HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 281, Issue 41, 30755-30767, October 13, 2006

This Article Abstract Full Text (PDF) All Versions of this Article: 281/41/30755    most recent M605190200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Demarest, S. J. Articles by Kehry, M. R. Search for Related Content PubMed PubMed Citation Articles by Demarest, S. J. Articles by Kehry, M. R. Social Bookmarking                      What's this?

An Intermediate pH Unfolding Transition Abrogates the Ability of IgE to Interact with Its High Affinity Receptor FcRI^*

From the Biogen Idec, San Diego, California 92122

Received for publication, May 31, 2006 , and in revised form, July 25, 2006.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The interaction between IgE-Fc (Fc) and its high affinity receptor FcRI on the surface of mast cells and basophils is a key event in allergen-induced allergic inflammation. Recently, several therapeutic strategies have been developed based on this interaction, and some include Fc-containing moieties. Unlike well characterized IgG therapeutics, the stability and folding properties of IgE are not well understood. Here, we present comparative biophysical analyses of the pH stability and thermostability of Fc and IgG1-Fc (Fc). Fc was found to be significantly less stable than Fc under all pH and NaCl conditions tested. Additionally, the C3C4 domains of Fc were shown to become intrinsically unfolded at pH values below 5.0. The interaction between Fc and an Fc-FcRI fusion protein was studied between pH 4.5 and 7.4 using circular dichroism and a combination of differential scanning calorimetry and isothermal titration calorimetry. Under neutral pH conditions, the apparent affinity of Fc for the dimeric fusion protein was extremely high compared with published values for the monomeric receptor (K_D < 10^-12 M). Titration to pH 6.0 did not significantly change the binding affinity, and titration to pH 5.5 only modestly attenuated affinity. At pH values below 5.0, the receptor binding domains of Fc unfolded, and interaction of Fc with the Fc-FcRI fusion protein was abrogated. The unusual pH sensitivity of Fc may play a role in antigen-dependent regulation of receptor-bound, non-circulating IgE.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Immunoglobulin E (IgE) is important for host defense against parasites and for protective inflammation. Yet, IgE-mediated signaling through its receptors is also a focal point of inflammatory allergic disease (1). The constant domain of IgE (Fc) is responsible for binding to its two receptors, FcRI and CD23 (also known as FcRII). FcRI is expressed on the surface of mast cells, basophils, and some antigen presenting cells in humans (2, 3), whereas FcRII is expressed primarily on antigen presenting cells, including B-cells (4). Binding of IgE to FcRI, in particular, leads to increased levels of FcRI on the cell surface, up-regulation of proteins involved in cell survival pathways, and cellular sensitization for an allergic event (2, 5-7). Cross-linking of cell surface IgE·FcRI complexes with multivalent antigens or anti-IgE antibodies leads to receptor signaling and cellular degranulation, the release of preformed secretory granules containing histamine, serotonin, various lipids, proteases, and other acute inflammatory agents, and the expression and release of inflammatory cytokines (1). Receptor cross-linking also leads to endocytosis of aggregated IgE·FcRI complexes and exposure to endosomes and lysosomes. Endocytosis is a potentially important pathway for IgE regulation and FcRI turnover during an antigen-mediated allergic response (8-10).

FcRI expressed on mast cells and basophils is a heterotetramer consisting of one , one , and two chains (1). The chain, an immunoglobulin family member, is the subunit responsible for high affinity binding of IgE (K_D 10^-10 M) (11). It has been shown that mice lacking B cells and passively sensitized with anti-trinitrophenyl IgE respond to antigen treatment or anti-IgE for more than 1 month following IgE administration even with the absence of detectable serum IgE (12). This implies that high affinity between IgE and FcRI translates into an incredibly long in vivo half-life of the complex on the surface of mast cells and basophils.

The Fc/FcRI interaction occurs in a structurally homologous manner to what has been observed for IgG₁ constant domain (Fc) binding to FcRI-III (13-15). Domain 2 of the FcRI subunit interacts with the homodimeric interface of the C3 domains of Fc.C4ofFc does not participate directly in the binding but is crucial for maintaining high affinity (16-18).² The C2 domain, which is unique to IgE and virtually replaces the hinge found in IgG, is much less involved in binding but plays an important role in controlling the proper IgE/FcRI stoichiometry and binding kinetics (17, 19).

The production and purification of IgGs, particularly human IgG1, for diagnostic or therapeutic applications is now fairly routine. IgE-based therapeutics, however, have only recently begun to build some momentum (20-22). Unlike IgG therapeutics, standard methods for producing, handling, and formulating IgE or Fc, particularly at an industrial scale, have not been established. In particular, it is not known whether Fc is similar to Fc in terms of its thermostability and pH sensitivity. Exposure to destabilizing conditions could lead to denaturation or aggregation. Even low levels of Fc dimer or higher order aggregates could have profound effects on cellular or in vivo functional assays by inadvertently cross-linking FcRI in the absence of antigen (5, 7). Our initial studies revealed an unusual sensitivity of Fc to various buffer and pH conditions. This led us to characterize in detail the biophysical properties of Fc important for maintaining IgE-FcRI interactions and for IgE half-life.

Here we describe detailed biophysical analyses of Fc focused on deriving domain-specific unfolding information for Fc and how buffer conditions, particularly pH, affect FcRI binding. Using circular dichroism (CD)³ and differential scanning calorimetry (DSC), we demonstrate that Fc is much less thermostable than Fc. The native structure of Fc is also highly sensitive to intermediate pH levels (5.0 and below) and high ionic strength. Binding of Fc to an Fc-FcRI fusion protein is extremely high affinity at all pH values where Fc remains folded. Unfolding of the C3 and C4 domains below pH 5.0 abolishes Fc binding to the Fc-FcRI fusion. This pH-dependent unfolding property of Fc may be important for providing a mechanism of IgE release from its high affinity receptor inside the cell and may help define a unique pathway for the regulation of receptor-bound IgE in vivo.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Subcloning of Fc, Fc, Fc-C2, Fc-C2C3, and Fc-FcRI-Fc was subcloned from mRNA extracted from human blood B cells (CD20+ and CD20+ IgM-). Complementary DNA primers, GTCACTATGCCACCATCAGCTTG and TTTACCGGGATTTACAGACACCGC, which amplify from the C terminus of the C1 domain to the C terminus of the C4 domain, were used to create an Fc vector insert via PCR. The resulting insert was cloned into a TA vector (TOPO TA cloning kit, Invitrogen). The modified TA vector was used as template for PCR using primers GCGGCCGCCTCACCATGGGCTGGAGCCTGATCCTGCTGTTCCTGGTGGCCGTGGCCACCCGCGTGCTGAGCTTCACCCCGCCCACCGTGAA and CGTCGTTTAATTAATCATTTACCGGGATTTACAG. The resulting PCR product was also introduced into the TA vector. After sequencing the 2nd generation TA vector, a fragment was digested from the vector using the enzymes NotI and PacI and ligated into the expression vector PV-90 (Biogen Idec). The theoretical subcloned sequence following signal processing was (in Kabat numbering) ²⁴⁸FTPP... PGK⁶¹⁰ (23). The plasmid was introduced into CHO cells by electroporation. Clones were selected with geneticin (Invitrogen). An N-terminal signal sequence, MGWSLILLFLVAVATRVLS, was built-in to the expression vector for secretion into the media and was included for the majority of the protein constructs described here (24). Cells were cultured for 14 days at 28 °C, 5% CO₂ humidified air, in BCM16 serum-free media. A secreted, dimeric protein of the expected molecular mass, 71.3 kDa (as per SDS-PAGE and static light scattering analysis), was found in the media following culture. The Fc protein identity was also confirmed by Edman degradation and intact mass analysis.

An in-house vector containing the constant region of human IgG₁ was used as template for PCR amplification of human Fc using primers GCGGCCGCCTCACCATGGGCTGGAGCCTGATCCTGCTGTTCCTGGTGGCCGTGGCCACCCGCGTGCTGAGCGAGCCCAAATCTTGTGACAA and TTAATTAATCATTTACCCGGAGACAGG. The PCR product was cloned into the TA vector and sequenced in-house. The remaining plasmid manipulations, transfections, and cell culture were performed as described above for Fc. The mature sequence of the Fc protein was predicted to be ²²⁶EPK... PGK⁴⁷⁸. The secreted, dimeric protein was found to have an average mass 56.4 kDa by SDS-PAGE and static light scattering analyses. Mass analysis with the purified protein reduced with dithiothreitol and treated with PNGase F yielded a dominant ion at 25,964 kDa corresponding to mature Fc with the C-terminal lysine cleaved at >90%. Cys²³⁰ (residue 5 in the mature protein) forms a disulfide bond with light chain in full-length IgG₁. No nonnative inter- or intra-molecular disulfides were detected following long term (i.e. several months) incubation at 4 °C.

The chimeric protein, Fc-FcRI, containing human Fc connected at its C terminus (Nterm-²²⁶EPK...SPG⁴⁷⁷-Cterm) by a 9-amino acid linker, SRENLYFQG, to the N terminus of human FcRI (starting with -VPQ...), was created for enhanced receptor expression. The human FcRI DNA insert encoding the extracellular domain without its signal peptide (Val²⁶ to Tyr²⁰², residue numbering includes signal peptide) was obtained by PCR from IMAGE clone 4294467 (ATCC) using the primers GCGGCGTCTAGAGAGAACCTGTACTTCCAGGGCGTCCCTCAGAAACCTAAGGTC and GCGGCGGTCGACGAATTCTTAGTACTTCTCACGCGGAGCTT. The PCR product was subsequently digested with XbaI and SalI and subcloned into a modified INPEP4-Fc vector containing a signal peptide of the mouse -light chain fused to the human immunoglobulin heavy chain IgG₁ constant region (Fc) (Kabat number 226-477). The Fc portion contained a T318A (EU299) mutation that abolishes glycosylation at Asn³¹⁴ (EU297). The C-terminal Lys on Fc was not included because this residue was cleaved at >90% within the cell culture for Fc (see above). The plasmid was transfected into dihydrofolate reductase-CHO DG44 cells using electroporation (25) and cloned in medium containing CHO-S-SFMII (Invitrogen) supplemented with HT (Invitrogen) in the presence of 400 µg/ml G418 (Invitrogen) using the limiting dilution method. Cell culture was performed using the same protocols as used for the Fc producing CHO cells.

The chimeric proteins, Fc-C2 and Fc-C2C3, were prepared by linking the C2orC2C3 domains of IgE to the C terminus of Fc via a 15-amino acid linker GSGGS(GGGGS)₂. The C-terminal Lys on Fc was also not included here. The sequences of the Fc-C2 and Fc-C2C3 protein domains began at the same N terminus as the above Fc construct and contained the following C termini:... SNP³⁶⁴ for Fc-C2 and... GPR⁴⁹⁹ for Fc-C2C3. CHO cell lines producing high titers of Fc-C2 and Fc-C2C3 were subcloned from the bulk transformants using the method of Brezinsky et al. (26) and cultured using the same protocol as described for the Fc CHO clone.

Protein Purification—Purifications were performed using an AKTA Explorer (GE-Healthcare). CHO cell media containing Fc was titrated to pH 9.0 using 1 M Tris base, diluted 10 times with distilled deionized H₂O, and loaded on a Q Sepharose column equilibrated in 20 mM, Tris, pH 9.0, at 10 ml/min. The column was washed with running buffer, and Fc was eluted using a linear gradient to 200 mM NaCl. Fc eluted between 110 and 170 mM. To concentrate the protein, the eluant was diluted 10 times, passed over a 60-ml Q Sepharose column, washed, and eluted in a single step using 20 mM Tris, 1 M NaCl, pH 9.0. The concentrated eluant was titrated to pH 8.0 using 2 M NaCH₃COO, pH 5.0, and further concentrated using an Amicon stir unit with a 10,000 M_r cut-off YM10 membrane, and passed over a 350-ml Superdex 200 column equilibrated with PBS to remove aggregates, multimers, and remaining contaminants. Purified Fc was concentrated using an Amicon Ultra-15 centrifugal filter device, 10,000 M_r (Millipore). Protein concentration was measured by AU_{280 nm} using an extinction coefficient of 1.4 ml mg^-1 cm^-1.

CHO supernatants containing recombinant Fc, Fc-FcRI, or Fc-C2 were loaded onto a Protein A-Sepharose FF (Amersham Biosciences) column equilibrated with 50 mM Tris, 500 mM NaCl buffer at pH 7.5. The column was washed and protein was eluted using a step gradient to 100% 100 mM glycine, pH 3.0. Protein-containing fractions were titrated to about pH 7.0 using 1 M Tris base, pooled, and dialyzed against PBS. The Fc-FcRI fusion protein was further purified by size exclusion chromatography (SEC) as described above for Fc. Purified Fc, Fc-FcRI, and Fc-C2 were concentrated in the same manner as Fc.Fc and Fc-FcRI concentrations were determined by AU_{280 nm} using extinction coefficients of 1.4 and 1.9 ml mg^-1 cm^-1, respectively. Fc-C2 concentration was determined using the modified Lowry method and bovine IgG as the standard.

Analytical Size Exclusion Chromatography with In-line Static Light Scattering—Various pH samples of Fc and Fc were prepared by dilution of 1.8 and 4.0 mg/ml stocks, respectively, into 25 mM phosphate, 25 mM citrate, 150 mM NaCl buffers at pH 2, 3, 4, 4.5, 5.0, 5.3, 5.7, 6.0, 6.5, 7.0, 8.0, and 9.0. Final protein concentrations were 320 µg/ml. Additional samples were prepared by diluting the Fc and Fc stocks into 25 mM phosphate, 25 mM citrate, 750 mM NaCl at pH 4, 5, and 6. The stock solutions were in PBS (10 mM phosphate, pH 7.4, 140 mM salt). All samples were incubated for 3 or more hours at room temperature before analysis. Eighty µl of each sample was injected onto a TSKgel G3000SW XL, 5 mm, 250-Å Analytical SEC column (Tosoh Biosciences) equilibrated in 10 mM phosphate, 150 mM NaCl, 0.02% sodium azide at pH 7.2 using an Agilent 1100 HPLC system. Whereas injection of the various pH samples onto the SEC column using a similar running buffer may result in some protein refolding or re-equilibration, the running buffer was amenable for the column and allowed for uniform comparison of elution times via the use of a single running buffer. Light scattering data for material eluting from the SEC column were collected using a miniDAWN static light scattering detector coupled to an in-line refractive index meter (Wyatt Technologies). Light scattering data were analyzed using the ASTRA V software provided by the manufacturer.

ANS Binding—The fluorescence of 1-anilino-8-naphthalene sulfonate (ANS, Sigma) was measured using a Victor3 multilabel fluorescence plate reader (PerkinElmer Life Sciences) with a 360 ± 20 nm excitation cutoff filter and a 460 ± 20 nm emission cutoff filter. All fluorescence measurements were made using 96-well fluorescence plates (NUNC MaxisorbF) with 150 µl/well and a 0.1-s sample averaging period per well. ANS (20 µM) was incubated with 20, 40, 80, 160, and 320 µg/ml bovine -lactalbumin (Sigma) at pH 2.0 and 7.0 to establish appropriate protein concentrations to obtain adequate signal to noise. At 80 µg/ml -lactalbumin at pH 2.0, the ANS fluorescence signal was 20-fold higher than the noise; therefore, 80 µg/ml protein concentrations were utilized for the Fc and Fc measurements. To study ANS binding to Fc or Fc, each protein was diluted into a 25 mM phosphate, 25 mM citrate, 150 mM NaCl buffer series at pH 2, 3, 4, 4.5, 5.0, 5.3, 5.7, 6.0, 6.5, 7.0, 8.0, and 9.0 and incubated with the fluorescent dye. Additional Fc and Fc samples were prepared in 25 mM phosphate, 25 mM citrate, 750 mM NaCl at pH 4.0, 5.0, and 6.0.

CD Spectroscopy—CD measurements were performed using a Jasco J-810 spectropolarimeter equipped with a thermoelectric Peltier device for temperature control and an external water bath as a heat sink. Fc, Fc, and Fc-FcRI spectra (195-260 nm) were taken using the continuous scan mode at 100 nm/min. Bandwidth was set to 1 nm and data pitch to 0.2 nm. The response time of the instrument was set to 1 s. Five spectra were averaged for increased signal to noise. All spectra were taken at 25 °C. Fc, Fc, and Fc-FcRI samples were dialyzed against 10 mM sodium citrate, 10 mM NaCl at pH 4.5, 5.0, 5.5, and 6.0. Additional Fc, Fc, and Fc-FcRI samples at pH 7.4 were prepared by dialysis against PBS. To map the apparent unfolding transition of Fc in detail, additional Fc samples were prepared by dialysis against the same citrate buffer at pH 4.8 and 5.2. Background buffer scans at pH 5.0, 6.0, and 7.4 were virtually identical; therefore, all background subtractions were performed using the pH 5.0 background spectrum. All CD spectra were obtained using 3.75 µM protein with the dimer molecular mass (71.8 kDa) used for Fc and the monomer molecular mass used for Fc (24.7 kDa) and the divalent Fc-FcRI fusion protein (49.8 kDa). Thermal melts of Fc were performed in the cuvette by heating the samples at 5 °C intervals at a rate of 1 °C/min. Between each 5 °C heating interval, three replicate scans were performed using the parameters described above.

Limited Proteolysis and LC/MS—Fc was digested by trypsin and Glu-C at pH 4.5, where significant protein structural changes away from the natively folded material occurred. Five samples were prepared by diluting 1 mg of Fc into 0.4 ml of 70 mM sodium acetate solutions at pH 4.5. The pH of the acetate solution was unperturbed subsequent to the addition of Fc in PBS. Various concentrations of trypsin (30, 300, and 3000 units, Sigma T-1426) and endoproteinase Glu-C (10 and 100 units, Sigma P-2922) were added to individual pH 4.5 Fc samples. Digestions were incubated at 37 °C. Time points (100 µl) were taken for LC/MS analysis after 0, 2, 10, 60, and 300 min and after overnight incubation. Proteolysis was halted by the addition of 50 mM EDTA and 10 mM phenylmethylsulfonyl fluoride. Dithiothreitol was then added to >10 mM for disulfide reduction, and each time point was subsequently frozen at -80 °C. Reagent blanks containing trypsin or Glu-C but excluding Fc were also prepared for identifying non-Fc peaks in the LC chromatograms. Based on the level of proteolysis observed by SDS-PAGE analysis, the 30-unit trypsin and 100-unit Glu-C samples were chosen for LC/MS peptide mass mapping. All time points were analyzed by HPLC MS as described previously (27). Total ion chromatograms were analyzed using the Agilent Deconvolution and Peptide Tools software programs.

DSC—DSC scans were performed using an automated capillary DSC (capDSC, MicroCal, LLC). Protein and reference solutions were sampled automatically from 96-well plates using the robotic attachment. Prior to each protein scan, two buffer scans were performed to define the baseline for subtraction. All 96-well plates containing protein were stored within the instrument at 6 °C.

For the Fc and Fc pH titrations (Figs. 3, B and C, and 4, A and B), three separate pH panels were created with 15, 150, or 750 mM NaCl. The buffers included 70 mM glycine at pH 2.8, 3.3, and 3.5; 70 mM sodium acetate at pH 4.0, 4.5, 4.8, 5.0, and 5.2; 35 mM sodium citrate at pH 5.5, 6.0, and 6.5; and 35 mM Tris at pH 7.0, 7.5, and 8.0. Stock solutions of Fc and Fc at 1.8 and 4.0 mg/ml, respectively, in PBS were diluted to 0.5 mg/ml in each buffer solution. Identical PBS dilutions into all members of the buffer panel were made for baseline measurements, and it was confirmed that the pH of each sample was not altered by the residual PBS. Scans were performed from 10 to 90 °C at 1 °C/min using the medium feedback mode for enhanced peak resolution. Additionally, the Fc and Fc-C2 proteins were co-dialyzed against 10 mM sodium phosphate, 15 mM NaCl, pH 2.5, diluted to 1 mg/ml with dialysate, and scanned under identical conditions as described for the buffer panel.

For measurement of the thermodynamic interaction parameters between Fc and Fc-FcRI, each protein was dialyzed against a panel of buffer solutions at pH 4.5, 5.0, 5.5, 6.0, and 7.4 as described above for the CD experiments. Using the dimeric molecular weight for apo- and holo-Fc and the monomeric molecular weight for apo- and holo-Fc-FcRI, 2.5 µM protein solutions were prepared using matched dialysates for dilution and incubated for at least 2 h at 4°C prior to DSC analysis. Dialysates were used within the reference cell of the calorimeter to define the baseline of each protein scan. Additional baseline corrections were performed by scanning with dialysate in both the reference and sample cells. For the binding experiments, scans were performed from 20 to 95 °C using a scan rate of 4.0 °C/min and the low feedback mode.

Scans were analyzed using the Origin software supplied by the manufacturer. Subsequent to the subtraction of reference baseline scans, non-zero protein scan baselines were corrected using a third order polynomial. The unfolding parameters for the multidomain unfolding profiles of Fc, Fc, Fc-FcRI, and Fc/Fc-FcRI were deconvoluted using the multipeak fitting routine within the software.

Isothermal Titration Calorimetry (ITC)—Fc and Fc-FcRI were dialyzed against 10 mM citrate, 10 mM NaCl at pH 5.5 and 6.0 as described above for the CD experiments. Additional samples were also prepared by dialyzing Fc and Fc-FcRI against 1x PBS. Fc stock solutions were concentrated to 100 µM using 6 ml of Vivaspin MW5000 centrifugal concentration units (VivaSciences). ITC experiments were performed on a VP-ITC microcalorimeter (MicroCal, LLC). Aliquots of 70 µM Fc (15 µl) were injected into the reaction cell containing 5 µM solutions of Fc-FcRI to obtain a final Fc/Fc-FcRI ratio of 2:1. Dialysates were used in the reference cell. A 4-min equilibration period was used between all Fc injections with an initial delay of 60 s. All samples were degassed for 10 min prior to each experiment. The ITC internal sample jacket was set 10 °C below the constant temperature within the reaction and reference cells, except for the 10 °C titrations where the bath was set to 1 °C. Numerical integration of the data were performed using the ITC data analysis software supplied by MicroCal (Origin). H_A⁰ (T) values were calculated based on the difference between the average heat liberated/absorbed during the binding phase of the injections and the average heat of dilution found once the receptor, Fc-FcRI, was saturated with Fc. The titration midpoints that defined the stoichiometry, n, were determined without data fitting. None of the ITC curves were utilized further for determination of binding constants due to the lack of titration points in the transition region. The absence of multiple titration points at the concentration where Fc saturated the receptor was an indication that the affinity was too high to be measured by ITC alone.

Evaluation of the apparent binding thermodynamics for Fc/Fc-FcRI using DSC and ITC-K_U(T_M) values for the isolated C3C4 domains of Fc and the apodomains of FcRI were extrapolated from the measured calorimetric enthalpies and T_M values of the protein domains (i.e. with Fc alone or Fc-FcRI alone in the calorimeter) using theoretical heat capacities, 7.2 and 3.1 kcal mol^-1 K^-1, respectively, based on the molecular weight of their cooperatively folded domains (28). C_P⁰ and H_A⁰ (25 °C) values for the Fc/Fc-FcRI interaction were determined by ITC and estimated at pH 5.0 by fitting the experimentally derived values at pH 5.5, 6.0, and 7.4 to a second order polynomial. All other thermodynamic parameters were measured directly by fitting the DSC peaks within the Origin Software. The parameters were input into expressions derived by Brandts and Lin (29) for two proteins that demonstrate independent unfolding transitions in isolation but whose unfolding becomes thermodynamically coupled upon formation of a complex.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
pH-dependent Unfolding of Fc—Concentrated Fc was diluted into a set of buffers ranging from pH 2 to 9 and chromatographed on an SEC column (Fig. 1A). The molecular weight(s) of the eluted Fc peak(s) was determined by static light scattering and refractive index analyses. Following incubations between pH 5.3 and 9.0, Fc eluted as a single peak with the expected molecular mass of 71 kDa. At pH 5.0 and below, multiple peaks were observed within the chromatogram (Fig. 1A). Between pH 3.0 and 5.0, the additional peaks were limited to small multimers (i.e. dimers and tetramers) and apparent monomeric material, which eluted later than the folded Fc protein did. At pH 2.0, higher order aggregates were observed.

View larger version (22K): [in this window] [in a new window]   FIGURE 1. A, SEC chromatograms of Fc samples incubated at various pH values (indicated next to each line) before injection over the SEC column. Chromatograms of Fc samples with multiple peaks in the elution profile are shown with dotted lines. B, fluorescence intensity of ANS in the presence of Fc () or Fc () and at various pH values. Inset, fluorescence intensity of ANS/Fc mixtures at various pH values in 150 mM NaCl () and 750 mM NaCl (). C, CD spectra of Fc at various pH values.

To more directly evaluate secondary structure, CD spectra of Fc were taken under buffer conditions ranging from pH 4.5 to 7.4. Between pH 5.2 and 7.4, the spectra of Fc were found to be identical and contained a single minimum between 216 and 217 nm indicative of significant -sheet and typical of Ig domains (Fig. 1C). At pH 5, the Fc spectrum shifted in a random coil direction (the minimum shifted toward 200 nm), and by pH 4.5, the spectrum was predominantly random coil. Based on the remaining negative signal at wavelengths between 210 and 220 nm and the overall spectral minimum, which did not shift entirely to 197 nm as would be expected for a random coil polypeptide, residual secondary structure was present at pH 4.5 (Fig. 1C).

The Receptor-binding Domains of Fc, C3C4, Unfold Below pH 5—To determine whether Fc unfolding observed at pH values below 5.0 was limited to particular domains or occurred over the entire Fc region, limited proteolysis with either Glu-C or trypsin was performed at pH 4.5. Digestion time courses were analyzed by reverse phase HPLC MS. The first peaks appeared within 10 min of Glu-C or trypsin digestion and corresponded predominantly to peptides from the C4 domain and to a lesser extent the C3 domain. Several peptides from the C3 domain appeared at a moderately slower rate. After 5 h, peptides covering >80% of the sequences of the C3 and C4 domains were observed (Fig. 2A). After 24 h of proteolysis, several small peaks corresponding to initial C2 proteolytic events appeared (not shown).

To confirm that the C2 domain was stable at low pH values relative to the C3 and C4 domains, a recombinant C2 domain without C3 and C4 was created by fusing the domain to the C terminus of Fc. Both Fc and the Fc-C2 fusion protein were subjected to DSC analysis. DSC is capable of deconvoluting individual protein unfolding events within multidomain proteins and was used to investigate the stability of C2 within the context of the multidomain proteins Fc and Fc-C2. Both Fc and Fc-C2 were analyzed by DSC at multiple pH values between 2.5 and 8.0 (data not shown). Under all pH conditions, a single transition with a midpoint of unfolding (T_M) between 60 and 70 °C corresponding to the denaturation of C2 within both Fc and Fc-C2 was observed. Fc and the Fc-C2 construct were additionally dialyzed against a sodium phosphate buffer at pH 2.5, and the matched solutions were analyzed by DSC (Fig. 2B). Both proteins displayed a C2 unfolding transition near 65 °C indicating that the C2 domain was stably folded even at very low pH values.

View larger version (39K): [in this window] [in a new window]   FIGURE 2. A, schematic (rectangle) diagram of Fc with peptides detected by LC/MS subsequent to digestion at pH 4. 5, 37 °C labeled above (Glu-C) and below (trypsin). Peptides/domains with masses <800 or >10,000 Da were not included in the diagram as the small peptides could correspond to multiple sequences, and the large peptides were too large for precise intact mass determination. Peptide sequences that appeared slowly (after 1 day) upon Glu-C or trypsin digestion at pH 4.5 are underlined. All non-underlined peptide sequences were detectable within1hof digestion. B, DSC traces of Fc (black line) and Fc-C2 (gray line) performed using samples dialyzed against the same pH 2.5 phosphate buffer. Schematic diagrams of the Fc and Fc-C2 proteins are shown above the DSC curves.

View larger version (29K): [in this window] [in a new window]   FIGURE 3. A, pH-dependent thermostability of Fc examined by CD spectroscopy. The curves represent the ellipticity at chosen wavelengths from spectra taken between 20 and 80 °C using 5 °C intervals. B and C, pH-dependent DSC traces of Fc (B) and Fc (C) in the presence of 15 mM NaCl.

The C2 and C3 domains of Fc were generally much more stable than the homologous C3C4 domains of Fc (Fig. 3C). Unlike the cooperative unfolding observed for the C3C4 domains of Fc, the C2 and C3 domains unfolded in two separate transitions. The C2 domain was significantly less thermostable than the C3 domain. The C2 transition was identified by the effect that deglycosylation had on its thermostability.⁴ The C3 domain was identified by its high thermostability, a characteristic of the isolated domain as investigated previously (32). The stability of both domains decreased with decreasing pH. Unlike the C3C4 domains, however, the sharp transition toward an intrinsically unfolded state at all temperatures only occurred below pH 3.

In the presence of high salt, the C2 and C3 domains of Fc and the C3 and C4 domains of Fc were slightly destabilized. This was seen as a small shift in their T_M values at 150 and 750 mM NaCl relative to 15 mM NaCl in the intermediate pH range between 5.0 and 7.0 (Fig. 4A). These small stability differences are unlikely to have a major affect on the in vitro half-life of Fc within this pH range because the T_M of both the C2 and C3 domains remained above 60 °C. Interestingly, in high salt, the C2 domain of Fc appeared to be slightly more stable. C2 was especially stabilized at neutral pH and 750 mM NaCl with a T_M more than 7 °C higher than the T_M measured using 15 mM NaCl (Fig. 4B). In contrast, NaCl significantly destabilized the C3C4 domains between pH 5 and 6 (Fig. 4B). C3C4 began to unfold (i.e. a measurable fraction of intrinsically unfolded material at all temperatures) at pH 5.0 in low salt. In high salt, the unfolding transition was shifted 0.5 pH units (to pH 5.5).

pH Dependence of the Fc/FcRI Interactions—Many protein-protein interactions are highly pH-dependent. Such pH dependencies often have significant biological implications. For example, the pH dependence of the interaction between IgG1-Fc and FcRn is important for serum IgG recirculation and half-life (33). Because marked decreases in Fc stability were observed as the pH was decreased, we investigated whether pH-dependent stability changes attenuated the ability of IgE to interact with its high affinity receptor, FcRI. To facilitate the expression of soluble FcRI, the receptor subunit was fused to Fc (26). The resulting protein was a dimeric chimera of Fc and FcRI. A mutation within Fc (T299A) that abrogated glycosylation was utilized to prevent potential nonspecific binding of Fc to FcRI.

View larger version (18K): [in this window] [in a new window]   FIGURE 4. pH dependence of the Fc and Fc domain thermostabilities as represented by their TM values. A, Fc domain TM values: C2 at 15 (), 150 (), and 750 () mM NaCl; C3 at 15 (), 150 (), and 750 () mM NaCl. B, Fc domain TM values: C3 C4 at 15 (), 150 (), and 750 () mM NaCl; C2 at 15 (), 150 (), and 750 () mM NaCl.

Combining Fc and Fc-FcRI in solution led to changes in the CD spectra of the complexed proteins (Fig. 5, B-IE). Between pH 5 and 7.4, the spectra of the complex were compared with added spectra of the isolated Fc and Fc-FcRI proteins. Across these pH values, the absolute value of the spectral intensity of the complex decreased slightly, and the minimum shifted from 216 to 217 nm indicating potential -sheet stabilization and possibly the loss of some dynamic flexibility. The spectral changes upon complex formation were highly similar to the spectral changes observed by Sechi and co-workers (34) for the Fc·FcRI complex at pH 7.2. While reproducible, the changes in the CD spectra upon Fc·FcRI complex formation were fairly minimal and would certainly not reflect large structural changes such as the folding/unfolding of an entire Ig domain. Due to the unfolded nature of Fc at pH 4.5, the summed spectra of the apoproteins changed significantly from that observed at higher pH values (Fig. 5F). The spectrum of the physical mixture of Fc and Fc-FcRI was identical to the summed spectra of the apoproteins indicating that mixing the proteins together at pH 4.5 produced no changes in structure.

View larger version (40K): [in this window] [in a new window]   FIGURE 5. pH-dependent structural changes within Fc/Fc-FcRI upon complex formation. A, difference CD spectra obtained by subtracting Fc spectra from Fc-FcRI spectra at the indicated pH values. The difference spectra reflect the expected CD spectra of FcRI alone. B-F, CD spectra of equimolar mixtures of Fc and Fc-FcRI (dotted lines) and the mathematical addition of the spectra of apo-Fc and apo-Fc-FcRI taken in isolation (solid lines) at the indicated pH values.

We therefore investigated the relative binding strengths of Fc to Fc-FcRI at various pH values using DSC. The DSC curves of the individual Fc and Fc-FcRI proteins at pH 7.4 are shown in Fig. 6. An Fc(T299A) construct was also analyzed to differentiate the unfolding transitions of Fc from the single transition observed for FcRI in the Fc-FcRI fusion protein,⁵ as the two transitions could not be separated by deconvolution (not shown). In particular, the two domains of FcRI were found to unfold at the same temperature as the Fc(T299A) C2 domain. The DSC curve of complexed Fc/Fc-FcRI was significantly different from the simple addition of the isolated Fc and Fc-FcRI curves (dotted lines in Fig. 6) indicative of a strong interaction between the two proteins. The transitions corresponding to the C3C4 domains of Fc and domains 1 and 2 of FcRI coalesced into a single transition that occurred at a higher temperature (8°C higher) than the unfolding transitions of C3C4 and FcRI in isolation. Additionally, there was a significant increase in the calorimetric enthalpy of the transition (Fig. 6).

A mathematical treatment of DSC changes resulting from protein complex formation has been developed to obtain approximate binding affinities for high affinity interactions (29). The equations used by Brandts and Lin (29) were applied to Fc and Fc-FcRI interactions with the following assumptions: 1) unfolding in all cases was two-state and reversible; and 2) the temperature-dependent equilibrium of the interaction could be described by, K_eq(T) = [U_FcRI][U_C3C4]/[F_FcRI-C3C4], where [U_FcRI] and [U_C3C4] are the concentrations of unfolded FcRI and C3C4, respectively, and [F_FcRI-C3C4] is the concentration of the complex that was folded at all temperatures. Although the unfolding was not two-state for Fc or FcRI due to aggregation at temperatures where unfolded protein exists, the scans were performed at maximal rates (4 °C/min) to reduce aggregation and approximate two-state behavior.

Most of the necessary parameters for determining the affinity were obtained from the DSC experiment; however, the heat capacity of the interaction (C_P⁰) and the enthalpy of the interaction at 25 °C (H_A⁰(25 °C)), the temperature where we report the affinity, needed to be determined by ITC. The C_P⁰ (-760 cal mol^-1 K^-1) and H_A⁰ (25 °C, -20.4 kcal mol^-1) values for binding of Fc to Fc-FcRI at pH 7.4 were measured by ITC and found to be similar to previously determined values (35). The remaining thermodynamic parameters derived by DSC for determination of the apparent binding affinity of Fc to Fc-FcRI are shown in Table 1. An extremely high affinity was calculated using the DSC method (K_D <10^-12 M) that was significantly stronger than the value measured by SPR at pH 7.4 (K_D = 2.6 x 10^-10 M, Table 2). However, for reasons described above, the SPR experiments likely reflect the lower limit (i.e. weakest possible K_D) of the interaction.

View this table: [in this window] [in a new window]   TABLE 1 Thermodynamic values determined for apo-Fc, apo-Fc-FcRI, and the Fc·Fc-FcRI complex by DSC

View this table: [in this window] [in a new window]   TABLE 2 pH-dependent binding affinity of Fc for Fc-FcRla

View larger version (30K): [in this window] [in a new window]   FIGURE 6. DSC traces of apo-Fc (solid black line), apo-Fc-FcRI (solid gray line), the summation of the apo-Fc and apo-Fc-FcRI traces (black dotted line), and the DSC trace of an equimolar complex of the two proteins (gray dotted line). The identity of each transition (i.e. peak) within the DSC curves is indicated. All scans were performed at pH 7.4 using identical instrument parameters.

DSC experiments with Fc, Fc-FcRI, and Fc·Fc-FcRI complexes were performed at pH 6.0 and 5.5 to obtain parameters for determining the affinity at these pH values (Tables 1 and 2, and Fig. 8, A and B). Dropping the pH from 7.4 to 6.0 did not attenuate the affinity within the error of the experiment (Table 2; compare Figs. 6 and 8A). At pH 5.5, however, the affinity appeared to be attenuated significantly (K_D < 10^-10 M; Table 2 and Fig. 8B). Complex formation between Fc and Fc-FcRI at both pH 6.0 and 5.5 resulted in large increases in the apparent T_M values of the C3C4 domains of Fc and domains 1 and 2 of FcRI similar to what was observed at pH 7.4 (compare Figs. 6 and 8, A and B), indicating the persistence of a strong interaction.

Titration to pH 5.0 and 4.5 profoundly weakened the interaction between Fc and Fc-FcRI. DSC experiments clearly indicated that the interaction between the two proteins was highly attenuated at pH 5.0 and completely abrogated at pH 4.5 (Fig. 8, C and D). At pH 5.0, a structural change within Fc (Figs. 1C and 5E) appeared coincidentally with a reduced stability of the C3C4 domains (Fig. 3B). Formation of the complex between Fc and Fc-FcRI at pH 5.0 resulted in a marginal increase in the T_M of the C3C4 domains and the apodomains of FcRI over what was observed for the two proteins alone (Fig. 8C). The integrated enthalpy under the DSC curve of the Fc·Fc-FcRI complex at pH 5.0 was also greatly decreased compared with that observed at higher pH values. At pH 4.5, the mathematically combined DSC traces of apo-Fc and apo-Fc-FcRI were nearly identical to the DSC trace measured for the mixture of the two proteins indicating that the interaction was completely abolished at pH 4.5 (Fig. 8D).

We speculated that Fc bound to FcRI (as if on the surface of a cell) may be afforded some protection to pH-dependent denaturation via its strong interaction with the receptor. To test this idea, Fc and Fc-FcRI were mixed at pH 7.4 prior to dialysis at pH 4.5. The potential complex was removed from dialysis tubing and analyzed by DSC. Fc was found to be completely dissociated from the Fc-FcRI fusion protein suggesting that the unfolding behavior of Fc at pH 4.5 disrupted the preformed complex. Thus, FcRI would not be predicted to protect IgE from denaturation if the complex were exposed to low pH values.

View larger version (29K): [in this window] [in a new window]   FIGURE 7. Examples of ITC measurement of H0A(T) and C0P of the interaction between Fc and Fc-FcRI. A and B, titration of Fc into solutions containing Fc-FcRI at pH 6.0 (A) and pH 5.5 (B). C, determination of C0P of the interaction by linear regression of H0A(T) measured between 10 and 37 °C at pH 7.4 (), 6.0 (), and 5.5 ().

View larger version (33K): [in this window] [in a new window]   FIGURE 8. Sum of the DSC traces of the apo-Fc and apo-Fc-FcRI proteins (solid line) and the DSC trace of an equimolar mixture of the two proteins (dotted line). A, pH 6.0; B, pH 5.5; C, pH 5.0; and D, pH 4.5.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Unfolding Cooperativity and Stability Differences between Fc and Fc—The C2 and C3 domains of Fc were found to unfold independently of one another, whereas the C3 and C4 domains of Fc unfolded cooperatively under all conditions tested. Analyses of the structures of Fc (14) and Fc (36) reveal a similar amount of surface area buried at the C3/C4 interface compared with the C2/C3 interface (500 Ų for the C3/C4 interface versus 460 Ų for the C2/C3 interface). There is also a strong homology between the C2/C3 and C3/C4 interfaces, with near identical Fc residue positions burying surface area between the domains (in terms of the Kabat numbering system). However, the amino acid identity at the two interfaces is moderate and similar to the overall sequence identity between Fc and Fc (34% identity, 64% homology). It is likely that differences between the cooperativity of unfolding for the IgG and IgE Fc regions are a consequence of specific amino acid interactions at the interfaces of the Fc domains because the contact areas and structural compositions are similar. It is possible that the IgG1-Fc in particular may not unfold cooperatively due to the extremely high apparent stability of the C3 domain. However, similar thermal unfolding experiments with human IgG2, IgG3, and IgG4 also demonstrated separate unfolding transitions for the C2 and C3 domains of these isotypes that contained relatively less stable C3 domains than the C3 domain of IgG₁.⁶ It should be noted that the C2 and C3 domains of mouse IgG_2a do appear to unfold at the same temperature under neutral pH conditions (31). This phenomenon alone does not indicate folding cooperativity between the domains; the domains could simply have relatively close T_M values. The C3 and C4 domains of Fc appeared to unfold cooperatively under all pH and salt conditions tested.

Apparent cooperativity between C3 and C4 coincides with a recent study that describes the partially unfolded nature of an individual recombinant C3 domain (16, 18). We found that portions of the C3 domain proteolyzed more slowly than C4 at pH 4.5. It is possible that incomplete unfolding of the C3 domain hinders the rapid proteolysis of C3. When we removed C4 from Fc using a recombinant fusion construct Fc-linker-C2C3, this protein demonstrated a strong tendency to aggregate and poor overall biophysical behavior. Although FcRI has been shown to bind the C3 domain, removal of C4 from Fc abrogates the ability of Fc to interact with cell surface FcRI (37). Our results and those of others suggest C3 folding is dependent on C4 and explain why the presence of C4 is critical for high affinity FcRI binding (16, 18, 37).

A cooperatively folded structure for C3 in the presence of C4 does not discount potential flexibility of various loops or flexibility at the C2/C3 interface important for the observed biphasic binding kinetics to FcRI (11) and the existence of closed versus open forms of the receptor-binding region (15, 38). In fact, we did observe changes in the CD spectrum of Fc/Fc-FcRI (Fig. 5) upon formation of the complex. This is indicative of stabilization of -structures or limited structural changes resulting from the "locking down" of flexible loops similar to what was observed by Sechi and co-workers (34).

The pH stability profiles of Fc and Fc were also very different. The pH-dependent unfolding of C3C4 occurred at pH 5.0 likely due to the protonation of one or more basic amino acids that subsequently destabilizes the native fold. pH-dependent protein stability is often observed for proteins whose folds either stabilize the burial of charged amino acids or are dependent on strong charge-charge interactions. In the pH range where Fc appears to undergo its unfolding transition (pH 4.4-5.5), the most likely amino acid to undergo protonation would be histidine. Four of 9 histidines within Fc (His⁴²², His⁴⁸⁰, His⁴⁹⁰, and His⁵²⁸) were found to be 90% buried (14). One is in the C3 domain and the remaining 3 are in the C4 domain. Of the four Fc histidines, only His⁵²⁸ is conserved at the homologous position of Fc (36). The two histidines, His⁵²⁸ in IgE and His⁴²⁹ in IgG, also occupy nearly identical chemical environments suggesting that His⁵²⁸ of IgE is unlikely to play a role in the intermediate pH unfolding transition of Fc. Alternately, His⁴²², His⁴⁸⁰, and His⁴⁹⁰ of Fc are all occupied by polar residues at their homologous positions within IgG (Asn³²⁵, Ser³⁸³, and Tyr³⁹¹, respectively) and more likely involved in the pH sensitivity of Fc.

The stability of the C2 domain was relatively insensitive to pH. Our DSC experiments demonstrate that the domain is natively folded between pH 2.5 and 9.0. C2 likely remains folded at even lower pH values considering that the acidic groups within the domain should all be protonated by pH 2.5 and incapable of inducing large electrostatic changes in domain stability. C2 contains significantly fewer charged groups than the C3 and C4 domains of Fc. There are only 16 charged amino acids within C2 and only one, Glu²⁷⁰, is >80% buried within the protein fold (15, 19). In contrast, C3 and C4 contain 25 and 28 charged amino acids, respectively. In these two domains, 12 of the charged amino acids are >85% buried within the fold, and several additional charged amino acids within C4 are >80% buried (15). The different charged residue compositions of C2 and C3C4 as well as the extent to which they are buried within their folds very likely lead to the different pH stability behaviors.

pH Effects on the Thermodynamics of the Fc/Fc-FcRI Interaction—The affinity between Fc and the Fc-FcRI fusion protein was extremely high under all pH conditions where the C3C4 domains of Fc remained folded. DSC is uniquely suited to the study of very strong binding interactions (29). There are a multitude of parameters that must be determined with reasonable accuracy to obtain the K_D by DSC including some that are estimated (i.e. C_P⁰_unfolding for both the isolated C3C4 domains and domains 1 and 2 of FcRI). Due to the combination of experimental errors from the many variables, the magnitude of the K_D represents the best that can be expected from the DSC measurements and likely includes an error in the range of 10-100-fold. Encouragingly, the change in the Fc/Fc-FcRI DSC curves upon complex formation looked very similar to DSC simulations of a theoretical K_D = 10^-12 M interaction described by Brandts and Lin (29). The experiments described here were performed at protein concentrations 2 orders of magnitude lower than their simulated curves; therefore, the simulations would predict that the Fc/Fc-FcRI K_D was close to 10^-14 M. The existence of two binding sites per single Fc-FcRI fusion protein may improve the affinity of the construct for IgE over what has previously been observed for the monomeric soluble receptor. However, thermal unfolding of both Fc and Fc-FcRI is irreversible and complicates the interpretation of the thermodynamic parameters as additional avidity could be induced during unfolding due to aggregation. Therefore, we simply state that the K_D < 10^-12 M.

Whereas the magnitude of the affinity between Fc and Fc-FcRI at pH 7.4 and 6.0 was relatively unchanged, the thermodynamic parameters of the interaction changed remarkably. The unfavorable-TS_A⁰(25 °C) entropy term at pH 7.4 (+0.7 kcal mol^-1) changed by -10 kcal mol^-1 upon titration to lower pH values (-TS_A⁰(25 °C) =-10 kcal mol^-1 at both pH 6.0 and 5.5). These results suggest a number of possibilities that all relate to the presence of charged groups directly at the binding interface. First, apparent changes in enthalpy are likely to arise from differences in buffer ionization. The buffer was changed from phosphate at pH 7.4 to acetate at pH 6.0 and below. It is possible that uptake of one or more protons at the binding interface may account for much of the enthalpy change because phosphate has an intrinsically low enthalpy of ionization (39). The titration of one or more residues between pH 7.4 and 6.0 may also affect the overall thermodynamics of binding and potentially the binding mode between the two proteins as well. No secondary structure changes were observed for apo-Fc or apo-Fc-FcRI by CD upon titration from 7.4 to 5.2; therefore, the significantly altered binding thermodynamics could be the result of changes in charge density at or near the binding interface, local changes in the loop structures, or perhaps dynamic changes in quarternary structure. Consistent with the latter possibility, "open" and "closed" states have been shown to exist for Fc in crystal structures with FcRI bound and absent (40). Titration to pH 6.0 and below also resulted in anomalous Fc binding to the carboxy dextran-coated surface of the SPR chips (not shown) suggesting a change in polarity on the surface of Fc. Large changes in the heat capacity of the interaction also suggest a change in how the proteins are associating at the different pH values. Quarternary structure rearrangements at low pH that modify the surface exposure of apo-FcE or apo-FcRI could explain the experimentally determined C_P⁰ changes. One could speculate that this is due to stabilization of the closed form at lower pH.

Biological Importance of the pH-dependent Fc Unfolding Event—It seems likely that the unusual pH sensitivity of Fc, which differs greatly from what was observed for Fc, plays a role in its biological function or regulation. We have found the same pH sensitivity in an independent construct containing mouse Fc,⁷ suggesting that this pH sensitivity is a general property of IgE. Mildly acidic solutions of sodium acetate have been used to strip bound IgE from the surface of basophils suggesting that the pH unfolding/unbinding mechanism of Fc abolishes the ability of IgE to remain bound to FcRI (8, 41).

As the half-life of FcRI-associated IgE is extremely long and differs from the short half-life of IgE in the serum (12), the regulation of mast cell surface-bound IgE is a key factor determining the duration of allergic sensitivity. High levels of monomeric IgE increase the amount of FcRI found on the surface of mast cells and basophils and induce enhanced survival of these inflammatory cells (6, 10). Cross-linking of receptor bound IgE and subsequent endocytosis is one recognized method of antigen-specific cell surface IgE clearance (8). It has been shown that cross-linking leads to shuttling of endocytic vesicles containing IgE/FcRI from prelysosomal to lysosomal compartments (8). Additionally, IgE/FcRI cross-linking leads to the accumulation of IgE fragments in the lysosomal-like secretory granules (9). These mechanisms of antigen-specific IgE turnover appear to involve the introduction of IgE to moderately acidic lysosomal compartments. Under these conditions, we would predict that the Fc portion of IgE unfolds and dissociates from its receptor. This release may lead to IgE proteolysis within lysosomal compartments, whereas the less pH-sensitive FcRI may recycle back to the cell surface. Thus, the pH sensitivity of Fc may play a key role in the turnover of receptor-bound IgE.

	FOOTNOTES

 
^* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom correspondence should be addressed. Dept. of Protein Chemistry, Biogen Idec, 5200 Research Place, San Diego, CA 92122. Tel.: 858-401-5261; Fax: 858-401-5031; E-mail: stephen.demarest{at}biogenidec.com.

² M. Shields and S. J. Demarest, unpublished data.

³ The abbreviations used are: CD, circular dichroism; Fc, IgG constant domain fragment; IgG, immunoglobulin G; C2, C3, and C4, second, third, and fourth constant region domains of the IgE heavy chain, respectively; DSC, differential scanning calorimetry; C2 and C3, second and third heavy chain constant domains of IgG, respectively; ANS, 1-anilino-8-naphthalene sulfonate; ITC, isothermal titration calorimetry; CHO, Chinese hamster ovary; SEC, size exclusion chromatography; LC/MS, liquid chromatography/mass spectrometry; HPLC, high pressure liquid chromatography; SPR, surface plasmon resonance; PBS, phosphate-buffered saline; H⁰_A(T), molar enthalpy of association; C⁰_P, molar heat capacity of association; T_M, midpoint of thermal unfolding transition; S⁰_A(T), molar entropy of association.

⁴ S. J. Demarest, unpublished results.

⁵ S. J. Demarest and F. Taylor, manuscript in preparation.

⁶ S. J. Demarest and F. Taylor, unpublished data.

⁷ E. Mertsching et al., manuscript in preparation.

	ACKNOWLEDGMENTS

 
We gratefully acknowledge Dr. Kristin Demarest for critical reading of the manuscript.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Gould, H. J., Sutton, B. J., Beavil, A. J., Beavil, R. L., McCloskey, N., Coker, H. A., Fear, D., and Smurthwaite, L. (2003) Annu. Rev. Immunol. 21, 579-628[CrossRef][Medline] [Order article via Infotrieve]
2. MacGlashan, D. (2005) Clin. Rev. Allergy Immunol. 29, 49-60[CrossRef][Medline] [Order article via Infotrieve]
3. Kinet, J.-P. (1999) Annu. Rev. Immunol. 17, 931-972[CrossRef][Medline] [Order article via Infotrieve]
4. Bonnefoy, J.-Y., Lecoanet-Henchoz, S., Aubry, J.-P., Gauchat, J.-F., and Graber, P. (1995) Curr. Opin. Immunol. 7, 355-359[CrossRef][Medline] [Order article via Infotrieve]
5. Kalesnikoff, J., Huber, M., Lam, V., Damen, J. E., Zhang, J., Siraganian, R. P., and Krystal, G. (2001) Immunity 14, 801-811[CrossRef][Medline] [Order article via Infotrieve]
6. Kawakami, T., and Kitaura, J. (2005) J. Immunol. 175, 4167-4173[Abstract/Free Full Text]
7. Kitaura, J., Xiao, W., Maeda-Yamamoto, M., Kawakami, Y., Lowell, C. A., and Kawakami, T. (2004) J. Immunol. 173, 4317-4323[Abstract/Free Full Text]
8. Furuichi, K., Rivera, J., Buonocore, L. M., and Isersky, C. (1986) J. Immunol. 136, 1015-1022[Abstract]
9. Xu, K., Williams, R. M., Holowka, D., and Baird, B. (1998) J. Cell Sci. 111, 2385-2396[Abstract]
10. Borkowski, T. A., Jouvin, M.-H., Lin, S.-Y., and Kinet, J.-P. (2001) J. Immunol. 167, 1290-1296[Abstract/Free Full Text]
11. Henry, A. J., Cook, J. P., McDonnell, J. M., Mackay, G. A., Shi, J., Sutton, B. J., and Gould, H. J. (1997) Biochemistry 36, 15568-15578[CrossRef][Medline] [Order article via Infotrieve]
12. Kubo, S., Nakayama, T., Matsuoka, K., Yonekawa, H., and Karasuyama, H. (2003) J. Immunol. 170, 775-780[Abstract/Free Full Text]
13. Sondermann, P., and Oosthuizen, V. (2002) Immunol. Lett. 82, 51-56[CrossRef][Medline] [Order article via Infotrieve]
14. Garman, S. C., Wurzburg, B. A., Tarchevskaya, S. S., Kinet, J. P., and Jardetzky, T. S. (2000) Nature 406, 259-266[CrossRef][Medline] [Order article via Infotrieve]
15. Wan, T., Beavil, R. L., Fabiane, S. M., Beavil, A. J., Sohi, M. K., Keown, M., Young, R. J., Henry, A. J., Owens, R. J., Gould, H. J., and Sutton, B. J. (2002) Nat. Immunol. 3, 681-686[CrossRef][Medline] [Order article via Infotrieve]
16. Henry, A. J., McDonnell, J. M., Ghirlando, R., Sutton, B. J., and Gould, H. J. (2000) Biochemistry 39, 7406-7413[CrossRef][Medline] [Order article via Infotrieve]
17. Hunt, J., Beavil, R. L., Calvert, R. A., Gould, H. J., Sutton, B. J., and Beavil, A. J. (2005) J. Biol. Chem. 280, 16808-16814[Abstract/Free Full Text]
18. Price, N. E., Price, N. C., Kelly, S. M., and McDonnell, J. M. (2005) J. Biol. Chem. 280, 2324-2330[Abstract/Free Full Text]
19. McDonnell, J. M., Calvert, R., Beavil, R. L., Beavil, A. J., Henry, A. J., Sutton, B. J., Gould, H. J., and Cowburn, D. (2001) Nat. Struct. Mol. Biol. 8, 437-441
20. Zhu, D., Kepley, C. L., Zhang, M., Zhang, K., and Saxon, A. (2002) Nat. Med. 8, 518-521[CrossRef][Medline] [Order article via Infotrieve]
21. Zhu, D., Kepley, C. L., Zhang, K., Terada, T., Yamada, T., and Saxon, A. (2005) Nat. Med. 11, 446-449[CrossRef][Medline] [Order article via Infotrieve]
22. Belostotsky, R., and Lorberboum-Galski, H. (2004) Clin. Immunol. 110, 89-99[CrossRef][Medline] [Order article via Infotrieve]
23. Kabat, E., Wu, T. T., Perry, H. M., Gottesman, K. S., and Foeller, C. (1991) Sequences of Proteins of Immunological Interest, U. S. Department of Health and Human Services, NIH, Bethesda, MD
24. Nakamura, T., Kloetzer, W. S., Brams, P., Hariharan, K., Chamat, S., Cao, X., LaBarre, M. J., Chinn, P. C., Morena, R. A., Shestowsky, W. S., Li, Y. P., Chen, A., and Reff, M. E. (2000) Int. J. Immunopharmacol. 22, 131-141[CrossRef][Medline] [Order article via Infotrieve]
25. Urlaub, G., McDowell, J., and Chasin, L. A. (1985) Somat. Cell. Mol. Genet. 11, 71-77[CrossRef][Medline] [Order article via Infotrieve]
26. Brezinsky, S. C., Chiang, G. G., Szilvasi, A., Mohan, S., Shapiro, R. I., MacLean, A., Sisk, W., and Thill, G. (2003) J. Immunol. Methods 277, 141-155[CrossRef][Medline] [Order article via Infotrieve]
27. Glaser, S. M., Hughes, I. E., Hopp, J. R., Hathaway, K., Perret, D., and Reff, M. E. (2005) J. Biol. Chem. 280, 41494-41503[Abstract/Free Full Text]
28. Myers, J. K., Pace, C. N., and Scholtz, J. M. (1995) Protein Sci. 4, 2138-2148[Medline] [Order article via Infotrieve]
29. Brandts, J. F., and Lin, L.-N. (1990) Biochemistry 29, 6927-6940[CrossRef][Medline] [Order article via Infotrieve]
30. Sánchez-Ruiz, J. M., López-Lacomba, J. L., Cortijo, M., and Mateo, P. L. (1988) Biochemistry 27, 1648-1652[CrossRef][Medline] [Order article via Infotrieve]
31. Vermeer, A. W., and Norde, W. (2000) Biophys. J. 78, 394-404[Medline] [Order article via Infotrieve]
32. Demarest, S. J., Rogers, J., and Hansen, G. (2004) J. Mol. Biol. 335, 41-48[CrossRef][Medline] [Order article via Infotrieve]
33. Raghavan, M., Bonagura, V. R., Morrison, S. L., and Bjorkman, P. J. (1995) Biochemistry 34, 14649-14657[CrossRef][Medline] [Order article via Infotrieve]
34. Sechi, S., Roller, P. P., Willette-Brown, J., and Kinet, J.-P. (1996) J. Biol. Chem. 271, 19256-19263[Abstract/Free Full Text]
35. Keown, M. B., Henry, A. J., Ghirlando, R., Sutton, B. J., and Gould, H. J. (1998) Biochemistry 37, 8863-8869[CrossRef][Medline] [Order article via Infotrieve]
36. Sondermann, P., Huber, R., Oosthuizen, V., and Jacob, U. (2000) Nature 406, 267-273[CrossRef][Medline] [Order article via Infotrieve]
37. Helm, B. A., Sayers, I., Higginbottom, A., Cantarelli Machado, D., Ling, Y., Ahmad, K., Padlan, E. A., and Wilson, A. P. M. (1996) J. Biol. Chem. 271, 7494-7500[Abstract/Free Full Text]
38. Wurzburg, B. A., Garman, S. C., and Jardetzky, T. S. (2000) Immunity 13, 375-385[CrossRef][Medline] [Order article via Infotrieve]
39. Pierce, M. M., Raman, C. S., and Nall, B. T. (1999) Methods 19, 213-221[CrossRef][Medline] [Order article via Infotrieve]
40. Wurzburg, B. A., and Jardetzky, T. S. (2002) Mol. Immunol. 38, 1063-1072[CrossRef][Medline] [Order article via Infotrieve]
41. MacGlashan, D. W., McKenzie-White, J., Chichester, K., Bochner, B. S., Davis, F. M., Schroeder, J. T., and Lichtenstein, L. M. (1998) Blood 91, 1633-1643[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				A. Doern, X. Cao, A. Sereno, C. L. Reyes, A. Altshuler, F. Huang, C. Hession, A. Flavier, M. Favis, H. Tran, et al. Characterization of Inhibitory Anti-insulin-like Growth Factor Receptor Antibodies with Different Epitope Specificity and Ligand-blocking Properties: IMPLICATIONS FOR MECHANISM OF ACTION IN VIVO J. Biol. Chem., April 10, 2009; 284(15): 10254 - 10267. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 281/41/30755    most recent M605190200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Demarest, S. J. Articles by Kehry, M. R. Search for Related Content PubMed PubMed Citation Articles by Demarest, S. J. Articles by Kehry, M. R. Social Bookmarking                      What's this?