an AP-2 site (–57 to –50), and a CRE site (–45 to –39). The CRE site has been shown to be involved in TGFbeta3 transcription, although its TGFbeta-inducible expression was not examined (6). In addition to the AP-2 and CRE sites, we also identified an SBE site (–49 to –46), between the AP-2 and CRE sites, which can also be induced by TGFbeta (27). We presumed that the SBE and/or CRE sites, but not the Sp-1 sites, in the TGFbeta3 promoter region might be important for TGFbeta induction of TGFbeta3 gene expression because Sp-1 has relatively little effect on the activation of the promoter (6). To address this issue, we constructed a Tbeta3-P221/110-Luc luciferase reporter plasmid using the DNA sequence from the TGFbeta3 5'-flanking region (–221 to +110) of the promoter. This sequence contains the AP-2, SBE, and CRE sites. We treated IEC4-1 cells with TGFbeta to stimulate the auto-induction loop, and we measured Tbeta3-P221/110-Luc reporter activity. Here we show that TGFbeta affected a time-dependent increase in Tbeta3-P221/110-Luc activity. The TGFbeta stimulation of Tbeta3-P221/110-Luc activity reached a peak 24 h after TGFbeta3 treatment (Fig. 1A). These results indicate that Tbeta3-P221/110 is important in TGFbeta auto-induction of TGFbeta3 gene transcription.

The IEC4-1 cells were used for these studies because they represent a good model for TGFbeta regulation in untransformed epithelial cells because of their high level of TGFbeta sensitivity and their well characterized TGFbeta pathways (21, 22, 28, 29). In addition, these cells have been shown to produce high levels of endogenous TGFbeta (20).

To determine whether the AP-2 (–57 to –50), SBE (–49 to –46), and/or CRE (–45 to –39) sites within the –221 to +110 region of the TGFbeta3 promoter were involved in TGFbeta induction of TGFbeta3 gene transcription, we examined the DNA binding activity of a sequence containing these three sites (Tbeta3-P61/35) in response to TGFbeta3. As shown in Fig. 1B, TGFbeta significantly increased complex formation at Tbeta3-P61/35 in a time-dependent manner, with peak levels occurring 1 h after TGFbeta treatment. Thus, our results indicate that a TGFbeta-inducible complex formed at Tbeta3-P61/35 in response to TGFbeta treatment.

During the TGFbeta signaling process, TGFbeta binds to RII, which then recruits RI into the active complex (30). To investigate whether the TGFbeta receptors were required for auto-regulation of TGFbeta3 expression, we performed EMSAs with Tbeta3-P61/35 after expression of a dominant-negative TGFbeta receptor II (DN RII) (22). As shown in Fig. 2A, the Tbeta3-P61/35 DNA binding activity stimulated by either TGFbeta1 or TGFbeta3 was significantly suppressed in the DN RII-expressing IEC4-1 cells (Fig. 2A, lanes 6 and 7 versus lanes 2 and 3). In contrast, DN RII had no effect in the PMA-induced cells (Fig. 2A, lane 8 versus lane 4). These results indicate that RII is required for TGFbeta3 auto-loop regulation.


Figure 1
View larger version (51K):
[in this window]
[in a new window]
  		FIGURE 1.
TGFbeta increases Tbeta3-P221/110-Luc activity and induces DNA binding at Tbeta3-P61/35. A, IEC4-1 cells were seeded in 24-well plates and grown to 70–80% confluence. Cells were transfected with 0.4 µg of Tbeta3-P221/110-Luc and 0.1 µgof Renilla luciferase control reporter (pRL-SV40) per well using LipofectamineTM 2000 (Invitrogen), as described in the user manual. 24 h after transfection, the cells of the TGFbeta3 group were exposed to TGFbeta3 (10 ng/ml), whereas the control group was not treated. The cells were harvested at the time points indicated, and luciferase assays were performed as described under the "Materials and Methods." Data are plotted as mean ± S.E. of triplicate samples for each of three independent experiments. Numbers on top of each bar indicate the fold increase compared with control. B, IEC4-1 cells were incubated in the absence or presence of TGFbeta3 (10 ng/ml). Nuclear protein was harvested at the time points indicated, and EMSAs were performed as described under the "Materials and Methods." The arrow indicates the relevant DNA binding complex. Three independent experiments were performed, and representative figures are shown.

 
To determine which DNA-binding sites are required for TGFbeta3 production, we performed site-directed mutagenesis at the relevant sites, and we then repeated the EMSAs using labeled versions of these as probes. As shown in Fig. 2B, mutation of the CRE site completely abolished DNA binding activity at Tbeta3-P61/35 (lanes 10–12), whereas mutation of the AP-2 (lanes 4–6) or SBE (lanes 7–9) sites had no effect. The TGFbeta-inducible complex formed at the wild-type Tbeta3-P61/35 is shown for comparison (Fig. 2B, lanes 2 and 3). These results indicate that DNA binding activity at the CRE site is critical for mediating the TGFbeta3 auto-induction loop. As shown in Fig. 2B (lanes 1, 4, 8, and 10), a 10-fold excess of unlabeled probe completely competed for DNA binding of the radioisotope-labeled probe, indicating that the bands observed represented specific binding to Tbeta3-P61/35.

To further confirm that the CRE site in the TGFbeta3 promoter is indeed required for the TGFbeta3 gene transcription, we constructed Mut-Tbeta3-P221/110-Luc, a CRE site-mutated Tbeta3-P221/110-Luc luciferase reporter plasmid. We transfected IEC4-1 cells with Mut-Tbeta3-P221/110-Luc, followed by treatment of the IEC4-1 transfectants with TGFbeta. As shown in Fig. 2C, CRE mutation completely abolished the luciferase activity induced by TGFbeta. This result confirms that this CRE site in the TGFbeta3 promoter region is critical for TGFbeta3 gene transcription.

CREB-1 and Smad3, but Not Smad4, Are Bound at the Tbeta3-P61/35—It is known that CREB-1 can recognize and bind to CRE consensus sites in various gene promoters. As we have demonstrated that the CRE site in Tbeta3-P61/35 is critical for TGFbeta auto-induction of TGFbeta3, we examined whether the CREB-1 protein was a component in the transcription factor complex bound at this Tbeta3-P61/35. As shown in Fig. 3A by EMSAs, TGFbeta-inducible complex formation (lanes 1 and 2) was reduced when the CREB-1 antibody was present (lane 4) but not when rabbit IgG was present (lane 3). A supershift was also observed using the CREB-1 antibody (Fig. 3A, lane 4). Thus, CREB-1 was in the transcription factor complex bound to the Tbeta3-P61/35 region.

We further explored whether Smad3 and Smad4 might be present in the complex at Tbeta3-P61/35, because Smads are known to play important roles in TGFbeta3 signaling and because an SBE site is present in Tbeta3-P61/35. As shown in Fig. 3A, lane 5, the anti-Smad3 antibody reduced the TGFbeta-inducible DNA binding, indicating that Smad3 was present in the transcription factor complex bound to Tbeta3-P61/35. This did not occur when phorbol myristate acetate was used as the inducer (data not shown). Because activated Smad2 or Smad3 can form a dimer with Smad4 prior to stimulation of transcriptional activation of target genes through SBE sites, it was of interest to determine whether Smad4 was also in this complex bound to Tbeta3-P61/35. As shown in Fig. 3A, lane 6, the anti-Smad4 antibody had no effect on DNA binding of Tbeta3-P61/35, suggesting that Smad4 may not be involved in the transcription factor complex bound to Tbeta3-P61/35. To verify the specificity of the anti-Smad3 and anti-Smad4 antibodies used, a full palindromic SBE sequence was used in the supershift EMSAs. As shown in Fig. 3B, a 10-fold excess of unlabeled cold probe completely competed for TGFbeta induction of the DNA binding of the radioisotope-labeled probe, indicating that the band observed was specific for the consensus palindromic SBE site (lane 1). Both Smad3 and Smad4 were present in the transcription factor complex bound to the consensus SBE site (Fig. 3A, lanes 5 and 6). The results in Fig. 3A, lane 2, indicate that in the absence of TGFbeta, there was no binding to the consensus palindromic SBE site in IEC4-1 cells, whereas TGFbeta could induce DNA binding at this site, as shown in lane 3 (Fig. 3B). As shown in Fig. 3B (lane 4), addition of rabbit IgG in the EMSAs had no effect on TGFbeta induction of DNA binding at the consensus palindromic SBE site. Overall, our results indicate that the anti-Smad3 and anti-Smad4 antibodies used (Fig. 3A) were capable of competing effectively for DNA binding at the consensus SBE site in the EMSA supershift assays.

Smad3 Is Bound at the Tbeta3-P61/35 Only in Response to TGFbeta Stimulation—Because we have demonstrated that both CREB-1 and Smad3 were required for DNA binding at Tbeta3-P61/35 in response to TGFbeta treatment, we performed ChIP analyses to confirm these findings, as well as to explore which other potential transcription factors bind to this TGFbeta3 promoter region. It has been reported that CREB-1, ATF-2, and c-Jun are able to bind to consensus CREs (20, 31, 32). In addition, CREB-2 is a member of the CREB family, and JunD is a close homologue of c-Jun, but it was not clear whether these transcription factors were effective in TGFbeta induction of DNA binding at the CRE site in the TGFbeta3 promoter (–45 to –39). Therefore, we examined whether CREB-1, CREB-2, ATF-2, c-Jun, JunD, Smad3, and/or Smad4 could bind to this TGFbeta3 promoter region (–45 to –39). To determine the transcription factors bound to the endogenous TGFbeta3 promoter, we performed ChIP analyses using noncancerous TGFbeta-responsive HaCaT human keratinocytes. As shown in Fig. 3C, in the absence of TGFbeta, the transcription factors that bound to the CRE site in the TGFbeta3 promoter (–45 to –39) were CREB-1, ATF-2, and c-Jun. In contrast, CREB-2, JunD, Smad3, and Smad4 were not present in the complex bound to this CRE site under these conditions (Fig. 3C, upper panel). After addition of TGFbeta, however, the DNA binding activity of CREB-1 and ATF-2, but not that of c-Jun, was increased (Fig. 3C, lower panel). Most significantly, Smad3 was detectable in the complex bound at the CRE site in the TGFbeta3 promoter (–45 to –39) only in response to TGFbeta treatment (Fig. 3C, lower panel). Thus, although CREB-1, ATF-2, and c-Jun all bound constitutively to the CRE site in the TGFbeta3 promoter (–45 to –39), CREB-1 and ATF-2 binding was also inducible by TGFbeta, and Smad3 only bound to the TGFbeta3 promoter CRE after TGFbeta treatment. These results suggest that Smad3, as well as the CREB/ATF family members CREB-1 and ATF-2, may play a role in TGFbeta induction of TGFbeta3 promoter DNA binding activity.


Figure 2
View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 2.
DN RII and the CRE site in Tbeta3-P61/35 are required for TGFbeta3 induction of DNA complex formation at Tbeta3-P61/35. A, IEC4-1 DN RII cells were incubated in the absence or presence of TGFbeta1 or TGFbeta3 (10 ng/ml) or PMA (100 ng/ml) for 1 h. Nuclear extracts were subjected to EMSAs using Tbeta3-P61/35 as the probe as described under the "Materials and Methods." Three independent experiments were performed, and representative figures are shown. B, IEC4-1 cells were incubated in the absence or presence of TGFbeta3 (10 ng/ml), and EMSAs were performed as described under "Materials and Methods." The probes used for wild-type (wt), mutated AP-2 (mAP-2), mutated SBE (mSBE), and mutated CRE (mCRE) of the Tbeta3-P61/35 were described under the "Materials and Methods." A 10-fold excess of unlabeled Tbeta3-P61/35 (cold probe) competed with TGFbeta-inducible Tbeta3-P61/35 DNA binding (lanes 1, 4, 7, and 10). TGFbeta3-inducible DNA binding to the TGFbeta3 promoter was abolished when mCRE was used as the probe (lanes 10–12) but not when mAP-2 (lane 4–6) or mSBE (lanes 7–9) was used as probes. Three independent experiments were carried out and representative figures are shown. C, IEC4-1 cells were seeded in 24-well plates and grown to 70–80% confluence. Cells were transfected with 0.4 µg of Tbeta3-P221/110-Luc or Mut-Tbeta3-P221/110-Luc and 0.1 µg of Renilla luciferase control reporter (pRL-SV40) per well using LipofectamineTM 2000 (Invitrogen), as described in the user manual. 24 h after transfection, the cells of the TGFbeta3 group were exposed to TGFbeta3 (10 ng/ml), whereas the control group was not treated. The cells were harvested another 24 h later, and luciferase assays were performed as described under the "Materials and Methods." Data are plotted as mean ± S.E. of triplicate samples for each of three independent experiments.

 
Smad3 Is Required for TGFbeta Induction of TGFbeta3 Promoter DNA Binding Activity—We have demonstrated above that Smad3 is present in the transcription factor complex bound to Tbeta3-P61/35 after induction by TGFbeta. Because there is an SBE site upstream of the CRE site in Tbeta3-P61/35, which was not required for TGFbeta-inducible DNA binding to Tbeta3-P61/35 (Fig. 2B), we employed CCL64-Smad3C cells, and their parental CCL64-L20 cells, in order to confirm whether Smad3 was required for TGFbeta-inducible complex formation at the Tbeta3-P61/35. CCL64-Smad3C cells stably express a dominant-negative form of Smad3 (33). In this cell line, TGFbeta is unable to induce phosphorylation of Smad3, and the inhibitory effect of TGFbeta on cell growth is blocked (33). Thus, normal Smad3 function in this cell line is lost. As shown in Fig. 4A by EMSAs, TGFbeta induction of complex formation at Tbeta3-P61/35 was blocked in the CCL64-Smad3C cells, compared with control L20 cells (lane 5 versus lane 2). In contrast, the PMA-induced complex formation at Tbeta3-P61/35 was not diminished, when compared with control L20 cells (Fig. 4A, lane 6 versus lane 3). Thus, Smad3 is required for TGFbeta induction of DNA binding at the CRE site of the TGFbeta3 promoter region.

We also examined TGFbeta induction of Tbeta3-P221/110-Luc luciferase activity after transfection of L20 or Smad3C cells with Tbeta3-P221/110-Luc. As shown in Fig. 4B, TGFbeta induced a 5.9-fold increase of Tbeta3-P221/110-Luc luciferase activity in the L20 cells, but only a 1.6-fold increase in the Smad3C cells. Statistic analyses indicated a significant difference between the fold changes of the two cell groups (p < 0.01). Collectively, our results demonstrate that Smad3 not only binds to Tbeta3-P61/35 but is also functionally required for TGFbeta3 autoregulation.


Figure 3
View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 3.
CREB-1 and Smad3 are the primary components present in the transcription factor complex binding at Tbeta3-P61/35. Nuclear protein was extracted from IEC4-1 cells, and EMSA supershift assays using the antibodies (Ab) indicated were performed as described under the "Materials and Methods." A, cells were incubated in the absence or presence of TGFbeta3 (10 ng/ml). The probe used was Tbeta3-P61/35, and the arrow indicates the supershifted band. B, cells were incubated in the absence or presence of TGFbeta3 (10 ng/ml). The probe used was the full palindromic SBE sequence as described under the "Materials and Methods." C, ChIP assays were performed as described under the "Materials and Methods." The antibodies indicated were incubated with cross-linked DNA isolated from HaCaT cells that had been treated in the absence (upper panel) or presence (lower panel) of TGFbeta. The TGFbeta3 promoter region –100 to +1 was amplified using the template ChIP DNA obtained with the antibodies indicated.

 
Because Smad4 plays an important role in mediating Smad-dependent TGFbeta responses, usually by forming dimers with Smad3 or Smad2, it was conceivable that Smad4 might be involved in the TGFbeta induction of Tbeta3-P221/110-Luc luciferase activity. Accordingly, we co-transfected a DN-Smad4 plasmid with Tbeta3-P221/110-Luc into IEC4-1 cells. As shown in Fig. 4C, DN-Smad4 expression did not block Tbeta3-P221/110-Luc activity either in the absence or presence of TGFbeta. Thus, Smad4 is not required for TGFbeta induction of Tbeta3-P221/110-Luc luciferase activity, suggesting that Smad4 is not required for the TGFbeta induction of TGFbeta3 transcription mediated through Smad3.

JNK and p38, but Not PKA or the ERKs, Are Required for TGFbeta3 Autoregulation—We have demonstrated previously that TGFbeta induction of DNA binding to Tbeta3-P61/35 occurs through the TGFbeta receptors (Fig. 2A). Accordingly, it was of interest to explore whether downstream signaling events were also involved in TGFbeta induction of TGFbeta3 transcription. Furthermore, it is known that mitogen-activated protein kinases (MAPKs) and PKA are upstream kinases of CREB-1 (34–36). Upon activation, these kinases translocate to the nucleus where they phosphorylate CREB-1 and initiate its DNA binding to the consensus CRE site. To determine whether JNK, ERK, p38, or PKA were required for TGFbeta3 auto-regulation, we employed the following specific inhibitors: SP600125 as a selective JNK inhibitor, SB203580 as a selective p38 inhibitor, PD98059 as a selective MEK inhibitor, and H89 as a selective inhibitor of PKA. Our results indicate that SP600125 and SB203580 effectively suppressed TGFbeta induction of Tbeta3-P61/35 DNA binding activity (Fig. 5A) and transactivation (Fig. 5B) in a dose-dependent manner. However, PD98059 affected neither DNA binding to Tbeta3-P61/35 nor Tbeta3-P221/110-Luc activity (Fig. 5, A and B) at concentrations previously demonstrated to be effective in blocking TGFbeta activation of ERKs in IEC4-1 cells (37). All three inhibitors had little effect on basal Tbeta3-P61/35 DNA binding activity (data not shown).

Most unexpectedly, H89 (10 µM) had no effect on either DNA binding to Tbeta3-P61/35 or Tbeta3-P221/110-Luc luciferase activity, either in the absence or presence of TGFbeta (Fig. 5, C and D). H89 has been shown previously to be effective in selectively blocking PKA in several cell types over the concentration range of 5–20 µM (38–42). Thus, a concentration of 10 µM H89 would be expected to completely block PKA activity in our system. Therefore, our results suggest that the signaling pathways mediating TGFbeta3 auto-regulation are independent of PKA. siRNA-CREB-1 and siRNA-Smad3 Both Suppress TGFbeta Induction of Tbeta3-P61/35 DNA Binding and Tbeta3-P221/110-Luc Luciferase Activity—Because we have shown that CREB-1 and Smad3 were both present in the complex at Tbeta3-P61/35, it was of interest to confirm our results using siRNA-CREB-1 and siRNA-Smad3 transfectants in the EMSA and luciferase reporter experiments. Commercially available double-stranded siRNA was purchased and transfected into IEC4-1 cells to block target gene protein expression. As shown in Fig. 6A, both CREB-1 and Smad3 were detectable using either an anti-CREB-1 (lane 1, 1st panel) or an anti-Smad3 antibody (lane 1, 3rd panel). Fig. 6A, lane 2 of the 1st and 3rd panels, indicates that the scrambled control siRNAs had no effect on expression levels of either CREB-1 (lane 2, 1st panel) or Smad3 (lane 2, 3rd panel). Fig. 6A (lane 3, 1st panel) also indicates that the expression levels of CREB-1 in IEC4-1 cells transfected with siRNA-CREB-1 were significantly suppressed compared with untransfected IEC4-1 cells (Fig. 6A, lane 1) or to IEC4-1 cells transfected with the scrambled control siRNA (lane 2). In contrast, as expected, siRNA-Smad3 did not suppress CREB-1 levels (Fig. 6A, lane 4, panel 1). Fig. 6A (lane 3) also demonstrates that siRNA-Smad3 completely blocked Smad3 expression (lane 4), whereas siRNA-CREB-1 (lane 3) was ineffective. beta-Actin was used as a loading control (Fig. 6A, 2nd and 4th panels). Thus, siRNA-CREB-1 and siRNA-Smad3 could effectively block the expression of their respective target proteins.


Figure 4
View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 4.
Smad3 is required for TGFbeta induction of Tbeta3-P61/35 DNA binding and Tbeta3-P221/110-Luc luciferase reporter activity. A, CCL64 L20 or CCL64 Smad3C cells were incubated in the absence or presence of TGFbeta3 (10 ng/ml) or PMA (100 ng/ml) for 1 h. Nuclear protein was harvested, and EMSAs were performed as described under the "Materials and Methods." Three independent experiments were performed, and representative figures are shown. B, CCL64 L20 or CCL64 Smad3C cells were transfected with Tbeta3-P221/110-Luc. 24 h after transfection, the cells in the TGFbeta3 group were exposed to TGFbeta3 (10 ng/ml), whereas the control group was not treated. The cells were harvested after an additional 24 h, and luciferase assays were performed as described under the "Materials and Methods." Data are plotted as the mean ± S.E. of triplicate samples for each of three independent experiments. Numbers on top of each bar indicate the fold increase compared with control. C, IEC4-1 cells were co-transfected with Tbeta3-P221/110-Luc and DN-Smad4. 24 h after transfection, the cells in the TGFbeta3 group were exposed to TGFbeta3 (10 ng/ml), whereas the control group was not treated. The cells were harvested after an additional 24 h, and luciferase assays were performed as described under the "Materials and Methods." EV, empty vector. Data are plotted as the mean ± S.E. of triplicate samples for each of three independent experiments. Numbers on top of each bar indicate the fold increase compared with control.

 
CREB-1 is activated by phosphorylation at Ser-133, which is critical for its biological function. Although we have demonstrated that siRNA-CREB-1 effectively suppressed CREB-1 protein expression (Fig. 6A), it was of interest to further investigate whether siRNA-CREB-1 suppressed TGFbeta induction of CREB-1 phosphorylation specifically at Ser-133. Accordingly, we incubated IEC4-1 cells and their respective transfectants with or without TGFbeta and performed Western immunoblotting by using an antibody specific for the activated form of phospho-CREB-1 (Fig. 6B, upper panel). As shown in Fig. 6B, siRNA-CREB-1 significantly blocked both basal and TGFbeta-induced phosphorylation of CREB-1 at Ser-133. Densitometric scanning of the phospho-CREB-1 bands from Western analysis demonstrated that TGFbeta could induce a 3-fold increase in phosphorylation of CREB-1 in IEC4-1 cells or IEC4-1 cells transfected with the siRNA control (Fig. 6B, lower panel). However, TGFbeta only induced a 1.4-fold increase of phosphorylation in CREB-1 in IEC4-1 cells transfected with siRNA-CREB-1, indicating that siRNA-CREB-1 suppressed TGFbeta induction of phosphorylation of the protein. Interestingly, siRNA-Smad3 also suppressed TGFbeta induction of CREB-1 phosphorylation, with only a 1.6-fold increase being observed. Thus, Smad3 might also be involved in the pathway mediating TGFbeta induction of CREB-1 phosphorylation.

As we have demonstrated that both CREB-1 and Smad3 are involved in the transcription factor complex formed at the CRE site in Tbeta3-P61/35 in response to TGFbeta treatment, we performed EMSAs using siRNA-CREB-1 and siRNA-Smad3 to examine whether CREB-1 and Smad3 were required for DNA binding at Tbeta3-P61/35. As shown in Fig. 6C, TGFbeta induced an increase in DNA binding at Tbeta3-P61/35 in both control IEC4-1 cells (lane 5 versus lane 1) and IEC4-1 cells transfected with the siRNA scrambled control (lane 6 versus lane 2). siRNA-CREB-1 or siRNA-Smad3 significantly blocked TGFbeta induction of Tbeta3-P61/35 DNA binding activity (Fig. 6C, lane 7 versus 3 and lane 8 versus 4), indicating that both CREB-1 and Smad3 were required for the DNA binding at Tbeta3-P61/35. These results were confirmed by quantitative analyses of the bands using densitometry (data not shown). siRNA-CREB-1 also repressed basal levels of Tbeta3-P61/35 DNA binding activity (Fig. 6C, lane 3 versus 2), which is consistent with the results shown in Fig. 6B, indicating that siRNA-CREB-1 also inhibited basal levels of phospho-CREB-1. Thus, both CREB-1 and Smad3 were required for TGFbeta induction of Tbeta3-P61/35 DNA binding activity.


Figure 5
View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 5.
JNKs and p38, but not PKA or ERKs, are required for TGFbeta induction of Tbeta3-P61/35 DNA binding and Tbeta3-P221/110-Luc luciferase reporter activity. A, IEC4-1 cells were pretreated with either SB203580, PD98059, or SP600125 (Calbiochem) at the concentrations indicated for 30 min. Cells were then incubated in the absence or presence of TGFbeta3 (10 ng/ml) for 1 h. Nuclear protein was harvested, and EMSAs were performed as described under the "Materials and Methods." Three independent experiments were performed, and a representative figure is shown. B, IEC4-1 cells were transfected with Tbeta3-P221/110-Luc. 24 h after transfection, the cells were pretreated with either SB203580, PD98059, or SP600125 at the concentrations indicated for 30 min and then incubated in the absence or presence of TGFbeta3 (10 ng/ml) for an additional 24 h. The cells were harvested, and luciferase assays were performed as described under the "Materials and Methods." Data plotted are the mean ± S.E. of triplicate samples from one of three independent experiments. Asterisks indicate a statistically significant difference (p < 0.05) in the fold changes between the absence and presence of TGFbeta in the inhibitor-treated IEC4-1 cells compared with the control IEC4-1 cells (no inhibitors). C, IEC4-1 cells were pretreated with H89 at the concentrations indicated for 30 min and were then incubated in the absence or presence of TGFbeta3 (10 ng/ml) for 1 h. Nuclear protein was harvested, and EMSAs were performed as described under the "Materials and Methods." Three independent experiments were performed, and a representative figure is shown. D, IEC4-1 cells were transfected with Tbeta3-P221/110-Luc. 24 h after transfection, the cells were pretreated with H89 at the concentrations indicated for 30 min and were then incubated in the absence or presence of TGFbeta3 (10 ng/ml) for an additional 24 h. The cells were harvested, and luciferase assays were performed as described under the "Materials and Methods." Data plotted are the mean ± S.E. of triplicate samples from one of three independent experiments.

 
Because we have demonstrated that both CREB-1 and Smad3 were required for DNA binding at Tbeta3-P61/35 in response to TGFbeta treatment, we performed Tbeta3-P221/110-Luc luciferase activity assays to examine whether CREB-1 and Smad3 were functionally required for initiating promoter transactivation. As shown in Fig. 6D, TGFbeta induced a 4.7-fold increase of Tbeta3-P221/110-Luc activity in control IEC4-1 cells (Control). TGFbeta also induced a 5.6-fold increase of Tbeta3-P221/110-Luc activity in IEC4-1 cells transfected with siRNA scrambled control reagent (Fig. 6D, siRNA-Ctrl). In contrast, TGFbeta induction of Tbeta3-P221/110-Luc activity was suppressed to 2.3-fold in siRNA-CREB-1 transfected IEC4-1 cells (Fig. 6D, siRNA-CREB-1) and to 2.4-fold in siRNA-Smad3 transfected IEC4-1 cells (siRNA-Smad3). These results established that both CREB-1 and Smad3 were not only present in the transcription factor complex bound at Tbeta3-P61/35 but were also functionally required for promoter transactivation in response to TGFbeta treatment. siRNA-CREB-1 and siRNA-Smad3 Both Suppress TGFbeta Induction of TGFbeta3 Expression—Although we have demonstrated that CREB-1 and Smad3 were involved in TGFbeta induction of TGFbeta3 promoter DNA binding and transcriptional activities, it was of interest to extend our observations to examine whether CREB-1 and Smad3 were necessary for TGFbeta induction of TGFbeta3 expression. We therefore performed real time RT-PCR to examine TGFbeta3 mRNA expression levels after knockdown of CREB-1 or Smad3. As shown in Fig. 6E, TGFbeta treatment induced a 5.7-fold increase in TGFbeta3 mRNA expression in control cells, confirming the presence of an active TGFbeta3 auto-loop. Furthermore, siRNA-CREB-1 or siRNA-Smad3 decreased the TGFbeta induction of TGFbeta3 mRNA expression to levels of only 3.1-fold, a statistically significant decrease compared with that for siRNA-Ctrl (p < 0.01). These results indicate that CREB-1 and Smad3 are required for TGFbeta induction of TGFbeta3 mRNA expression.


Figure 6
View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 6.
siRNA-CREB-1 and siRNA-Smad3 both suppress TGFbeta induction of Tbeta3-P61/35 DNA binding and Tbeta3-P221/110-Luc luciferase reporter activity. A, IEC4-1 cells transfected with the indicated siRNA plasmids were harvested. Cell lysates were subjected to Western blotting using the CREB-1 and Smad3 antibodies described under the "Materials and Methods." As a loading control, beta-actin was also detected in the same membrane using an anti-beta-actin antibody. The siRNA-Control (siRNA-Ctrl) used was an siRNA-scrambled sequence from Ambion. B, upper panel, siRNA-transfected IEC4-1 cells as described in A were incubated in the absence or presence of TGFbeta3 (10 ng/ml) for 30 min. The cells were then harvested, and lysates were prepared, and Western blotting was performed with phospho-CREB-1 and phospho-Smad3 antibodies, as described under the "Materials and Methods." As a loading control, beta-actin was also detected in the same membrane using an anti-beta-actin antibody. The siRNA-control used was an siRNA-scrambled sequence from Ambion. Lower panel, quantitative analysis of the bands in the upper panel. The numbers on top of the bars indicate fold increases compared with control (Ctrl). C, the siRNA-transfected IEC4-1 cells described in A were incubated in the absence or presence of TGFbeta3 (10 ng/ml) for 1 h. Nuclear protein was harvested, and EMSAs were performed as described under the "Materials and Methods." The arrow indicates the relevant DNA complex. Three independent experiments were performed, and a representative figure is shown. D, IEC4-1 cells were co-transfected with Tbeta3-P221/110-Luc and the indicated siRNA plasmids. 24 h after transfection, the cells were incubated in the absence or presence of TGFbeta3 (10 ng/ml). The cells were harvested after an additional 24 h, and luciferase assays were performed as described under the "Materials and Methods." Data plotted are the mean ± S.E. of triplicate samples from one of three independent experiments. Asterisks indicate a statistically significant difference (p < 0.05) in the fold changes between the absence and presence of TGFbeta in the siRNA-transfected IEC4-1 cells compared with siRNA-Ctrl IEC4-1 cells. E, real time RT-PCR was performed as described under the "Materials and Methods." Data plotted are the mean ± S.E. of triplicate samples from one of two independent experiments. Asterisks indicate a statistically significant difference (p < 0.05) of the siRNA-transfected HaCaT cells compared with siRNA-Ctrl HaCaT cells for their fold changes between the absence and presence of TGFbeta. F, quantitative determination of TGFbeta3 in CM from IEC4-1 cells and their siRNA transfectants was performed as described under the "Materials and Methods." Results were normalized for cell number, and secreted TGFbeta3 was expressed as pg/106 cells. Data represent the mean ± S.E. of triplicate wells from a representative experiment (n = 3). Asterisk indicates p < 0.01.

 
siRNA-CREB-1 and siRNA-Smad3 Both Suppress Endogenous TGFbeta3 Production—To measure endogenous TGFbeta3 production in response to TGFbeta3 stimulation, we performed ELISA quantitative analyses on CM from IEC4-1 cells, which produce high levels of TGFbeta3 (20). Because the TGFbeta3 ELISA is specific for TGFbeta3, with no cross-reactivity with TGFbeta1 or TGFbeta2, we used TGFbeta1 to treat the cells and performed ELISAs to evaluate TGFbeta3 concentrations in CM collected from IEC4-1 cells. As shown in Fig. 6F, basal TGFbeta3 production was reduced in siRNA-CREB-1 transfected IEC4-1 cells. Upon TGFbeta1 stimulation, TGFbeta3 production in IEC4-1 cells was increased by more than 6-fold. This induction of TGFbeta3 by TGFbeta1 was significantly suppressed in siRNA-CREB-1- and siRNA-Smad3-transfected IEC4-1 cells. The results are consistent with our previous observations in EMSAs and reporter assays. Furthermore, the results indicate that a TGFbeta3 autocrine loop exists in IEC4-1 cells and that both CREB-1 and Smad3 binding at the CRE site of the TGFbeta3 promoter are critical for the physiological production of TGFbeta3 in these cells.

Schematic Model for TGFbeta3 Autoregulation—Based upon the results in the preceding figures, we have defined the signal transduction pathways that mediate TGFbeta3 autoregulation, specifically focusing on TGFbeta induction of TGFbeta3 secretion, as depicted in the schematic diagram in Fig. 7. According to this model, CREB-1, ATF-2, and c-Jun constitutively bind at the TGFbeta3 promoter CRE site. TGFbeta activates Smad3 as well as JNKs and p38 through the TGFbeta receptors (43–45). JNKs and p38 activate CREB-1 and ATF-2 (45–47), which thereafter bind at the CRE site (–45 to –39) in the TGFbeta3 promoter region Tbeta3-P61/35. Phospho-Smad3 is also bound at this CRE site. Based upon our results, the activation of Smad3, CREB-1, and ATF-2 by TGFbeta results in an increase in TGFbeta3 transcriptional activity and a subsequent increase in TGFbeta3 production. c-Jun is also constitutively bound to this TGFbeta3 promoter CRE site. However, the DNA binding activity of c-Jun is not TGFbeta-inducible, suggesting that c-Jun may play a role in basal TGFbeta3 production in response to stimuli other than TGFbeta.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Although three mammalian isoforms of TGFbeta, TGFbeta1, TGFbeta2, and TGFbeta3, share 60–80% identity at the amino acid level, the promoter regions of these isoforms are highly variable, suggesting that their expression is regulated by distinct mechanisms. Our previous results indicated that the proximal AP-1 site in the TGFbeta1 promoter region was critical for TGFbeta1 auto-induction and that the JNK and ERK cascades, as well as Smad3 and Smad4, were required for TGFbeta1 auto-regulation in untransformed epithelial cells (19). However, the signaling pathways mediating TGFbeta regulation of TGFbeta3 production have not been investigated previously. In this study, we found that TGFbeta3 auto-induction was mediated by the CRE site located between –61 and –35 in the TGFbeta3 promoter region and that CREB-1 and Smad3, as well as JNKs and p38, but not PKA, ERKs, or Smad4, were the critical activators of TGFbeta3 expression. In addition, we found that CREB-1, ATF-2, and c-Jun are constitutively bound at this CRE site. In contrast, Smad3 binding at the TGFbeta3 promoter CRE site was only observed after TGFbeta stimulation. siRNA-CREB-1 and siRNA-Smad3 significantly inhibited the TGFbeta-inducible effects on complex formation at the TGFbeta3 promoter CRE, Tbeta3-P221/110-Luc activity, TGFbeta3 mRNA expression, and TGFbeta3 secretion. Because these data demonstrate that both CREB-1 and Smad3 are critical for mediating TGFbeta3 auto-induction, our results provide the first evidence of the physiological relevance of these transcriptional factors, as well as of the CRE site, in mediating this critical biological response to TGFbeta. Furthermore, DN RII or DN Smad3, but not DN Smad4, effectively blocked the DNA binding activity induced by TGFbeta, confirming that RII and Smad3 are required for this TGFbeta3 auto-loop regulation.


Figure 7
View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 7.
Schematic model for TGFbeta3 autoregulation. CREB-1, ATF-2, and c-Jun constitutively bind at the TGFbeta3 promoter CRE site and are likely required for basal expression of TGFbeta3. Upon TGFbeta3 stimulation, phosphorylated Smad3 is also recruited to this CRE site, which, together with above-mentioned transcription factors, significantly enhances the TGFbeta3 promoter transactivation, thereby resulting in an increase in TGFbeta3 production. Overall, phosphorylation of CREB-1 and Smad3 are the critical events in mediating TGFbeta3 autoinduction.

 
In this study, we have shown for the first time that Smad3 does not bind to the SBE site in the Tbeta3-P61/35 region upon TGFbeta stimulation, but instead it binds to the CRE site, where CREB-1 also binds. Moreover, Smad4 was not present in this binding complex. Because Smad3 knockdown significantly blocked TGFbeta induction of Tbeta3-P61/35 DNA binding, Tbeta3-P221/110-Luc activity, and TGFbeta3 secretion, Smad3 is not only present in the complex bound at Tbeta3-P61/35 CRE, but it is also functionally required for TGFbeta-inducible TGFbeta3 secretion. There are several reports that indicate that Smad3, but not Smad4, associates with both the CREB-1-binding protein, as well as the structurally related p300 protein, in response to TGFbeta exposure (48–50). In keeping with these previous findings, and our results herein, it is conceivable that Smad3 may actually form a complex with CREB-1 in response to TGFbeta and activate TGFbeta3 secretion in the absence of Smad4.

We also found that CREB-1 and ATF-2, but not CREB-2, were constitutively bound at the TGFbeta3 promoter CRE site. Although CREB-1, CREB-2 (also termed ATF-4), and ATF-2 all belong to the ATF/CREB family, they do not share much similarity other than a basic region-leucine zipper (bZip) motif (51). Our data indicate that CREB1, but not CREB-2, is involved in TGFbeta3 secretion mediated by TGFbeta.

It has been shown that the ATF/CREB family of proteins can form heterodimers with AP-1 proteins to activate target gene transcription (51). Similarly, previous reports have indicated that c-Jun can bind to a consensus CRE site. For example, it has been reported that TGFbeta could stimulate CREB-dependent transcription by increasing the amount of c-Jun present in the CREB-1-binding protein-containing complex bound at a consensus CRE site (52). In addition, overexpression of c-Jun not only activated a reporter gene containing a consensus CRE but also activated a portion of the c-Fos promoter only containing a CRE site (52). Our results also suggest that c-Jun might be involved in TGFbeta3 regulation.

It should be pointed out that although Smads are critical for TGFbeta signaling, TGFbeta also stimulates other intracellular signaling pathways, such as JNKs, ERKs, and p38 (19, 43, 44, 53–56). Such MAPKs are required for the signaling of TGFbeta effects on growth, apoptosis, and gene expression (53–56). MAPKs are also kinases that can function upstream of CREB (25). In this study, selective inhibitors of JNKs and p38 effectively blocked DNA binding to the TGFbeta3 promoter region Tbeta3-P61/35, indicating that JNKs and p38 were required for TGFbeta activation of complex formation at this site. Most notably, the selective MEK1 inhibitor failed to suppress the DNA binding to Tbeta3-P61/35, although there are reports that ERKs are involved in CREB activation, particularly in specific neuronal cell cultures (26, 31). Although others have shown that JNK and p38 are involved in TGFbeta signaling, this is the first report of their requirement in TGFbeta induction of TGFbeta3 gene transcription.

It has been reported that ATF-2, which is known to be a nuclear target of p38 and JNKs, was phosphorylated in the N-terminal activation domain in response to TGFbeta (47). In addition, TGFbeta-mediated induction of fibronectin requires activation of JNK, which in turn modulates the activity of ATF-2 and c-Jun (57). Moreover, TGFbeta can induce the phosphorylation of ATF-2 via p38 and TGFbeta-activated kinase-1 (TAK1), follow by ATF-2 complex formation with Smad3 and Smad4 (58). The binding between ATF-2 and Smad3/4 is mediated via the MH1 domain of the Smad proteins and the basic leucine zipper domain of ATF-2 (58). Furthermore, ATF-2 can cooperate with Smad3 to regulate the rate of chondrocyte maturation in response to TGFbeta (59). In our report, ATF-2 displayed TGFbeta-inducible DNA binding activity at the TGFbeta3 promoter CRE site, suggesting that ATF-2 may also play a role in TGFbeta induction of TGFbeta3 production through the signaling pathways described above. Thus, our findings provide evidence of co-regulation by the MAPK and Smad signaling pathway components in mediating this biological response to TGFbeta, similar to the synergistic contribution of these signaling pathways in mediating other TGFbeta responses (53, 56, 60).

It is well documented that the autocrine and/or paracrine effects of TGFbeta1 play a crucial role in tumor invasion and progression. However, although increased expression of TGFbeta3 has been observed in a variety of late stage carcinomas, reports regarding the paracrine effects of TGFbeta3 in modulating the tumor microenvironment and the immune system of the host are scarce. It has been reported that expression of TGFbeta3 correlates with the progression of osteosarcomas (61). In addition, TGFbeta3 has been shown to contribute to the formation of tumor stroma, induction of angiogenesis, and modulation of extracellular matrix, suggesting that excessive secretion of TGFbeta3 by the tumor and/or stromal cells would also foster cancer progression (62). Identification of the factors that are required for TGFbeta3 auto-regulation improves our understanding of the mechanisms underlying TGFbeta3 secretion. Our results may enable the design of novel strategies to regulate TGFbeta3 secretion in pathological conditions by manipulating factors that are involved in this pathway. For example, blockade of TGFbeta3 production in late stage solid cancers using siRNA approaches may prevent the invasiveness and metastatic nature of such cancers. Future studies can address such potential therapeutic strategies.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grants CA90765, CA92889, and CA100239 and Department of Defense Award DAMD17-03-1-0287 (to K. M. M.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Dept. of Pharmacology, Penn State College of Medicine, 500 University Dr., Hershey, PA 17033. Tel.: 717-531-6789; Fax: 717-531-5013; E-mail: kmm15{at}psu.edu.

2 The abbreviations used are: TGFbeta, transforming growth factor-beta; CRE, c-AMP-responsive element; EMSA, electrophoresis mobility shift assay; ChIP, chromatin immunoprecipitation; JNK, c-Jun N-terminal kinase; PKA, protein kinase A; siRNA, small interfering RNA; ERK, extracellular signal-regulated kinase; ELISA, enzyme-linked immunosorbent assay; RT, reverse transcription; DN, dominant negative; PMA, phorbol 12-myristate 13-acetate; MAPK, mitogen-activated protein kinase; SBE, Smad-binding element. Back


   ACKNOWLEDGMENTS
 
We thank H. F. Lodish (Massachusetts Institute of Technology, Cambridge, MA) for the CCL64-Smad3C cells.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Massague, J. (1998) Annu. Rev. Biochem. 67, 753–791[CrossRef][Medline] [Order article via Infotrieve]
  2. Parada, D., Arciniegas, E., Moreira, O., and Trujillo, E. (2004) Arch. Esp. Urol. 57, 93–99[Medline] [Order article via Infotrieve]
  3. Lammerts, E., Roswall, P., Sundberg, C., Gotwals, P. J., Koteliansky, V. E., Reed, R. K., Heldin, N. E., and Rubin, K. (2002) Int. J. Cancer 102, 453–462[CrossRef][Medline] [Order article via Infotrieve]
  4. Kim, S. J., Glick, A., Sporn, M. B., and Roberts, A. B. (1989) J. Biol. Chem. 264, 402–408[Abstract/Free Full Text]
  5. Samatar, A. A., Wang, L., Mirza, A., Koseoglu, S., Liu, S., and Kumar, C. C. (2002) J. Biol. Chem. 277, 28118–28126[Abstract/Free Full Text]
  6. Lafyatis, R., Lechleider, R., Kim, S. J., Jakowlew, S., Roberts, A. B., and Sporn, M. B. (1990) J. Biol. Chem. 265, 19128–19136[Abstract/Free Full Text]
  7. Pelton, R. W., Saxena, B., Jones, M., Moses, H. L., and Gold, L. I. (1991) J. Cell Biol. 115, 1091–1105[Abstract/Free Full Text]
  8. Roberts, A. B., and Sporn, M. B. (1992) Mol. Reprod. Dev. 32, 91–98[CrossRef][Medline] [Order article via Infotrieve]
  9. Tudela, C., Formoso, M. A., Martinez, T., Perez, R., Aparicio, M., Maestro, C., Del Rio, A., Martinez, E., Ferguson, M., and Martinez-Alvarez, C. (2002) Int. J. Dev. Biol. 46, 333–336[Medline] [Order article via Infotrieve]
  10. Hentges, S., Boyadjieva, N., and Sarkar, D. K. (2000) Endocrinology 141, 859–867[Abstract/Free Full Text]
  11. Chaturvedi, K., and Sarkar, D. K. (2004) Endocrinology 145, 706–715[Abstract/Free Full Text]
  12. Unsicker, K., Flanders, K. C., Cissel, D. S., Lafyatis, R., and Sporn, M. B. (1991) Neuroscience 44, 613–625[CrossRef][Medline] [Order article via Infotrieve]
  13. Yamazaki, H., Arai, M., Matsumura, S., Inoue, K., and Fushiki, T. (2002) Am. J. Physiol. 283, E536–E544
  14. Copland, I. B., Adamson, S. L., Post, M., Lye, S. J., and Caniggia, I. (2002) Placenta 23, 311–321[CrossRef][Medline] [Order article via Infotrieve]
  15. Lopez-Casillas, F., Wrana, J. L., and Massague, J. (1993) Cell 73, 1435–1444[CrossRef][Medline] [Order article via Infotrieve]
  16. Bocharov, E. V., Korzhnev, D. M., Blommers, M. J., Arvinte, T., Orekhov, V. Y., Billeter, M., and Arseniev, A. S. (2002) J. Biol. Chem. 277, 46273–46279[Abstract/Free Full Text]
  17. Hart, P. J., Deep, S., Taylor, A. B., Shu, Z., Hinck, C. S., and Hinck, A. P. (2002) Nat. Struct. Biol. 9, 203–208[Medline] [Order article via Infotrieve]
  18. Tang, B., Bottinger, E. P., Jakowlew, S. B., Bagnall, K. M., Mariano, J., Anver, M. R., Letterio, J. J., and Wakefield, L. M. (1998) Nat. Med. 4, 802–807[CrossRef][Medline] [Order article via Infotrieve]
  19. Yue, J., and Mulder, K. M. (2000) J. Biol. Chem. 275, 30765–30773[Abstract/Free Full Text]
  20. Mulder, K. M., Segarini, P. R., Morris, S. L., Ziman, J. M., and Choi, H. G. (1993) J. Cell. Physiol. 154, 162–174[CrossRef][Medline] [Order article via Infotrieve]
  21. Mulder, K. M., and Morris, S. L. (1992) J. Biol. Chem. 267, 5029–5031[Abstract/Free Full Text]
  22. Yue, J., Sun, B., Liu, G., and Mulder, K. M. (2004) J. Cell. Physiol. 199, 284–292[CrossRef][Medline] [Order article via Infotrieve]
  23. Devling, T. W., Lindsay, C. D., McLellan, L. I., McMahon, M., and Hayes, J. D. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 7280–7285[Abstract/Free Full Text]
  24. Liu, G., Chen, N., Kaji, A., Bode, A. M., Ryan, C. A., and Dong, Z. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 7510–7515[Abstract/Free Full Text]
  25. Mora-Garcia, P., Cheng, J., Crans-Vargas, H. N., Countouriotis, A., Shankar, D., and Sakamoto, K. M. (2003) Stem Cells (Dayton) 21, 123–130
  26. Masutani, H., Bai, J., Kim, Y. C., and Yodoi, J. (2004) Mol. Neurobiol. 29, 229–242[CrossRef][Medline] [Order article via Infotrieve]
  27. Shi, Y., Wang, Y. F., Jayaraman, L., Yang, H., Massague, J., and Pavletich, N. P. (1998) Cell 94, 585–594[CrossRef][Medline] [Order article via Infotrieve]
  28. Hartsough, M. E., and Mulder, K. M. (1995) J. Biol. Chem. 270, 7117–7124[Abstract/Free Full Text]
  29. Yue, J., Buard, A., and Mulder, K. M. (1998) Oncogene 17, 47–55[CrossRef][Medline] [Order article via Infotrieve]
  30. Wrana, J. L., Attisano, L., Wieser, R., Ventura, F., and Massagué, J. (1994) Nature 370, 341–347[CrossRef][Medline] [Order article via Infotrieve]
  31. Weeber, E. J., and Sweatt, J. D. (2002) Neuron 33, 845–848[CrossRef][Medline] [Order article via Infotrieve]
  32. Cho, H. R., Hong, S. B., Kim, Y. I., Lee, J. W., and Kim, N. I. (2004) J. Korean Med. Sci. 19, 853–858[Medline] [Order article via Infotrieve]
  33. Liu, X., Sun, Y., Constantinescu, S. N., Karam, E., Weinberg, R. A., and Lodish, H. F. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 10669–10674[Abstract/Free Full Text]
  34. Shaywitz, A. J., and Greenberg, M. E. (1999) Annu. Rev. Biochem. 68, 821–861[CrossRef][Medline] [Order article via Infotrieve]
  35. Nishihara, H., Hwang, M., Kizaka-Kondoh, S., Eckmann, L., and Insel, P. A. (2004) J. Biol. Chem. 279, 26176–26183[Abstract/Free Full Text]
  36. Gustin, J. A., Pincheira, R., Mayo, L. D., Ozes, O. N., Kessler, K. M., Baerwald, M. R., Korgaonkar, C. K., and Donner, D. B. (2004) Am. J. Physiol. 286, C547–C555
  37. Yue, J., Frey, R. S., and Mulder, K. M. (1999) Oncogene 18, 2033–2037[CrossRef][Medline] [Order article via Infotrieve]
  38. Oki, N., Takahashi, S.-I., Hidaka, H., and Conti, M. (2000) J. Biol. Chem. 275, 10831–10837[Abstract/Free Full Text]
  39. Davies, S. P., Reddy, H., Caivano, M., and Cohen, P. (2000) Biochem. J. 351, 95–105[CrossRef][Medline] [Order article via Infotrieve]
  40. Chijiwa, T., Mishima, A., Hagiwara, M., Sano, M., Hayashi, K., Inoue, T., Naito, K., Toshioka, T., and Hidaka, H. (1990) J. Biol. Chem. 265, 5267–5272[Abstract/Free Full Text]
  41. Yang, F., Kawedia, J. D., and Menon, A. G. (2003) J. Biol. Chem. 278, 32173–32180[Abstract/Free Full Text]
  42. Ranganathan, G., Phan, D., Pokrovskaya, I. D., McEwen, J. E., Li, C., and Kern, P. A. (2002) J. Biol. Chem. 277, 43281–43287[Abstract/Free Full Text]
  43. Frey, R. S., and Mulder, K. M. (1997) Cancer Lett. 117, 41–50[CrossRef][Medline] [Order article via Infotrieve]
  44. Frey, R. S., and Mulder, K. M. (1997) Cancer Res. 15, 628–633
  45. Hanafusa, H., Ninomiya-Tsuji, J., Masuyama, N., Nishita, M., Fujisawa, J., Shibuya, H., Matsumoto, K., and Nishida, E. (1999) J. Biol. Chem. 274, 27161–27167[Abstract/Free Full Text]
  46. Park, S. W., Sung, M. W., Heo, D. S., Inoue, H., Shim, S. H., and Kim, K. H. (2005) Oncogene 24, 6689–6698[CrossRef][Medline] [Order article via Infotrieve]
  47. Bhat, N. R., Feinstein, D. L., Shen, Q., and Bhat, A. N. (2002) J. Biol. Chem. 277, 29584–29592[Abstract/Free Full Text]
  48. Feng, X.-H., Zhang, Y., Wu, R. Y., and Derynck, R. (1998) Genes Dev. 12, 2153–2163[Abstract/Free Full Text]
  49. Shen, X., Hu, P. P., Liberati, N. T., Datto, M. B., Frederick, J. P., and Wang, X.-F. (1998) Mol. Biol. Cell 9, 3309–3319[Abstract/Free Full Text]
  50. Furumatsu, T., Tsuda, M., Taniguchi, N., Tajima, Y., and Asahara, H. (2005) J. Biol. Chem. 280, 8343–8350[Abstract/Free Full Text]
  51. Hai, T., and Hartman, M. G. (2001) Gene (Amst.) 273, 1–11[CrossRef][Medline] [Order article via Infotrieve]
  52. Hu, P. P., Harvat, B. L., Hook, S. S., Shen, X., Wang, X.-F., and Means, A. R. (1999) Mol. Endocrinol. 13, 2039–2048[Abstract/Free Full Text]
  53. Mulder, K. M. (2000) Cytokine Growth Factor Rev. 11, 23–35[CrossRef][Medline] [Order article via Infotrieve]
  54. Yue, J., and Mulder, K. M. (2000) Methods Mol. Biol. 142, 125–131[Medline] [Order article via Infotrieve]
  55. Hartsough, M. T., and Mulder, K. M. (1997) Pharmacol. Ther. 75, 21–41[CrossRef][Medline] [Order article via Infotrieve]
  56. Yue, J., and Mulder, K. M. (2001) Pharmacol. Ther. 91, 1–34[CrossRef][Medline] [Order article via Infotrieve]
  57. Hocevar, B. A., Brown, T. L., and Howe, P. L. (1999) EMBO J. 18, 1345–1356[CrossRef][Medline] [Order article via Infotrieve]
  58. Sano, Y., Harada, J., Tashiro, S., Gotoh-Mandeville, R., Maekawa, T., and Ishii, S. (1999) J. Biol. Chem. 274, 8949–8957[Abstract/Free Full Text]
  59. Ionescu, A. M., Schwarz, E. M., Zuscik, M. J., Drissi, H., Puzas, J. E., Rosier, R. N., and O'Keefe, R. J. (2003) Exp. Cell Res. 288, 198–207[CrossRef][Medline] [Order article via Infotrieve]
  60. Javelaud, D., and Mauviel, A. (2005) Oncogene 24, 5742–5750[CrossRef][Medline] [Order article via Infotrieve]
  61. Kloen, P., Gebhardt, M. C., Perez-Atayde, A., Rosenberg, A. E., Springfield, D. S., Gold, L. I., and Mankin, H. J. (1997) Cancer 80, 2230–2239[CrossRef][Medline] [Order article via Infotrieve]
  62. Gold, L., Jussila, T., Fusenig, N. E., and Stenback, F. (2000) J. Pathol. 190, 579–588[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
D.-W. Lin, I.-C. Chang, A. Tseng, M.-L. Wu, C.-H. Chen, C. A. Patenaude, M. D. Layne, and S.-F. Yet
Transforming Growth Factor {beta} Up-regulates Cysteine-rich Protein 2 in Vascular Smooth Muscle Cells via Activating Transcription Factor 2
J. Biol. Chem., May 30, 2008; 283(22): 15003 - 15014.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
H. P. Gaide Chevronnay, P. B. Cornet, D. Delvaux, P. Lemoine, P. J. Courtoy, P. Henriet, and E. Marbaix
Opposite Regulation of Transforming Growth Factors-{beta}2 and -{beta}3 Expression in the Human Endometrium
Endocrinology, March 1, 2008; 149(3): 1015 - 1025.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Q. Jin, W. Ding, and K. M. Mulder
Requirement for the Dynein Light Chain km23-1 in a Smad2-dependent Transforming Growth Factor-beta Signaling Pathway
J. Biol. Chem., June 29, 2007; 282(26): 19122 - 19132.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
B. S. Yoon, R. Pogue, D. A. Ovchinnikov, I. Yoshii, Y. Mishina, R. R. Behringer, and K. M. Lyons
BMPs regulate multiple aspects of growth-plate chondrogenesis through opposing actions on FGF pathways
Development, December 1, 2006; 133(23): 4667 - 4678.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/40/29479    most recent
M600579200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, G.
Right arrow Articles by Mulder, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, G.
Right arrow Articles by Mulder, K. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement