Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M605811200 on July 25, 2006

J. Biol. Chem., Vol. 281, Issue 40, 29753-29761, October 6, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/40/29753    most recent
M605811200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Faraco, J. H.
Right arrow Articles by Mignot, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Faraco, J. H.
Right arrow Articles by Mignot, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Regulation of Hypocretin (Orexin) Expression in Embryonic Zebrafish*

Juliette H. Faraco{ddagger}1, Lior Appelbaum§1, Wilfredo Marin{ddagger}, Stephanie E. Gaus§, Philippe Mourrain{ddagger}, and Emmanuel Mignot{ddagger}2

From the {ddagger}Stanford University Center for Narcolepsy, Department of Psychiatry and Behavioral Sciences, Stanford University, Stanford, California 94305, the §Howard Hughes Medical Institute, Stanford University, Stanford, California 94305, and INSERM, U784, 75230 Paris, France

Received for publication, June 16, 2006 , and in revised form, July 21, 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Hypocretins/orexins are neuropeptides involved in the regulation of sleep and energy balance in mammals. Conservation of gene sequence, hypothalamic localization of cell bodies, and projection patterns in adult zebrafish suggest that the architecture and function of the hypocretin system are conserved in fish. We report on the complete genomic structure of the zebrafish and Tetraodon hypocretin genes and the complete predicted hypocretin protein sequences from five teleosts. Using whole mount in situ hybridization, we have traced the development of hypocretin cells in zebrafish from onset of expression at 22 h post-fertilization through the first week of development. Promoter elements of similar size from zebrafish and Tetraodon were capable of driving efficient and specific expression of enhanced green fluorescent protein in developing zebrafish embryos, thus defining a minimal promoter region able to accurately mimic the native hypocretin pattern. This enhanced green fluorescent protein expression also revealed a complex pattern of projections within the hypothalamus, to the midbrain, and to the spinal cord. To further analyze the promoter, a series of deletion and substitution constructs were injected into embryos, and resulting promoter activity was monitored in the first week of development. A critical region of 250 base pairs was identified containing a core 13-base pair element essential for hypocretin expression.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The hypocretin/orexin peptides (HCRT-1 and HCRT-2)3 are neurotransmitters involved in the regulation of sleep and energy balance (1). HCRT-1 and HCRT-2 have significant homology and result from the cleavage of a common precursor encoded by the hcrt locus. In mammals, the hypocretin expressing cell clusters are located in the lateral hypothalamus and send widespread projections that innervate multiple brain areas and the spinal cord. The population is relatively small and involves ~70,000 neurons in the human brain (2). Projections are especially dense on several aminergic and cholinergic nuclei, most notably the adrenergic locus coeruleus and histaminergic tuberomammilary neurons (3).

Loss of HCRT transmission causes the sleep disorder narcolepsy in humans, canines, and rodents (46). The symptoms of narcolepsy in humans typically present in the second decade of life, usually in association with undetectable levels of HCRT-1 in the cerebrospinal fluid (7, 8). Post-mortem studies indicate a 90–95% loss of hypocretin-producing cells in human narcolepsy (2, 6, 9, 10). The process leading to cell death is unknown, but because of a strong association with human leukocyte antigen DQB1*0602 (11, 12), it is generally presumed that hypocretin cells are the target of an autoimmune process (13). This cell destruction in human narcolepsy is likely triggered by environmental factors interacting with a specific genetic background.

An understanding of the processes underlying hcrt cell specification, differentiation, and maintenance as well as why they are susceptible to loss are key questions of both basic and clinical relevance. The zebrafish is well suited for such studies by virtue of nearly transparent and rapid external development. Another important feature is the ease and efficiency of genetic manipulation of zebrafish embryos to create transgenic marker lines or to achieve rapid overexpression or phenotypic knock-down of selected genes (14, 15). The zebrafish is a simple and powerful model for studying promoter function, and recently genetic manipulation has been extended to functional characterization of putative regulatory sequences (1620). Transgenesis is far simpler than in the mouse, with the additional advantage of being able to assess transient promoter activity in the context of the whole animal for accurate study of spatial and temporal gene regulation. Hundreds of independent transgenic animals can be easily monitored; thus position-dependent integration effects do not bias the results.

The hypocretin gene is conserved in teleost genomes and is similarly expressed in lateral hypothalamic cell clusters in the adult zebrafish (21). It may thus be involved in the regulation of states of "wakefulness" and energy homeostasis as in mammals. Larval zebrafish display a diurnal rhythm of locomotor activity and have periods of nocturnal immobility that are associated with a stereotypic posture and an increased arousal threshold, key behavioral indicators of a sleep-like state (2224). Sleep homeostatic mechanisms are also present; following rest deprivation, larvae display a compensatory rest rebound with an increased arousal threshold (22). Hypnotic compounds of the benzodiazepine and barbiturate families induce a sleep-like behavior in zebrafish; thus the role of GABA in behavioral sleep is likely to be functionally conserved (22). This may also be the case with other sleep-modulatory neurotransmitters that have been identified in the zebrafish (25, 26) including acetylcholine, histamine, 5-hydroxytryptamine, and dopamine (2731).

In our efforts to understand the origins and unique character of hypocretin cells, we have applied both embryologic and transgenic studies in zebrafish. We have extended the genetic characterization of the zebrafish hypocretin gene to include the first coding exon and demonstrate a selective pattern of lateral hypothalamic expression. Hcrt transcripts were localized in a cluster of ~9 cells/hemibrain by the end of the first week of development. A similar genomic characterization was performed in Tetraodon nigroviridis. Transgenesis revealed a compact, phylogenetically conserved promoter driving enhanced green fluorescent protein (EGFP) expression exclusively in native HCRT-producing cells. We have used this promoter to create transient and stably transgenic EGFP marker strains to characterize the process of formation of hypocretin projections. Finally, a 13-base pair functional element essential to promoter function was also identified.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Zebrafish Husbandry—Wild-type zebrafish were maintained at 28 °C on a 14:10 light-dark cycle under optimal maintenance conditions (32) in accordance with the animal protocol approved by Stanford University. The embryos were generated by natural spawning and were raised in egg water containing methylene blue (0.3 ppm). For in situ hybridization and EGFP observation, the embryos were incubated in 0.003% 1-phenyl-2-thiourea after 24 hpf to prevent pigment formation.

BAC Clones—Zebrafish HCRT clones were isolated from two BAC libraries through hybridization and analyzed by hybridization, PCR, sequence analysis, and subcloning. Genome systems (Incyte Genomics) clones 87J11, 91K13, and 147H8 were a kind gift from Will Talbot; Chori 211 clones 3K3, 37N13, 59P20, 134F5, and 135D16 were obtained through CHORI (Oakland, CA). T. nigroviridis BAC clones 50L6, 38I21, 49B24, 10G8, and 20D23 were identified through blast searches of the GenBankTM Genome Survey Sequence database and obtained from Genoscope, Paris.

Reverse transcription-PCR and RACE—The full transcripts of the zebrafish and T. nigroviridis hcrt genes were determined through reverse transcription-PCR and 5'- and 3'-RACE. Total RNA was extracted from excised, pooled juvenile zebrafish brains and adult Tetraodon brain and then treated by on-column DNase I digestion (RNeasy; Qiagen). cDNA was prepared with avian myeloblastosis virus reverse transcriptase. 5'- and 3'-RACE were performed according to the GeneRacer protocol (Invitrogen) with primers 3'zhcrt-RACE-GSP2 (5'-GGAAGAGGCTGGAGGAGCCCGCTA-3') and 5'zhcrt-RACE-GSP2 (5'-TAGCAGCGCCATGAAGACGAGCAC-3'). PCR products were cloned into pCRII TOPO® (Invitrogen) and sequenced. The expression and splicing of Tetraodon and zebrafish hcrt were confirmed through reverse transcription-PCR (Superscript II; Invitrogen). Primers were tet-F1 (5'-ACTTGTTCCAAAAAGGAAGATCAG-3') and tet-R1 (5'-CAACACGTAGAGTCGACAGGAGCG-3').

Bioinformatics—Fish hcrt sequences were identified through Blast searches of databases including: Zv6 v38 May 2006 (zebrafish), TETRAODON 7 April 2003, FUGU 4.0 June 2005, and Gasterosteus aculeatus BROAD S1 (stickleback) (all available at www.ensembl.org/index.html); Oryzias latipes (medaka) databases golw_scaffold_last.seq, golw_scaffold Hd-rR (200506, 200406), golw_contig Hd-rR (200506, 200406) are available at dolphin.laboratorynig.ac.jp/medaka/srch_db/search_medaka_blastdb2.php?hmpage=/medaka/index.php&lang=eg&lmode=all. Hit and database for Exon 2 were GOLWno5793_l17.g1 golw05 (494–132).

DNA sequencing was performed on an ABI 377 automated sequencer, and analysis was performed using Sequencher (Gene Codes). Alignments were made with ClustalW (1.83). Analysis of transcription factor binding sites was made with TESS (www.cbil.upenn.edu/cgi-bin/tess/tess) and the public version of Match 1.0 (www.gene-regulation.com/pub/programs.html#match, (33) using the best selection profile and minimize sum of both error rate options. Fgenes, Fex, and Spl (Softberry.com) were used to identify potential first exons and/or splice donor sites. Signal peptide cleavage sites were predicted with SignalP 3.0 www.cbs.dtu.dk/services/SignalP/. Putative first exons were next compared for conserved encoded amino acids, predicted intron length, and relative conservation of promoter elements (TATAA box) using ClustalW (www.ebi.ac.uk/clustalw/). Footprinter (bio.cs.washington.edu/software.html) (34) and MEME (meme.sdsc.edu/meme/intro.html) were used to identify conserved motifs.

Constructs—Zebrafish hcrt promoter constructs 2kb-zhcrt-EGFP (–1941 to +62) and 1kb-zhcrt-EGFP (–941 to +62, GenBankTM DQ831347 [GenBank] ) fragments were amplified by PCR of genomic DNA and ligated into the SalI-BamH1 sites of pEGFP-1. A 1040-bp T. nigroviridis hcrt promoter fragment (1–1040 of GenBankTM DQ831348 [GenBank] ) was amplified from BAC 10G8 DNA by PCR and ligated into the BglII site of pEGFP-1 (Clontech). Deletion and substitution mutations were created using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) as instructed by the manufacturer. The resulting clones were tested through restriction analysis and confirmed through sequencing.

Substitution Primers—Forward primers are listed, and overlapping reverse primers are reverse complement: Region 1-SalI, 5'-GTTAGCAAATACCAACAGGTCGACTGTGTGACGAGGCCTTGATT-3'; Region 2-SalI, 5'-CACTCATTCTGTTGGTATTTGCTGTCGACGCTCGTCCTCCTGTCCATAAT-3'; Region 3-NotI, 5'-AGCTCGTCCTCCTGTCCATAAGCGGCCGCTTAAGAACTTGCCGGGATA-3'; and Region 4-NotI, 5'-AAGAACTTGCCGGGATACAGGGCGGCCGCGTTACACGCTAATGACAA-3'.

Deletion Primers—The deletion primers used are: 1000 to 750-Right, 5'-pATATCTCGTTTAGAGTGCTGCATT-3'; 1000 to 750-Left, 5'-pTTTTCTGCTCTGAGCACAGTGTAG-3'; 750 to 500-Right, 5'-pTTAAATCTGACTGCTCTCTGACCT-3'; 750 to –500-Right Left, 5'-pGCTGTTGTTTCAGGTGAAAGTTTG-3'; 500 to 250-Right, 5'-pGACAAAGATGCTAACAACCCCGAA-3'; 500 to 250-Left, 5'-pTGATGAGGCGCTCGAACACATTCA-3'; 251 to 99 (also known as "–250 to TATAAA")-Right, pGTGGCACATCTGTATAAAAACGAG; 251 to 99-Left, pATTAGCGTGTAACCAGGATTACCT; Region 2-Right, 5'-pCGTACTCCTGTCCATAATAGTTGTTTTAAG-3'; and Region 2-SnabI-Left, 5'-pTAATACCAACAGAATGAGTGTGTGACG-3'.


Figure 1
View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 1.
A, genomic structure of zhcrt. Exons 1 and 2 are separated by a polymorphic intron of 3.6 or 6 kb in zebrafish. B, alignment of human and complete predicted protein sequences of HCRT in five teleosts derived from cloned DNA sequences (zebrafish and Tetraodon) and from sequences available through genome data bases (Fugu, stickleback, and medaka). Amino acids predicted to be encoded by exon 1 are within the boxed region. The shaded regions depict mature human HCRT-1 and HCRT-2 peptides. Predicted N termini of mature HCRT-1 in fish are displayed in bold type. All of the fish listed contain additional amino acids within the HCRT-1 peptide compared with human (see dashed lines).

 
Transient and Stable Expression Assay—Upon fertilization, 100–400 eggs were harvested and placed in agarose grooves for injection. Supercoiled plasmid DNA (transient experiments) or gel-purified, linearized DNA (stable transgenic lines) was diluted to 50 ng/µl, and ~2 nl were injected into the cytoplasm of one-cell stage wild-type embryos using a micromanipulator and a PLI 90 injector (Harvard Apparatus). The embryos were transferred to 10-cm dishes (<60/dish) and maintained as above. For promoter analysis EGFP positive embryos were counted at two time points (30 and 54 hpf) using a Zeiss M2Bio fluorescence microscope fitted with a 10x objective lens and an EGFP filter. Hypothalamic fluorescence of one or more cells (unilateral or bilateral) in the hypocretin cells region was scored as specific. For hcrt cell projection analysis, the embryos were injected with the 1kb-zhcrt-EGFP construct and monitored during the first week of development.

Whole Mount in Situ Hybridization—Whole mount RNA in situ hybridization was carried out as described previously (35, 36). Digoxigenin- or fluorescein-labeled full-length antisense riboprobes for egfp and zebrafish hcrt were transcribed in vitro using standard reagents (ProMega).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Genomic Structure of zhcrt and thcrt Genes—We performed 5'-RACE to identify the transcriptional start site of zebrafish hypocretin (zhcrt) and identified a small first exon encoding 6 amino acids and containing 62 bp of 5'-untranslated sequences (GenBankTM/EBI accession number DQ831346 [GenBank] ). This exon was not identified in prior published work (21). The two-exon structure is similar to the structure of mammalian hcrt genes. Through sequence and Southern analysis of BAC clones from two libraries (Genome systems, Chori 211), we identified the presence of a single zhcrt locus with a polymorphic intron sized 3.6 or 6 kb associated with a 2408-bp insertion located 137 bp upstream of exon 2, with homology to the helentron Hel_Dr6 repetitive element, as well as numerous SNPS and indel polymorphisms in BAC clones from the AB strain (GenBankTM/EBI accession number DQ831349 [GenBank] ) (Fig. 1A). This polymorphism was confirmed through Southern analysis of genomic zebrafish strains from various strains. The Tetraodon hcrt (thcrt) gene was identified through Blast searches and resequenced on BAC DNA revealing also a two-exon hypocretin gene. Expression and splicing of the predicted Tetraodon gene were confirmed by reverse transcription-PCR and sequencing. Further studies of the zebrafish and Tetraodon BAC clones indicated conservation of synteny in this region, with the Stat3, Stat5, hcrt, and Bec2/KCNH4 genes located in the BAC contigs, as reported in mouse (37). In the most recent zebrafish and Tetraodon whole genome assemblies (Sanger Institute, Ensembl), hcrt corresponds to FGENESH00000056346 on chromosome 3 in zebrafish and GSCT000132001 on chromosome 3 in Tetraodon.

We also identified two-exon hcrt genes in other teleosts through searches of genome databases and subsequent analysis of the regions surrounding the hits. These other teleost hcrt genes were identified in Fugu (NEWSINFRUG00000161995), Stickleback (GENSCAN00000033466, with 5' sequence and exon 1 reported here located on contig_4260: 5838783–5839782), and medaka (5' sequence and exon 1 on scaffold5097: 24560–23509, and exon 2 on GOLWno5793_l17.g1: 494–132). The medaka, stickleback, and both pufferfish genes all have multiple in-frame ATG codons in the predicted first exons, but these correspond to an out of frame ATG in zebrafish in alignments. Because there are no data on the transcriptional or translational start sites in these animals, predicted translational start sites were selected as the last ATG based on conservation (7 encoded amino acids in mammals and 6 in zebrafish) (Fig. 1B). Flanking 5' noncoding sequences showed substantial conservation between various fish species, supporting our exon predictions (data not shown). Predicted signal peptide cleavage sites were in a localized region of the precursor protein similar to that known in mammals (Fig. 1B). In the two pufferfish, two potential sites were predicted (22{downarrow}23 and 24{downarrow}25) and the first site (22{downarrow}23) was reported. In all of the fish studied, an additional stretch of amino acids is present within the mature HCRT-1 peptide when compared with mammals (Fig. 1B).


Figure 2
View larger version (79K):
[in this window]
[in a new window]
 
FIGURE 2.
Whole mount in situ hybridization of zhcrt in the first week of development using antisense zhcrt riboprobes. Hcrt is exclusively detected in bilateral clusters of the developing hypothalamus and onset of ~22 hpf marked by arrowheads in A–C. Rotation of cells along a dorsal-caudal path with respect to the lens axis is notable through the first week. Cells proliferate early and reach ~8–9 cells/hemibrain cluster during the first week of development. Frontal (C, F, I, L, and O) and dorsal (A, D, G, J, and M) views show the localization of the cluster in the lateral hypothalamus. Vitellus was removed to picture stained cells in A and D. Lateral views are depicted in B, E, H, K, and N, and frontal views in (C, F, I, L, and O) illustrate the gradual movement of the clusters during development along the dorso-ventral and antero-posterior axes with lens position as a reference.

 
Alignment of human and predicted protein sequences of HCRT in five teleosts revealed a strikingly high homology at the predicted C-terminal end of both hypocretin peptides and at dibasic cleavage sites. As these amino acids are indispensable for proper peptide processing and ligand binding to the receptor (38), the data add credence to the functional similarity of the hypocretin system across fish and mammals.

Embryonic and Larval Expression of Hypocretin—We examined the development of hypocretin-producing cells through whole mount in situ hybridization ISH. Starting at ~22 hpf hcrt expression was observed either unilaterally or bilaterally in loose clusters in the lateral ventral diencephalon corresponding to the developing hypothalamus (Fig. 2, A–C). There was variability in both the number and positioning of cells within the bilateral clusters through all time points. Signal was never detected outside this unique hypothalamic cluster at any larval time point, indicating that in the zebrafish, hcrt transcripts are restricted to the lateral hypothalamus. The positions of the cell clusters changed with the ongoing development of the brain, first appearing rostral with respect to the lens axis, then moving directly between the lenses (2 dpf), and finally reaching a position slightly dorsal and caudal to the lens axis (6 dpf) (Fig. 2). Cell counts were determined by observation of 20 animals aged from 1 to 7 dpf. At day 1, up to 5 cells per cluster were observed, with an average total number of 4.6 ± 0.5 (S.E.). Average total cell numbers were 14.4 ± 0.9 at 2 dpf, 17.1 ± 0.7 at 3 dpf, 20.5 ± 0.9 at 4 dpf, 15.7 ± 0.7 at 5 dpf, 15.9 ± 0.5 at 6 dpf, and 18.9 ± 0.7 at 7 dpf. Overall, an average total of 17.63 ± 0.36 cells were seen at 2–7 dpf.

A One-kilobase Promoter Fragment Is Sufficient to Drive Cell-specific Hypocretin Expression—The promoter activity of putative zebrafish 5' genomic fragments was explored through expression of EGFP. Purified DNA was injected into zebrafish embryos at the one-cell stage, and EGFP fluorescence was observed after 24 hpf. We found that reporter constructs containing 1 and 2 kb of sequence upstream of the translational start site (1kb-zhcrt GenBankTM/EBI accession number DQ831347 [GenBank] , and 2kb-zhcrt, containing bases –1941 or –941 through +62; Fig. 1) were efficient at driving EGFP expression in a pattern consistent with time of onset and position of native hcrt expression (Fig. 3). In addition, a 1040-bp Tetraodon fragment (1kb-thcrt, spanning 1–1040 of GenBankTM/EBI accession number DQ831348 [GenBank] ) was able to drive expression of EGFP in zebrafish embryos in a similar manner (Fig. 3). Strikingly, ectopic EGFP expression was never observed. Co-expression of egfp and endogenous hcrt mRNAs was demonstrated by double in situ hybridization (Fig. 3). A stable strain of zebrafish with fluorescent hcrt cells was derived using the 1kb-thcrt-EGFP Tetraodon construct (two germline founders among 100 animals raised). We also tested the 3.2-kb human hypocretin promoter fragment effective in mouse (39)4 and never observed any fluorescence.

Elaboration of hcrt Projections—Development of HCRT fibers was characterized by observation of EGFP fluorescence under the control of the 1kb-zhcrt and 1kb-thcrt promoters. Mosaic transient expression resulted in the intense expression of EGFP in a variable number of cells (up to a number similar to native expression; compare Fig. 4, F and G), allowing observation of projections. Cell projections were initiated by 1 dpf, during the proliferative phase, and first extended caudo-dorsally at an oblique angle (Fig. 4, A and B). After 2 dpf, the projections bend to attain a sharp 90° turn located in the center of the midbrain (Fig. 4C), with subsequent trajectory running strictly posteriorly in the mesoventral part of the midbrain, hindbrain, and spinal cord (Fig. 4, C, D, I, and J). Viewed dorsally, the fibers maintain a strictly parallel orientation, transitioning from a deep midbrain-hindbrain position to a peripheral location within the spinal cord (Fig. 4, I and J). The length of these posterior projections was found to increase with time, being restricted to the midbrain at day 1 (Fig. 4, A and B), crossing the hindbrain at day 2 (Fig. 4C), and extending through the spinal cord at day 3 (Fig. 4D). These caudal projections branch in the vicinity of the rhombomere 1–2 boundary (Fig. 4, C, D, and J). Between 3 and 5 dpf, projections from single cells become complex. In addition to the posterior projection described above, more localized and arborized projections were observed most notably laterally within the hypothalamus and midbrain (Fig. 4, E, F, and H).


Figure 3
View larger version (92K):
[in this window]
[in a new window]
 
FIGURE 3.
EGFP fluorescence in zebrafish hcrt cells. EGFP fluorescence under the control of 1kb-thcrt and 1kb-zhcrt promoter fragments were visualized in live animals on the second day of development. Observed fluorescence from the stable 1kb-thcrt-EGFP transgenic strain and transient expression from 1kb-zhcrt-EGFP construct are consistent with the timing and position of native hcrt expression (lateral and frontal views). Expression of egfp and hcrt are localized in the same cell bodies, establishing that observed fluorescence accurately tracks hcrt cells. Single and double in situ hybridization experiments demonstrate identical expression of egfp (INT/BCIP, red color) and endogenous hcrt (BM purple, blue color) mRNA within the same cell population in transgenic animals (co-localized colors appear purple).

 
Functional Characterization of Zebrafish hcrt Promoter—We began the analysis of the hcrt promoter by studying the 1-kb functional regions from Tetraodon and zebrafish to identify conserved areas using alignments and motif search software. To help distinguish functionally conserved bases in alignments from those identical through random neutral evolution, we included the corresponding regions from Fugu, medaka, and stickleback to allow identification of conserved bases and motifs. Conservation was notable in the 500 bp upstream of the identified TATA boxes (917 in 1kb-zhcrt, 1030 in 1kb-thcrt). We next performed a two-tiered functional characterization, first creating nested deletions then disrupting regions of conservation (Fig. 5). Constructs were injected (50 ng/µl) into single-cell embryos, and promoter activity was assessed by quantifying the proportion of animals expressing fluorescence in one or more hcrt cell at 2 dpf. The proportion of fluorescent embryos injected with the 1kb-zhcrt-EGFP and 2kb-zhcrt-EGFP constructs were equivalent, indicating that deletion of the 5' 1 kb of sequence had no effect on the efficiency of EGFP expression and was unlikely to contain regulatory elements of importance. The 1kb-zhcrt-EGFP construct was selected as the wild-type base-line promoter, and subsequent constructs normalized against this 1000-bp benchmark for comparison of promoter efficiency. A further series of deletions were characterized, each including 250 bp of the base-line promoter. The final deletion was 153 bp to maintain the activity of the TATA box and 12 highly conserved adjacent bases. Deletions within the base-line 1-kb promoter decreased the efficiency of expression by 75% or more but always produced a normal pattern of expression. Ectopic expression was never observed. Strikingly, deletion of the region from –500 to –250 resulted in a complete loss of EGFP expression in all animals.

This critical 250-bp region was analyzed to determine the extent of conservation, conserved motifs and potential transcription factor-binding sites between zebrafish and Tetraodon. Four regions containing clusters of identical residues were selected for further study by site-directed mutagenesis (Fig. 5). Each construct was designed to substitute 3–7 conserved bases within the conserved region. All four of the resulting mutations had significant effects on the percentage of embryos displaying EGFP fluorescence. Three of these mutations (regions 1, 3, and 4) had moderate effects, reducing the efficiency of the promoter by approximately one-half compared with the native 1-kb fragment. These regions had homology to core-binding sites of various transcription factors in the TRANSFAC data base including a zeste core binding site in region 1, a core site for nkx-2.5 in region 3, and an Ap-1 consensus site in region 4. In addition to these potential sites within selected regions, potential interferon response elements were detected at position 337 in zebrafish and at positions 154 and 488 of the Tetraodon promoter. The zebrafish interferon regulatory factor is in a position that contains mismatches compared with Tetraodon, whereas the Tetraodon elements are in areas that do not appear to be conserved with zebrafish.


Figure 4
View larger version (114K):
[in this window]
[in a new window]
 
FIGURE 4.
Hcrt-cell projections as monitored by EGFP fluorescence. Mosaic transient expression (ranging from one cell to the complete pattern) allowed selected intensely fluorescent cells to be monitored. Animals from the stable 1kb-thcrt-EGFP line (A and B) had the same pattern of projections as those expressing from the 1kb-zhcrt-EGFP construct (C–J). Lateral views of developing projections are pictured at 24 hpf (A), 30 hpf (B), 2 dpf (C), and 4 dpf (D). The frontal view (E) depicts cells at 5 dpf in the lateral hypothalamus. The fluorescence, pictured at 5 dpf (F) is able to completely mimic native hcrt expression compared with a 5-dpf ISH reference (G). At this stage, hcrt cells are loosely clustered and apparently interconnected. Single cells at 5 dpf are highly arborized (H, a cell from the left hemisphere at high magnification from dorsal view, top of figure is anterior axis). The most prominent early projections are directed dorso-caudally (1–3 dpf, A–D) in parallel tracts (I, 34 hpf; J), with prominent lateral branching in the ventral area of the rhombomere 1–2 boundary (J). By 5 dpf, projections extend to the spinal cord and are highly arborized, also projecting locally within the midbrain hypothalamic area (F, H, and J).

 
In contrast to the moderate effects associated with mutations in regions 1, 3, and 4, altering three bases in region 2 dramatically reduced the activity of the 1-kb promoter fragment to 4% of the wild-type. We also deleted all 13 bases comprising region 2 at positions 670–682 of 1kb-zhcrt (TGCTAACGAAGCT). Of these 13 bases, 9 are conserved between zebrafish and Tetraodon, and 7 are conserved among zebrafish, Tetraodon, and Fugu (and also 7 between zebrafish Tetraodon and medaka). The result of this deletion was a complete loss of hcrt promoter activity. Bioinformatics analysis suggests that region 2 contains a potential core binding site for the Epstein-Barr virus Zta factor and an overlapping core site for c-MYB, but the regions of homology do not extend through the full recognition motifs. We did not note similarity between the region 2 motif and the OE1/OE2 elements of the human promoter (40).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We report the complete two-exon structure of the hypocretin gene in several teleosts, correcting a previous report suggesting a single exon (21). The position of the intron is conserved among these species and in mammals. The conservation of coding and noncoding sequences in the vicinity of our reported first exons adds support to our predicted gene structure in animals we studied strictly in silico (Fugu, stickleback, and medaka). We also noted conserved synteny of local genes including Stat3 Stat5a, hcrt, and Bec2/KCNH4 in zebrafish and Tetraodon compared with human and mouse. When compared with mammals, the predicted fish preprohypocretin protein is conserved in areas of known functional importance. Conservation of amino acids is most prominent at the C terminus of HCRT-1 and HCRT-2 (a region homologous between both peptides and of critical importance for HCRT receptor binding), as well as at the sites required for peptide cleavage. The pattern of conservation in teleost HCRT-2 (Fig. 1B) is in excellent agreement with previously reported functional studies (38). Substitutions of the 8 C-terminal amino acids of human HCRT-2 (A22-M28) caused significant drops in the affinity of the processed peptide for its receptor, whereas substitution in other areas, particularly in the N-terminal area, had minimal effects. The terminal 8 HCRT-2 residues have been retained in teleosts, with one conservative substitution. Interestingly, the zebrafish HCRT precursor protein is also somewhat different from other teleosts. A stretch of additional amino acids in fish compared with mammalian HCRT-1 is larger in zebrafish than in other fish (Fig. 1B). This region is not well conserved even among fishes and is therefore not predicted to have an important functional role.


Figure 5
View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 5.
Functional analysis of the hcrt promoter through transient expression of EGFP. Zebrafish DNA fragments containing 1 or 2 kb of sequences upstream from the initiation codon of hcrt (2kb-zhcrt-EGFP and 1kb-zhcrt-EGFP, also called {Delta}2000–1000) are shown in gray. Vertical lines mark (250 bp) increments of the functional 1-kb promoter that were deleted. Black ovals mark conserved regions selected for mutagenesis. Region 1, GenBankTM DQ831347 positions 653–662 CTCATTCTGT; region 2, positions 670–682 TGCTAACGAAGCT; region 3, positions 694–713 CCATAATAGTTGTTTTAAGA; and region 4, positions 725–744 TACAGGTAATCCTGGTTACA. Arrow and hatched section denote the start of transcription and 5'-untranslated region, with GFP coding sequences beginning at +63 (substituting at the native translational start site) in zebrafish constructs. The Tetraodon 1kb-thcrt-EGFP construct was less efficient than the native zebrafish promoter, although entirely specific. Promoter activity was assessed as the proportion of embryos displaying 1 or more fluorescent hcrt cells at 2 dpf and normalized to the wild-type 1-kb results. The region 2-1 and 2-2 constructs contained 3 substituted bases and 13 deleted bases, respectively. In addition to the teleost promoters, a characterized 3.2-kb human hcrt construct was also tested and was not functional in zebrafish.

 
We also establish a conserved position of hcrt cells in zebrafish compared with mammals, with Hcrt expression detected in a selected area of the hypothalamus in both zebrafish larvae (Fig. 2) and adults,5 although the location was more anterior than in mammals, in the rostral-medial hypothalamus. The onset of expression was remarkably early, at 22 hpf, at a time before differentiation and proliferation is com-plete, and suggests that the ligand is present before projections have been fully formed. Cell counts indicated that the hcrt cell groups form early in development and quickly reach 7–10 cells/hemisphere by day 7. During the first week of development, the cluster changes from a rostro-ventral to a more caudo-dorsal position. This apparent early single peak of hcrt cell birth is consistent with that seen in the rat (41). hcrt cells were generated in a single peak on embryonic day 12, based on bromodeoxyuridine labeling. Interestingly, this peak of hcrt cell birth was between two peaks of MCH cell genesis at embryonic days 11 and 13 with an overall peak of cell birth at embryonic day 12. We note that in zebrafish mch has an onset of expression later than hcrt, becoming detectable at 36 hpf (data not shown). Adult zebrafish hypothalami contain ~40 hcrt cells,5 indicating additional proliferation after day 10. The zebrafish thus offers an exciting and simplified vertebrate model for the study of these cells, in comparison with the roughly 70,000 hcrt cells in the adult human brain.

The exclusively hypothalamic localization reported here is in contrast to other reports in zebrafish, goldfish, and amphibians. In addition to a ventral hypothalamic hcrt cluster in zebrafish, Kaslin et al. (21) reported a much larger preoptic cluster of neurons that was observed only by immunostaining with antibodies to mammalian HCRT. The nature of this cluster was acknowledged as "putatively" hypocretinergic by these authors (21). In adult brain slices, we also observed strong immunostaining in the pretectal area clustered close to the ventricle in addition to weakly stained cells in the hypothalamus (data not shown). Consistent with previously reported results, however, only the small hypothalamic cluster of cells was seen with ISH, and these strongly stained cells were clearly more caudal and located in a region covered by the tectum. Cell counts at day 10 and in adults for this cluster were consistent with our ISH data (21). Other recent studies in three frogs and in goldfish also identified putatively hypocretinergic anteriorly placed cells in the preoptic/suprachiasmatic area (4245) using various antibodies directed against mammalian HCRTs. Overall, we believe that much of the previous anatomical work published to date has been confounded by antibody cross-reactivity. These results emphasize the importance of using species-specific reagents to minimize detection of cross-reacting epitopes in highly diverged proteins such as HCRT. Although there could be very low levels of expression in the preoptic area that result in detectable amounts of antigen, the relative intensity of ISH and immunostaining argue against this hypothesis. Rather, it appears that hcrt expression is highly localized in a single nucleus in zebrafish, leading us to examine the underlying regulation.

Our work also identified remarkably selective and compact promoters for the hypocretin gene in two teleosts, Tetraodon nigroviridis and Danio rerio. Efficiency and specificity of the zebrafish promoter were entirely retained when reducing the size from 2 to 1 kb, but beyond this, every change we introduced had variable but substantial effects on efficiency, without any loss of specificity. Most strikingly, even in the case of specific mutations, no ectopic expression was ever found. The region ~500 bases upstream of the reporter had the strongest effect. In this segment, we identified a 13-bp motif that, if disrupted, was able to entirely abolish promoter activity. Thus a hypocretin-specific transcriptional activator may exist that binds this motif. In a parsimonious model, such an activator may be required for hcrt transcription and act in the context of multiple additional transcriptional activators distributed along the 1-kb span to effect maximal transcriptional efficiency. The results of the serial deletions do not support the existence of essential repressor elements. This model is in contrast to regulation in mammals. Two regulatory elements, OE1 and OE2, were identified through human-mouse sequence comparisons and functionally tested by trangenesis (40). Deletion of OE1 induced ectopic expression in medial regions of the hypothalamus, including the arcuate nucleus, and restoration of proper localization was only obtained in the presence of OE2.

The Tetraodon promoter was also able to accurately drive expression, although at significantly lower levels than the wild-type zebrafish construct. The two promoters are highly diverged, reflecting the split of these lineages ~280 million years ago (46), a distance similar to that between humans and birds (300 million years ago). Short, conserved regulatory elements were not easily recognized in alignments or motif searches using only zebrafish and Tetraodon, and including Fugu, medaka, or stickleback in alignments allowed functionally conserved signal to emerge through the diverged nonfunctional background. A combination of alignments and motif discovery tools proved to be the most useful approach to identify potential functional areas and motifs, complementing our in vivo experimental evaluations using serial promoter sequence deletions. This approach was effective at identifying the 13-base pair region 2 as a putative functional element within this promoter, to be addressed by functional analysis.

The human hcrt promoter construct did not promote egfp expression in zebrafish. Promoter conservation spanning such phylogenetic distances has been reported; however, in the majority of cases, these are from genes critical for early development. Such promoter sequences are sufficiently constrained to allow identification of conserved noncoding sequences across vertebrates (19, 47, 48) and are found to promote EGFP expression in patterns consistent with the associated genes when assayed in zebrafish. Functional conservation across phylogenetic groups in the absence of apparent sequence conservation has also been recently reported at the RET receptor tyrosine kinase locus (49). Similar to results reported here, pufferfish sequences that were conserved with zebrafish drove EGFP expression consistent with the endogenous RET pattern. Surprisingly, a majority of sequences conserved among nonprimate mammals and without similarity to teleosts also drove expression consistent with zebrafish ret when assayed in zebrafish embryos. The interpretation is that the functional 4–20-bp elements were present but undetectable by conventional means. We were unable to find any striking homology between our most active promoter element (13-bp core of region 2) and the reported core functional 55 bp OE1 sequence. It is possible that the transcription factors binding this core 13-bp sequence could also be important for mammalian hypocretin gene regulation; however, the overall results of Moriguchi et al. (40) suggest this is not the case. Rather, determination of hcrt expression by various transcription factors is likely to be somewhat different between fish and mammals. Indeed the basal promoters of mammals and zebrafish are different, with a CAAT box identified in human as opposed to a TATA box in fish. Several reports suggest an active interferon regulatory factor-1 site in the human hcrt promoter acts to down-regulate transcription (50, 51). There are also potential core interferon response elements in zebrafish and Tetraodon. No effects could be attributed to the deletion of these sites in our assay; however, it is possible that interferon could have modulatory effects on hcrt transcription in zebrafish.

The compact promoter is able to completely mimic the native hcrt pattern and allowed us to characterize hypocretin cell development and projections during early development. We found all projections to be ipsilateral at these stages. Two major types of projections were noted: 1) a long posterior projection reaching the spinal cord, with accessory branching on the way (Fig. 4, A–D, I, and J), and 2) more highly arborized local set of projections extending laterally in an umbrella-shaped network of terminals (Fig. 4, F and H). This pattern of projections is roughly consistent with mammalian neuroanatomy (3, 52, 53). In rats, the highest density of anterior projections is directed to the basal forebrain area (3, 53), immediately anterior to the hypothalamus. Dense hypothalamic projections are also noted in mammals, although in contrast to zebrafish, many are also located medial to the hypocretin cell group. Posteriorly, mammalian hypocretin cells project heavily to the brain stem areas and beyond. In rats, HCRT strongly innervates the spinal cord from cervical to sacral segments (54) and has therefore been proposed to have some role in modulating sensory input, particularly nociception, and autonomic tone. Interestingly, the long posterior projection observed in zebrafish was associated with significant branching in the rostral hindbrain region, in a region equivalent to major innervation sites of the brainstem in mammals (such as the locus coeruleus) (3, 53). Whether or not these additional projections will contact aminergic and cholinergic cell groups located nearby in zebrafish as reported in mammals and suggested by Kaslin (21) will require additional work. The regulation of aminergic (especially histaminergic) and cholinergic nuclei by hypocretin has been suggested to be of functional importance in the regulation of sleep (5558); conservation in zebrafish would bolster the use of this model for the study of sleep and wakefulness.

In conclusion, we have characterized the early stages of hcrt development in the zebrafish and have characterized a minimal promoter. Such a promoter will be an invaluable resource for the study of this system at the neurobiological and developmental level and can be used to generate animal models for functional studies. At the molecular level, these tools may allow the identification of hypocretin-specific transcriptional activators, as well as providing a resource for identifying novel downstream factors modulated by hypocretin activity. There are clear links demonstrating the similarity between these cells in zebrafish and mammals, and an understanding of the development, differentiation, and establishment of network will be valuable in translational studies for human narcolepsy. The simplified organization of the zebrafish hypocretin systems offers a unique opportunity: the study of the formation of a network of neurons of importance for the regulation of sleep and metabolism.


    FOOTNOTES
 
* This work was supported by the MacKnight Foundation and the Howard Hughes Medical Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 These authors contributed equally to this work. Back

2 Howard Hughes Medical Institute Investigator. To whom correspondence should be addressed: Center for Narcolepsy Research, 701B Welch Road, Palo Alto, CA 94304-5742. Tel.: 650-725-6517; Fax: 650-725-725-4913; E-mail: mignot{at}stanford.edu.

3 The abbreviations used are: HCRT, hypocretin; EGFP, enhanced green fluorescent protein; ISH, in situ hybridization; hpf, hours post-fertilization; dpf, days post-fertilization; RACE, rapid amplification of cDNA ends; contig, group of overlapping clones. Back

4 Human hcrt-EGFP promoter construct kindly provided by T. Sakurai (Japan). Back

5 ISH on adult brains was performed by K. Eriksson (Stanford University). Data not shown. Back


    ACKNOWLEDGMENTS
 
We thank K. Eriksson, who provided helpful discussions, and L. Alexandre, who provided excellent care for our animals.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Beuckmann, C. T., and Yanagisawa, M. (2002) J. Mol. Med. 80, 329–342[CrossRef][Medline] [Order article via Infotrieve]
  2. Thannickal, T. C., Moore, R. Y., Nienhuis, R., Ramanathan, L., Gulyani, S., Aldrich, M., Cornford, M., and Siegel, J. M. (2000) Neuron 27, 469–474[CrossRef][Medline] [Order article via Infotrieve]
  3. Peyron, C., Tighe, D. K., van den Pol, A. N., de Lecea, L., Heller, H. C., Sutcliffe, J. G., and Kilduff, T. S. (1998) J. Neurosci. 18, 9996–10015[Abstract/Free Full Text]
  4. Lin, L., Faraco, J., Li, R., Kadotani, H., Rogers, W., Lin, X., Qiu, X., de Jong, P. J., Nishino, S., and Mignot, E. (1999) Cell 98, 365–376[CrossRef][Medline] [Order article via Infotrieve]
  5. Chemelli, R. M., Willie, J. T., Sinton, C. M., Elmquist, J. K., Scammell, T., Lee, C., Richardson, J. A., Williams, S. C., Xiong, Y., Kisanuki, Y., Fitch, T. E., Nakazato, M., Hammer, R. E., Saper, C. B., and Yanagisawa, M. (1999) Cell 98, 437–451[CrossRef][Medline] [Order article via Infotrieve]
  6. Peyron, C., Faraco, J., Rogers, W., Ripley, B., Overeem, S., Charnay, Y., Nevsimalova, S., Aldrich, M., Reynolds, D., Albin, R., Li, R., Hungs, M., Pedrazzoli, M., Padigaru, M., Kucherlapati, M., Fan, J., Maki, R., Lammers, G. J., Bouras, C., Kucherlapati, R., Nishino, S., and Mignot, E. (2000) Nat. Med. 6, 991–997[CrossRef][Medline] [Order article via Infotrieve]
  7. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., and Mignot, E. (2000) Lancet 355, 39–40[CrossRef][Medline] [Order article via Infotrieve]
  8. Mignot, E., Lammers, G. J., Ripley, B., Okun, M., Nevsimalova, S., Overeem, S., Vankova, J., Black, J., Harsh, J., Bassetti, C., Schrader, H., and Nishino, S. (2002) Arch. Neurol. 59, 1553–1562[Abstract/Free Full Text]
  9. Blouin, A. M., Thannickal, T. C., Worley, P. F., Baraban, J. M., Reti, I. M., and Siegel, J. M. (2005) Neurology 65, 1189–1192[Abstract/Free Full Text]
  10. Crocker, A., Espana, R. A., Papadopoulou, M., Saper, C. B., Faraco, J., Sakurai, T., Honda, M., Mignot, E., and Scammell, T. E. (2005) Neurology 65, 1184–1188[Abstract/Free Full Text]
  11. Juji, T., Satake, M., Honda, Y., and Doi, Y. (1984) Tissue Antigens 24, 316–319[Medline] [Order article via Infotrieve]
  12. Mignot, E., Lin, L., Rogers, W., Honda, Y., Qiu, X., Lin, X., Okun, M., Hohjoh, H., Miki, T., Hsu, S., Leffell, M., Grumet, F., Fernandez-Vina, M., Honda, M., and Risch, N. (2001) Am. J. Hum. Genet. 68, 686–699[CrossRef][Medline] [Order article via Infotrieve]
  13. Chabas, D., Taheri, S., Renier, C., and Mignot, E. (2003) Annu. Rev. Genomics Hum. Genet. 4, 459–483[CrossRef][Medline] [Order article via Infotrieve]
  14. Stuart, G. W., McMurray, J. V., and Westerfield, M. (1988) Development 103, 403–412[Abstract]
  15. Nasevicius, A., and Ekker, S. C. (2000) Nat. Genet. 26, 216–220[CrossRef][Medline] [Order article via Infotrieve]
  16. Dickmeis, T., Plessy, C., Rastegar, S., Aanstad, P., Herwig, R., Chalmel, F., Fischer, N., and Strahle, U. (2004) Genome. Res. 14, 228–238[Abstract/Free Full Text]
  17. Amsterdam, A., and Becker, T. S. (2005) Dev. Dyn. 234, 255–268[CrossRef][Medline] [Order article via Infotrieve]
  18. Ellingsen, S., Laplante, M. A., Konig, M., Kikuta, H., Furmanek, T., Hoivik, E. A., and Becker, T. S. (2005) Development 132, 3799–3811[Abstract/Free Full Text]
  19. Plessy, C., Dickmeis, T., Chalmel, F., and Strahle, U. (2005) Trends Genet. 21, 207–210[CrossRef][Medline] [Order article via Infotrieve]
  20. Gomez-Skarmeta, J. L., Lenhard, B., and Becker, T. S. (2006) Dev. Dyn. 235, 870–885[CrossRef][Medline] [Order article via Infotrieve]
  21. Kaslin, J., Nystedt, J. M., Ostergard, M., Peitsaro, N., and Panula, P. (2004) J. Neurosci. 24, 2678–2689[Abstract/Free Full Text]
  22. Zhdanova, I. V., Wang, S. Y., Leclair, O. U., and Danilova, N. P. (2001) Brain Res. 903, 263–268[CrossRef][Medline] [Order article via Infotrieve]
  23. Yokogawa, T., Zhang, J., and Mignot, E. (2006) Sleep 29, A36
  24. Zhdanova, I. V. (2006) Zebrafish 3, 215–226[Medline] [Order article via Infotrieve]
  25. Kaslin, J., and Panula, P. (2001) J. Comp. Neurol. 440, 342–377[CrossRef][Medline] [Order article via Infotrieve]
  26. Renier, C., Faraco, J., and Mignot, E. (2006) Sleep 29, A360
  27. Eriksson, K. S., Peitsaro, N., Karlstedt, K., Kaslin, J., and Panula, P. (1998) Eur. J. Neurosci. 10, 3799–3812[CrossRef][Medline] [Order article via Infotrieve]
  28. Peitsaro, N., Anichtchik, O. V., and Panula, P. (2000) J. Neurochem. 75, 718–724[CrossRef][Medline] [Order article via Infotrieve]
  29. Holzschuh, J., Ryu, S., Aberger, F., and Driever, W. (2001) Mech. Dev. 101, 237–243[CrossRef][Medline] [Order article via Infotrieve]
  30. Bellipanni, G., Rink, E., and Bally-Cuif, L. (2002) Gene. Expr. Patterns 2, 251–256[CrossRef][Medline] [Order article via Infotrieve]
  31. Arenzana, F. J., Clemente, D., Sanchez-Gonzalez, R., Porteros, A., Aijon, J., and Arevalo, R. (2005) Brain Res. Bull 66, 421–425[CrossRef][Medline] [Order article via Infotrieve]
  32. Westerfield, M. (1993) The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio rerio), 2nd Ed., University of Oregon Press, Eugene, OR
  33. Kel, A. E., Gossling, E., Reuter, I., Cheremushkin, E., Kel-Margoulis, O. V., and Wingender, E. (2003) Nucleic Acids Res. 31, 3576–3579[Abstract/Free Full Text]
  34. Blanchette, M., and Tompa, M. (2003) Nucleic Acids Res. 31, 3840–3842[Abstract/Free Full Text]
  35. Hauptmann, G., and Gerster, T. (1994) Trends Genet. 10, 266[CrossRef][Medline] [Order article via Infotrieve]
  36. Jowett, T., and Lettice, L. (1994) Trends Genet. 10, 73–74[CrossRef][Medline] [Order article via Infotrieve]
  37. Miyoshi, K., Cui, Y., Riedlinger, G., Robinson, P., Lehoczky, J., Zon, L., Oka, T., Dewar, K., and Hennighausen, L. (2001) Genomics 71, 150–155[CrossRef][Medline] [Order article via Infotrieve]
  38. Asahi, S., Shin-ichiro, E., Matsuda, M., Iwaasa, H., Kanatani, A., Ohkubo, M., Ihara, M., Sakurai, T., and Morishima, H. (2000) in Peptide Science 1999 (Fujii, N., ed) pp. 37–40, Protein Research Foundation, Toyonata, Japan
  39. Sakurai, T., Moriguchi, T., Furuya, K., Kajiwara, N., Nakamura, T., Yanagisawa, M., and Goto, K. (1999) J. Biol. Chem. 274, 17771–17776[Abstract/Free Full Text]
  40. Moriguchi, T., Sakurai, T., Takahashi, S., Goto, K., and Yamamoto, M. (2002) J. Biol. Chem. 277, 16985–16992[Abstract/Free Full Text]
  41. Amiot, C., Brischoux, F., Colard, C., La Roche, A., Fellmann, D., and Risold, P. Y. (2005) Eur. J. Neurosci. 22, 531–534[CrossRef][Medline] [Order article via Infotrieve]
  42. Shibahara, M., Sakurai, T., Nambu, T., Takenouchi, T., Iwaasa, H., Egashira, S. I., Ihara, M., and Goto, K. (1999) Peptides 20, 1169–1176[CrossRef][Medline] [Order article via Infotrieve]
  43. Galas, L., Vaudry, H., Braun, B., Van Den Pol, A. N., De Lecea, L., Sutcliffe, J. G., and Chartrel, N. (2001) J. Comp. Neurol. 429, 242–252[CrossRef][Medline] [Order article via Infotrieve]
  44. Huesa, G., van den Pol, A. N., and Finger, T. E. (2005) J. Comp. Neurol. 488, 476–491[CrossRef][Medline] [Order article via Infotrieve]
  45. Singletary, K. G., Delville, Y., Farrell, W. J., and Wilczynski, W. (2005) Brain Res. 1041, 231–236[CrossRef][Medline] [Order article via Infotrieve]
  46. Kumazawa, Y., Yamaguchi, M., and Nishida, M. (1999) The Biology of Biodiversity, pp. 35–52, Springer-Verlag New York Inc., New York
  47. Goode, D. K., Snell, P., Smith, S. F., Cooke, J. E., and Elgar, G. (2005) Genomics 86, 172–181[CrossRef][Medline] [Order article via Infotrieve]
  48. Woolfe, A., Goodson, M., Goode, D. K., Snell, P., McEwen, G. K., Vavouri, T., Smith, S. F., North, P., Callaway, H., Kelly, K., Walter, K., Abnizova, I., Gilks, W., Edwards, Y. J., Cooke, J. E., and Elgar, G. (2005) PLoS Biol. 3(1): e7[CrossRef][Medline] [Order article via Infotrieve]
  49. Fisher, S., Grice, E. A., Vinton, R. M., Bessling, S. L., and McCallion, A. S. (2006) Science 312, 276–279[Abstract/Free Full Text]
  50. Waleh, N. S., Apte-Deshpande, A., Terao, A., Ding, J., and Kilduff, T. S. (2001) Gene (Amst.) 262, 123–128[CrossRef][Medline] [Order article via Infotrieve]
  51. Ogawa, Y. K. T., Yano, T., Sawaishi, Y., Saito, Y., and Shimizu, T. (2003) Sleep Biol. Rhythms 1, 143–145[CrossRef]
  52. van den Pol, A. N., Gao, X. B., Obrietan, K., Kilduff, T. S., and Belousov, A. B. (1998) J. Neurosci. 18, 7962–7971[Abstract/Free Full Text]
  53. Nambu, T., Sakurai, T., Mizukami, K., Hosoya, Y., Yanagisawa, M., and Goto, K. (1999) Brain Res. 827, 243–260[CrossRef][Medline] [Order article via Infotrieve]
  54. van den Pol, A. N. (1999) J. Neurosci. 19, 3171–3182[Abstract/Free Full Text]
  55. Huang, Z. L., Qu, W. M., Li, W. D., Mochizuki, T., Eguchi, N., Watanabe, T., Urade, Y., and Hayaishi, O. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 9965–9970[Abstract/Free Full Text]
  56. Taheri, S., Zeitzer, J. M., and Mignot, E. (2002) Annu. Rev. Neurosci. 25, 283–313[CrossRef][Medline] [Order article via Infotrieve]
  57. Shigemoto, Y., Fujii, Y., Shinomiya, K., and Kamei, C. (2004) Brain Res. 1023, 121–125[CrossRef][Medline] [Order article via Infotrieve]
  58. Bernard, R., Lydic, R., and Baghdoyan, H. A. (2006) J. Pharmacol. Exp. Ther. 317, 163–171[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Neurosci.Home page
D. A. Prober, J. Rihel, A. A. Onah, R.-J. Sung, and A. F. Schier
Hypocretin/Orexin Overexpression Induces An Insomnia-Like Phenotype in Zebrafish
J. Neurosci., December 20, 2006; 26(51): 13400 - 13410.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/40/29753    most recent
M605811200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Faraco, J. H.
Right arrow Articles by Mignot, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Faraco, J. H.
Right arrow Articles by Mignot, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement