HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 281, Issue 42, 31254-31267, October 20, 2006

This Article Abstract Full Text (PDF) All Versions of this Article: 281/42/31254    most recent M604850200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Moulis, C. Articles by Remaud-Simeon, M. Search for Related Content PubMed PubMed Citation Articles by Moulis, C. Articles by Remaud-Simeon, M. Social Bookmarking                      What's this?

Understanding the Polymerization Mechanism of Glycoside-Hydrolase Family 70 Glucansucrases^*

From the Laboratoire de Biotechnologies-Bioprocédés, UMR CNRS 5504, UMR INRA 792, INSA, 135 avenue de Rangueil, 31077 Toulouse Cedex 4, France

Received for publication, May 19, 2006 , and in revised form, July 24, 2006.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Glucan formation catalyzed by two GH-family 70 enzymes, Leuconostoc mesenteroides NRRL B-512F dextransucrase and L. mesenteroides NRRL B-1355 alternansucrase, was investigated by combining biochemical and kinetic characterization of the recombinant enzymes and their respective products. Using HPAEC analysis, we showed that two molecules act as initiator of polymerization: sucrose itself and glucose produced by hydrolysis, the latter being preferred when produced in sufficient amounts. Then, elongation occurs by transfer of the glucosyl residue coming from sucrose to the non-reducing end of initially formed products. Dextransucrase preferentially produces an isomaltooligosaccharide series, whose concentration is always low because of the high ability of these products to be elongated and form high molecular weight dextran. Compared with dextransucrase, alternansucrase has a broader specificity. It produces a myriad of oligosaccharides with various -1,3 and/or -1,6 links in early reaction stages. Only some of them are further elongated. Overall alternan polymer is smaller in size than dextran. In dextransucrase, the A repeats often found in C-terminal domain of GH family 70 were found to play a major role in efficient dextran elongation. Their truncation result in an enzyme much less efficient to catalyze high molecular weight polymer formation. It is thus proposed that, in dextransucrase, the A repeats define anchoring zones for the growing chains, favoring their elongation. Based on these results, a semi-processive mechanism involving only one active site and an elongation by the non-reducing end is proposed for the GH-family 70 glucansucrases.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Glucansucrases from Glycoside-Hydrolase (GH)²-family 70 (EC. 2.4.1.5 [EC] ) are extracellular enzymes produced by lactic acid bacteria of the genus Leuconostoc, Streptococcus, or Lactobacillus (1). From sucrose, they catalyze the synthesis of high molecular weight glucans. They can also produce oligosaccharides or glucoconjugates by a transglucosylation reaction from the sucrose donor to an exogenous acceptor, and this so called "acceptor reaction" occurs at the cost of polymer synthesis (2, 3). An interesting diversity exists in the GH-family 70, where there are enzymes able to synthesize all the types of glucosidic linkages, namely -1,2; -1,3; -1,4; or -1,6 glucosidic bonds. So, depending on the enzyme specificity, a wide range of glucans can be produced, varying in terms of size, structure, degree of branches and spatial arrangements.

Primary structures of at least 44 different glucansucrases are now available in GH-family 70.³ With an average predicted molecular mass of more than 160,000 Da, they all show the same organization consisting of a variable region at the N terminus, a conserved catalytic domain, and a C-terminal domain typically containing a series of homologous repeating units. In a number of streptococcal glucansucrases, as well as for the L. mesenteroides NRRL B-512F dextransucrase, the repeats have been demonstrated to play a role in enzyme glucan binding. For this reason, this domain is also often called "glucan binding domain" (5). In addition, these repeated units are sometimes found in the variable region, especially for Lactobacilli glucansucrases (6). The catalytic domain is predicted to be organized in a (/)₈-barrel resembling that of enzymes from GH-family 13 (the -amylase family); however probably circularly permuted (7). Both families belong to the same clan, named GH-H (4). Notably, some glucansucrases are also encountered in the GH-family 13, namely the amylosucrase from Neisseria polysaccharea (AS) (8) and that of Deinococcus radiodurans (DRAS) (9). They are shorter than GH-family 70 glucansucrases and both synthesize amylose from sucrose, displaying a narrow specificity toward -1,4 linkage synthesis. The three-dimensional structure of N. polysaccharea AS was solved (10), allowing a better understanding of polymer formation by this enzyme. The first step consists of the formation of a covalent glucosyl-enzyme intermediate (8, 11), involving a triad of catalytic residues conserved in all GH-family 13 enzymes: Asp-286 (AS numbering) acts as nucleophile, Glu-328 as general acid/base catalyst (proton donor) and Asp-393 as a stabilizer of the glucosyl intermediate (8, 12). It was also demonstrated that polymer elongation occurred following a non-processive, or multichain, process, by addition of the glucosyl units at the non-reducing end of acceptor molecules (9, 13, 14).

However, contrary to the mechanism of amylose formation by amylosucrases, polymer formation by GH-family 70 enzymes is still not clearly elucidated. In the early fifties, analyses of the kinetics of polymer formation from sucrose showed that a high molecular weight polymer was formed very early, without release of detectable oligosaccharides of intermediate size (15). A single chain, primer-dependent mechanism of elongation was proposed for dextran elongation, as it was generally accepted for polysaccharide biosynthesis at this period (2, 16, 17). Working with the L. mesenteroides NRRL B-512F dextransucrase (DSR-S), Tsuchiya et al. (16) proposed thus that in absence of exogenous co-substrate, impurities in the crude dextransucrase preparation or sucrose itself could act in the role of primer. Cheetham et al. (18) identified sucrose at the end of the dextran produced by the S. sobrinus glucansucrase GTF-S3 (18), but attempts to identify it in various other glucan extremities failed. Thus, from pulse/chase experiments using radiolabeled sucrose and immobilized dextransucrase, a different single chain mechanism was proposed by Robyt et al. (19). It involved two nucleophilic active sites able to form glucosyl and glucanosyl covalent enzyme intermediates, and polymer synthesis was suggested to occur by the insertion of glucosyl residues at the reducing end of the glucanosyl-enzyme intermediate. Their work first performed on DSR-S was later confirmed for glucansucrases from S. mutans and S. sanguis (20, 21).

However, Mooser et al. (22, 23) trapped only one covalent glucosyl enzyme intermediate from a quenched reaction of S. sobrinus glucansucrase and radiolabeled sucrose, indicating that only one active site would be present. Sequence comparisons between GH-families 70 and 13 enzymes enabled the identification of only one catalytic triad composed of two aspartic acids and one glutamic acid, similar to that of amylosucrases. Thus, Asp-551 (in DSR-S sequence) was proposed to act as nucleophile, Glu-589 as the acid-base catalyst and Asp-662 to assist the glucosyl-enzyme formation (7). These residues are strictly conserved for all the GH-family 70 glucansucrases of known primary structure to date, and their mutation leads to inactive enzymes (24–26). In addition, no other putative active sites were identified from sequence analyses (7, 25). For a better understanding, these two mechanisms are shown in Fig. 1.

Regarding the acceptor reaction, since the pioneer work of Koepsell et al. (2), all researchers agree with a multichain elongation mechanism, occurring by successive transfer of glucosyl residues at the non reducing end of the acceptor (in the case of glucose, maltose, or isomaltose, for instance), and producing oligosaccharide series to the detriment of polymer formation (27). A wide range of exogenous molecules can act this acceptor role. Notably, water and fructose were also described to accept the glucosyl residue, resulting in sucrose hydrolysis, neo-synthesis of a sucrose molecule ("isotopic exchange") (28), or the production of sucrose isomers, like leucrose (D-glucopyranosyl--1,5 -D-fructopyranose) (29). Su and Robyt proposed that the synthesis of oligosaccharides occurred through the participation of a third catalytic nucleophile site, however this required the participation of one of the two nucleophilic sites, which are normally associated with the polysaccharide synthesis (30). However, mutation of Asp-551 in DSR-S abolished both polymer synthesis from sucrose, or oligosaccharide production by the acceptor reaction (26).

In summary, many researchers now agreed to the fact that an elongation mechanism resembling that used by GH-family 13 amylosucrases could be used to explain the acceptor reactions occurring in GH-family 70 glucansucrases. On this basis, the de novo polymer synthesis from the non reducing end involving only one active site could be suggested, but was however never demonstrated. In particular, the initiator molecule, the sense and mode of elongation (single or multichain, also called processive or non-processive) are still questionable when looking at the literature. The aim of our study was thus to re-investigate the mode of de novo polymer formation from a detailed biochemical study of the kinetics of polymer synthesis, using sensitive analytical methods. Two models of study were chosen in the GH-family 70: the most intensively studied dextransucrase to date, the DSR-S from L. mesenteroides NRRL B-512F specific for -1,6 linkage formation, and the alternansucrase from L. mesenteroides NRRL B-1355 (ASR), which has the particularity to alternate -1,6 and -1,3 links. These two enzymes were chosen to highlight their common features, but the role of specific sites of protein sequence divergences were also closely studied, in respect to the polymerization process and the linkage specificity displayed.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The enzyme constructs chosen for this study are the DSR-S vardel 4N and the ASR C-APY del. Both enzymes are variants of L. mesenteroides NRRL B-512F dextransucrase (DSR-S) and L. mesenteroides NRRL B-1355 alternansucrase (ASR) truncated of part of the C-terminal domain. Some of them also show an additional N-terminal truncation. The construction of these variants was undertaken to reduce the problems of glucansucrase degradation occurring during heterologous enzyme expression by Escherichia coli. These two truncated variants have previously been shown to display the same behavior than the wild-type enzyme in term of specificity and products synthesized, and are thus considered here as models of study (31, 32).

Bacterial Strains, DNA Manipulation, and Mutant Constructions
The pBad/TOPO Thiofusion vector (Invitrogen) was used for cloning and expression of truncated or mutated dsrS and asr genes, under the control of L-arabinose promoter. It permits the fusion of the gene to a His₆ tag at the C-terminal end, and to a thioredoxin tag at N-terminal extremity. To be used as template, genomic DNA was extracted from L. mesenteroides NRRL B-512F and B-1355 using the Blood and Cell culture DNA maxi kit (Qiagen). The strains were provided by the NCAUR stock culture collection in Peoria, IL. E. coli One Shot TOP10 (Invitrogen) was used for expression of truncated or mutated dsrS and asr genes. Restriction enzymes were purchased from New England Biolabs and used according to the manufacturer's instructions. DNA purification was performed using QIAquick (PCR purification and gel extraction) and QIAprep (plasmid purification) from Qiagen.

Dextransucrase Variants—Truncated DSR-S variants were constructed by PCR amplification of the dsrS gene from L. mesenteroides NRRL B-512F genomic DNA (GenBank^TM accession number I09598 [GenBank] ), using the Long Expand High Fidelity polymerase (Roche Applied Science) and the following primers (given in 5' 3', sense): 1) The DSR-S vardel 4N construct was previously described (31), and contains amino acids Thr-152 to Ser-1450. 2) The DSR-S vardel 2 was constructed using Pbad DSR-S vardel: ⁴⁵⁴acacaacaagttagcggcaagtacgttgaaaaagac⁴⁹⁰ and Pbad 2: ⁴¹⁹⁴ctgatttgtgatcaaatttcctgtgttatc⁴¹⁶⁴. The protein contains the DSR-S amino acids Thr-152 to Gln-1398. 3) The DSR-S vardel 3 was constructed using Pbad DSR-S vardel and Pbad 3: ⁴⁰⁸⁶cccgtctgcatcaatgaattcacc⁴⁰⁶². The protein contains the DSR-S amino acids Thr-152 to Gly-1362. 4) The DSR-S vardel Core was obtained using Pbad DSR-S vardel and Pbad Core: 3489-gccagtttctgacagatcattagttaactg-3459. The protein contains the DSR-S amino acids Thr-152 to Gly-1162. 5) The DSR-S Core A was created using Pbad DSR-S cat: ⁸⁴³ggcttctctggtgtgattgatggtcaa⁸⁷⁰ and Pbad Core. The protein contains the DSR-S amino acids Gly-282 to Gly-1162. 6) Site-directed mutations were performed in the Thio-DSR-S vardel 4N-His protein, using the "megaprimer" method (33) and the Pfu DNA polymerase (Stratagene). An initial PCR reaction was carried out using the Thio-DSRS vardel 4N-His plasmid template, one of the mut primer (see below) and the helper primer rev, ³⁴⁴⁷gtcaccatcctcagtgttcgaaacg³⁴²², including the BstBI site (underlined). The PCR product was then used as a reverse megaprimer in a second PCR, together with a forward primer located upstream of the SpeI site: forw, ¹³²⁹caaccacagtggaatgaaactagtc¹³⁵⁴. This product was then digested by BstBI and SpeI as described by the enzyme suppliers (New England Biolabs) and cloned into the Thio-DSRS vardel 4N-His. The mut primers were designed so as to introduce a new unique restriction site to select the positive clones.

View larger version (24K): [in this window] [in a new window]   FIGURE 1. Schematic representation of the two polymerization mechanisms of glucansucrases proposed in the literature. A, mechanism involving only one active site, as suggested by Mooser (47) and resembling that of -retaining transglucosidases (4); B, mechanism involving two active sites, as proposed by Robyt et al. in 1974 (19).

Alternansucrase Variants—The ASR C-APY del was constructed by PCR amplification of the asr gene from L. mesenteroides NRRL B-1355 genomic DNA (Genbank accession number no. AJ250173 [GenBank] ), using the Long Expand High Fidelity polymerase and the primers Bad dir (forward 5' to 3') ¹atggaacaacaagaaacagttacccgt²⁷ and Bad C-del 2 (reverse 5' to 3') ⁴²⁷⁵ccctcgagacatagtcccatcaacatttaagtg⁴²⁴³. The protein contains the ASR amino acids Met-1 to Gly-1425. The site-directed Y768S:D769E:A770V mutation was introduced by PCR using the ForAsrCat primer ¹⁶⁹⁰ggaaataacagaaaactaggacgtcaacc¹⁷¹⁸ (AatII), annealing upstream the region to be modified and the reverse primer RevAsr YDA768SEV ²³²⁴ctaattggatcctgaacttcggaatcatgtgc²²⁹³ (BamHI). The amplified product was then used as megaprimer in combination with the RevAsrCat primer ⁴²⁸⁸caaatttaaatagtcctcgagacatagtccc⁴²⁵⁸ (XhoI). The final amplification product was then inserted in the [pBad asr C-APY-del] between the AatII and XhoI restriction sites. The mutant will be named YDA768SEV. All constructions were verified by DNA sequencing (Millegen SA, Toulouse, France).

Enzyme Extraction Methods
Dextransucrase Variants—E. coli TOP10 cells carrying the recombinant plasmids encoding dsrS variants were grown under conditions optimized for DSR-S expression (31), at 23 °C, in aerated 2x YT medium supplemented with 100 mM Tris/HCl, pH 6.4 and 100 µg/ml ampicillin, and inducted with 0.002% (w/v) of L-arabinose at 0.5 A_{600 nm}. Cell growth and DSR-S production were monitored over 24 h after induction. For enzyme extraction, cells were harvested by centrifugation (8,000 x g, 10 min, 4 °C), resuspended and concentrated to an A_{600 nm} of 80 in sodium acetate buffer 50 mM, pH 5.2 containing 0.05 g/liter CaCl₂ and 1 mM phenylmethylsulfonyl fluoride. All preparations were centrifuged to eliminate cell debris. Characterizations were performed on highly purified DSR-S vardel 4N as described before (31). For other DSR-S-truncated variants, it was verified by activity Schiff-staining gel electrophoresis that only the entire form was active (condition of Schiff-staining gel as described before (34)). No change of expression levels or degradation was observed for site-directed mutants compared with DSR-S vardel 4N extracts on electrophoresis gel.

Alternansucrase Variants—Bacterial cells were grown on LB medium with 100 µg/ml of ampicillin. Induction was performed using 0.02% arabinose (w/v). Cells were harvested after 19 h by centrifugation (4,500 x g, 10 min, 4 °C) and resuspended to A_{600 nm} of 80 in lysis buffer (20 mM sodium acetate buffer pH 5.4, 1% Triton X-100, 1 mg/ml lysozyme, and 5 mg/ml DnaseI) before sonication. The protein extracts obtained were centrifuged (27,000 x g, 30 min, 4 °C), to remove cell debris. Electrophoresis analyses confirmed that site-directed mutagenesis did not change the expression profiles compared with the wild-type.

Activity Assay
Activity was assayed using the dinitrosalicylic acid method (35). For dextransucrase variants, one unit is defined as the amount of enzyme that catalyzes the formation of 1 µmol of fructose/min at 30 °C in 50 mM sodium acetate buffer pH 5.2, 0.05 g/liter CaCl₂ and 100 g/liter sucrose. For alternansucrase variants, activity was determined in the same conditions except that the buffer was replaced by a 20 mM sodium acetate buffer pH 5.4, without CaCl₂.

Polymer Synthesis and Acceptor Reactions
With DSR-S variants, polymer syntheses were carried out with 1 unit/ml of enzyme, at 25 °C in sodium acetate buffer 50 mM, pH 5.2 supplemented with 0.05 g/liter CaCl₂ and 290 mM sucrose. Buffer was replaced by 20 mM sodium acetate pH 5.4 (without CaCl₂), and 1.6 units/ml were used for alternansucrase variants. Acceptor reactions were performed following the same conditions, except that 145 mM maltose was added as acceptor. Complete sucrose depletion was monitored by HPAEC-PAD (see below), and reactions were stopped by 5 min of incubation at 95 °C.

Glucan Analysis
Alternan—The high molecular weight polymer was precipitated by addition of 1 volume of ethanol, recovered by centrifugation and washed three times with water. The supernatant containing low molecular weight oligosaccharides (DP 8) was purified from mono and disaccharides by size exclusion chromatography on Biogel P2 Gel Fine (Bio-Rad) column of 318 ml of resin, at a flow-rate of 0.5 ml/min. Samples were collected every 10 min, for 600 min of analysis. Purified alternan and oligosaccharides were freeze-dried before NMR and methylation analysis. Alternan and oligosaccharides were dissolved at 50 mg/ml in D₂O. ¹³C NMR (75.468 MHz) analyses were recorded on a Bruker Avance 300 spectrometer. Spectra were recorded at 333 K, from 1.445 s acquisition time and 12,288 scan accumulations. For two-dimensional NMR, HSQC, and HMBC were registered on a Bruker-ARX 400 spectrometer, ¹H spectra were recorded at 400.130 MHz and ¹³C spectra at 100.612 MHz, at 300 K in both case. For HSQC, 1.343 s acquisition time and 4 scans were accumulated, 0.852 s acquisition time and 8 scans, in case of HMBC.

Glycosidic linkage composition was determined by methylation. The polymers and oligosaccharides were methylated according to the modified procedure from Ciucanu and Kerek (36), hydrolyzed with 2 N trifluoroacetic acid at 110 °C for 2 h, reduced with NaBD₄ 10 mg/ml in NH₄OH/C₂H₅OH, (1:1, v/v), freshly prepared and peracetylated with acetic anhydride 1 h at 110 °C. The alditol acetates were solubilized in cyclohexane before analysis by gas chromatography (GC) and gas chromatography coupled to mass spectrometry (GC-MS). GC was performed on a Girdel series 30 equipped with an OV1 capillary column (0.22 mm x 25 m), using helium at a flow rate of 2.5 ml/min and with a flame ionization detector at 310 °C. The injector temperature was 260 °C and the temperature separation program ranged from 100 to 290 °C with 3 °C/min speed. GC-MS analyses were performed on a Hewlett-Packard 5889X mass spectrometer (electron energy, 70 eV) working in electron impact coupled with Hewlett-Packard 5890 gas chromatograph series II fitted with a similar OV1 column (0.30 mm x 12 m).

Dextran—Digestions by Chaetomium gracile endodextranase (Sankyo Co.) were performed during 16 h at 37 °C with 3 units of enzyme per ml of polymer synthesis medium. Digestion products were analyzed by HPAEC-PAD in conditions described below.

Digestions by Saccharomyces cerevisiae invertase (Fluka), a -fructofuranosidase, which catalyzes sucrose hydrolysis to produce glucose and fructose, were performed during 15 min at 25 °C with 20 units of enzyme per ml of reaction medium readjusted at pH 4,5. Digestion products were also analyzed by HPAEC-PAD in conditions described below.

View larger version (13K): [in this window] [in a new window]   FIGURE 2. Analysis of the products synthesized by DSR-S vardel 4N from 290 mM sucrose. A, HPSEC chromatogram after total sucrose consumption, and B, HPAEC-PAD profile. DP1, monosaccharides, I3 to I25, isomaltooligosaccharides of DP2 to DP25;?, products of unknown structure.

Glucan molecular weights were determined by high-performance size-exclusion chromatography (HPSEC). For dextran analyses, two Shodex OH-Pack SB-805 and SB-802.5 columns were maintained in series, using an eluent containing 0.45 M of NaNO₃ and 1% (v/v) of ethylene glycol at a flow rate of 0.3 ml/min (31). Columns and guard column were maintained at 70 °C, and samples were filtered through a 0.45 µm-pore size filter (Sartorius) before injection. Alternan analyses were performed using a Jordi DVD-glucose 1000A column (Altech), at a flow rate of 0.6 ml/min of water/Me₂SO (80/20) (v/v), and column was maintained at 50 °C. In both cases, calibration standards used were commercial dextrans of 2,000, 530, 70, and 10 kDa, isomaltotriose, sucrose, and fructose (Sigma).

Glucose, fructose, and leucrose concentrations were determined by HPAEC-PAD analysis. The percentages of glucosyl residues coming from sucrose incorporated into free glucose (%G_glucose) and leucrose (%G_leucrose) were calculated by the formula in Equation 1,

(Eq. 1)

where [glucose_tf] and [leucrose_tf] correspond to the final concentrations of glucose and leucrose (in mM) at the end of the reaction, and [sucrose_t0] to the initial substrate one (in mM).

The percentage of glucosyl residues incorporated into high molecular weight (HMW) polymer and dextrans of 10,000 Da (%G_dextran) were determined by HPSEC analysis following the formula in Equation 2,

(Eq. 2)

where area_{dextran tf} corresponds to the area of the dextran peak estimated on HPSEC chromatogram at the end of reaction, and area_{sucrose t0} to that of sucrose at the initial time. Indeed, for a given concentration, the area obtained by refractometry is identical, whatever the sugar is.

The proportion of glucose incorporated into IMW polymer or oligosaccharides (%G_IMW) for which the concentration cannot be directly quantified by HPAEC-PAD or HPSEC analyses is determined by the formula in Equation 3.

(Eq. 3)

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
To investigate the de novo polymer formation by glucansucrases from GH-family 70, two models of study were chosen: the DSR-S vardel 4N and the ASR C-APY del. Both enzymes were recently demonstrated to possess the same specificity and behavior than the full-length enzymes, namely DSR-S from L. mesenteroides NRRL B-512F (31) and ASR from L. mesenteroides NRRL B-1355 (32). DSR-S vardel 4N displays a dextransucrase specific for -1,6 linkages of more than 95%, and ASR C-APY del displays alternansucrase activity, capable of producing alternate -1,6 and -1,3 linkages in the main chain.

Polymerization Reaction with Dextransucrase
Characterization of the Products Synthesized from 290 mM Sucrose—Products formed after complete sucrose depletion were analyzed by HPSEC (Fig. 2A). Elution profile revealed the presence of two main populations: a peak of HMW dextran eluted from 35 to 45 min and a second peak eluted from 68 to 80 min, corresponding principally to the fructose released. HMW dextran was previously estimated to be larger than 10⁷ g/mol (i.e. a degree of polymerization (DP) superior to 61,700). Dextrans of intermediate size (IMW) were also present, as indicated by the perturbations of the base line between the two main peaks. Complementary analysis was performed on HPAEC-PAD, revealing that the medium contained at the end of reaction 47% of fructose, 4.6% of free glucose, 12.6% of leucrose (D-glucopyranosyl--1,5 fructopyranose), and oligosaccharides varying from DP2 to 25 (Fig. 2B). In this population, the predominant products were isomaltooligosaccharides, but oligosaccharides of unknown structure were also detected. By combining HPSEC and HPAEC-PAD analyses, the population of IMW dextrans was estimated to represent 32% of the available glucosyl residues (Table 1).

View this table: [in this window] [in a new window]   TABLE 1 Relative amount of glucosyl units incorporated into the products synthesized by DSR-S vardel 4N and ASR C-APY del, after complete depletion of 290 mM sucrose

View larger version (30K): [in this window] [in a new window]   FIGURE 3. Kinetics of oligosaccharide and polysaccharide production during polymerization catalyzed by DSR-S vardel 4N. A, HPAEC-PAD chromatograms, reaction analyzed at initial time, 10, 60, 180, and 300 min. B, products formed during the first 45 min. C, HPAEC-PAD chromatogram of products formed after 6 h of reaction, before and after specific digestion with invertase. D, HPSEC analysis during the polymerization reaction, after 0, 20, 30, 45, 120, 240, 360, and 480 min of reaction. G, glucose; F, fructose; S, sucrose; L, leucrose; I2, I3, I4, to I19 correspond to isomaltooligosaccharides of DP2 to DP19; DP2, disaccharides; DP1, monosaccharides.

View larger version (21K): [in this window] [in a new window]   FIGURE 4. HPSEC chromatograms of the products synthesized by ASR C-APY del during the polymerization reaction from 290 mM sucrose. Insert corresponds to an enlargement around the HMW and IMW regions. The reaction medium was analyzed at 0, 20, 30, 40, 50, 60, 70, 94, 196, and 376 min. DP2, disaccharides; DP1, monosaccharides. Arrows indicate an increase or decrease of the products over time.

View larger version (19K): [in this window] [in a new window]   FIGURE 5. Kinetics of oligosaccharide synthesis during polymerization catalyzed by ASR C-APY del. A, HPAEC-PAD chromatograms, reaction medium was analyzed at initial time, 2, 20, 94, and 196 min. B, kinetics of product release during initial reaction phase. G, glucose; F, fructose; S, sucrose; Tre, Trehalulose, Tur, Turanose; L, leucrose; I2, I3, I4 correspond to isomaltooligosaccharides of DP2 to DP4.

Comparison of Polymer Formation Catalyzed by Dextransucrase and Alternansucrase—Like dextransucrase, alternansucrase first catalyzes the transfer of the glucosyl moiety onto water and sucrose. However, glucosyl transfer onto glucose and fructose occurs earlier in the reaction process than for dextransucrase. In addition, alternansucrase produces a wider diversity of oligosaccharides containing both -1,6 and -1,3 linkages whereas dextransucrase produces mainly isomaltooligosaccharides, which is in agreement with the high regiospecificity of this enzyme.

View larger version (23K): [in this window] [in a new window]   FIGURE 6. Schematic representation of the DSR-S-truncated variants and their relative activity. The four different domains: (i) signal peptide, (ii) variable region, (iii) catalytic domain, and (iv) C-terminal domain, and the repeated units A, C, and N (shaded boxes) are localized according to Monchois et al. (37).

Dextransucrase-truncated Variants and Identification of Dextran Binding Zones
The primary structure of the full-length DSR-S contains number of repeated units in both the C-terminal domain and at the end of the variable region (Fig. 6) (37). As the HMW dextran chain reached its maximum size after only 45 min (23% of sucrose consumed), it can be proposed that the enzyme interacts very strongly with the polymer chain during growing. This could also explain the very low accumulation of dextran of intermediate size in the medium. Successive deletions of the C-terminal domain were thus undertaken to identify putative regions involved in the elongation process. For each construction, it was verified by endodextranase digestions that the linkage specificity of DSR-S was conserved (data not shown).

With reference to DSR-S vardel 4N, the construct DSR-S vardel 2 was truncated of one additional N and C repeat from C-terminal extremity (Fig. 6). The enzyme activity was reduced by 50%, but no significant change in product formation was observed by HPSEC (data not shown). On the contrary, deletion of an additional A repeat at the C-terminal end, in the variant DSR-S vardel 3, resulted in a dramatic decrease of initial activity (99%). However, this variant was able to consume 290 mM sucrose at 1 unit/ml of reaction medium and produce polymers. Surprisingly, a new population of Low Molecular Weight (LMW) dextran was observed in addition to the HMW polymer, with an average molecular mass of about 10,000 Da (Fig. 7A). This LMW population has never previously been described, and accounts for 25% of the transferred glucosyl residues (Table 3). A DSR-S vardel Core variant was also constructed (Fig. 6), in which the whole C-terminal domain was truncated. This variant also synthesized a LMW dextran of about 10,000 Da, at the cost of HMW polymer synthesis, which accounts for less than 10% of the glucosyl units available from sucrose (Table 3 and Fig. 7A). The reaction was followed over an 8-h period, showing that LMW dextran increased from 6,000 to 10,000 Da (Fig. 8), after 1–8 h of reaction.

View this table: [in this window] [in a new window]   TABLE 3 Relative amount of glucosyl units incorporated into the products synthesized by DSR-S vardel 4N, DSR-S vardel 3, DSR-S vardel Core, and DSR-S Core A after complete depletion of 290 mM sucrose

HPAEC-PAD analysis performed after total sucrose depletion showed that isomaltooligosaccharides were present in all the reaction media. They were, however, in more abundance and showed higher DP for the A truncated forms, compared with those produced by the DSR-S vardel 4N (Fig. 7B). In particular, a series of isomaltooligosaccharides of DP varying from 2 to about 60 was clearly observed for the DSR-S Core A reaction, in agreement with the HPSEC profile.

The effect of initial sucrose concentration on the product pattern was also studied. For all dextransucrase variants, increasing the initial sucrose concentration from 290 to 730 mM favored the synthesis of LMW dextran to the detriment of HMW polymer. Most significant results were observed with DSR-S vardel 3, for which this LMW population increased from 24 to 71% of the glucosyl units issued from sucrose by multiplying by 2.5 the initial sucrose concentration (Fig. 9A). With DSR-S vardel 4N, this new population is clearly identifiable on HPSEC chromatogram using 440 mM sucrose instead of 290 mM, representing then 16% of glucosyl residues. Finally, using DSR-S vardel Core, the HMW dextran synthesis was totally abolished using 580 mM sucrose, the reaction instead mainly producing LMW dextran (74% of the total glucosyl units, data not shown). Similar results were obtained with the alternansucrase, for which, the oligosaccharide population from DP 3 to DP 8 ranged from 34 to 73% of glucosyl residues transferred using 300 to 1000 mM sucrose, to the detriment of the HMW alternan synthesis (Fig. 9B).

Linkage Specificity
Dextransucrase and alternansucrase linkage specificities are clearly different. The C-terminal domain of dextransucrase does not seem to be involved in linkage specificity, as the DSR-S Core A catalyzes mainly -1,6 linkages like the native enzyme. However, glucansucrase sequence analysis has revealed that within the highly conserved regions of the catalytic domain, there exist small areas of divergence from the consensus. This is especially true for enzymes displaying unusual specificities such as the L. mesenteroides NRRL B-1355 alternansucrase ASR, the L. mesenteroides NRRL B-1299 dextransucrase DSR-E (-1,2 linkage specificity), or the Lactobacillus reuteri 121 reuteransucrase GTF-A (-1,4 linkage specificity) (38–40).

View larger version (26K): [in this window] [in a new window]   FIGURE 7. A, HPSEC and B, HPAEC-PAD profiles of products synthesized from 290 mM sucrose by (a) DSR-S vardel 4N, (b) DSR-S vardel 3, (c) DSR-S vardel Core, and (d) DSR-S Core A. LMW 10,000 Da, short population of dextran of about 10,000 Da; DP1, monosaccharides; I3 to I60: isomaltooligosaccharides of DP 3 to 60.

To further investigate this hypothesis, we constructed several dextransucrase mutants. These were made by replacing up to seven residues located immediately downstream of Asp-662 of DSR-S by the equivalent residues found in ASR, L. mesenteroides NRRL B-1299 DSR-E (second catalytic domain E2), and GTF-A sequences. Alternansucrase was also mutated downstream the aspartic acid Asp-767, by swapping of three residues with those found in the DSR-S sequence (Fig. 10).

Characterization of Dextransucrase Variants—To mimic the alternansucrase sequence, one single mutant S663Y and one triple mutant SEV663YDA were constructed. One triple mutant SEV663NNS was constructed to mimic the reuteransucrase (GTF-A), and one quintuple mutant SEVQTVI663KGVQEKV was constructed to mimic the second catalytic domain of DSR-E (Fig. 10).

By testing partially purified samples, it was seen that all of these mutants suffered a drastic loss of activity with only 4% residual activity for S663Y, 3% for SEV663YDA, 2% for SEV663NNS, and 0.5% for SEVQTVI663KGVQEKV. They were characterized in respect to their ability to synthesize HMW dextran in the presence of sucrose and to produce isomaltooligosaccharides by acceptor reaction with maltose and sucrose.

All of these mutants consumed more than 80% of substrate without being able to form dextran. The product pattern did not reveal the presence of any product of DP superior to 7 (data not shown). Mutant SEV663YDA was further purified following protocol optimized for DSR-S vardel 4N, and specific activity was determined at only 9 unit/mg, corresponding to a 98% loss compared with the wild-type. After purification, the variant was more stable and able to consume the 100 g/liter sucrose. However, sucrose hydrolysis appears to be largely favored, as 32% of glucosyl residues are transferred onto water. Part of the glucose released then acted the role of acceptor, resulting in the major synthesis of isomaltose (Glcp-(16)-Glcp), corresponding to 47% of glucosyl residues transferred. Traces of isomaltotriose, maltose or nigerose were also identified, as was the presence of other oligosaccharides of unknown structures probably resulting from glucosyl transfers onto sucrose (data not shown).

Acceptor reactions with maltose gave additional information. Mutant S663Y mainly catalyzed sucrose hydrolysis, and production of low amount of isomaltose (Fig. 11). For the SEV663YDA mutant, hydrolysis was still the major reaction catalyzed, but maltose was also recognized as an acceptor, resulting in the formation of panose (Glcp-(16)-maltose). Transglucosidase ability of the triple mutant SEV663NNS was less affected. Hydrolysis was maintained at low level compared with the first variants, and oligodextrans of DP up to 4 were observed (Glcp-(16)-Glcp-(16)-maltose). Isomaltose was however produced to a less extent compared with SEV663YDA, whereas panose was the major product. Leucrose was present in small amounts, showing that fructose was also recognized as acceptor. Products of unknown structure may correspond to transfers onto sucrose, and they were observed at low concentrations for all the variants. Finally, the quintuple mutant SEVQTVI663KGVQEKV was still able to produce little amounts of oligodextrans until DP 5 (Fig. 11). However, no oligosaccharides containing-1,2 linkages were detected. A second run of mutation was undertaken on this construct, downstream the nucleophile Asp-551, resulting in a variant which completely lost any activity, and was thus impossible to characterize.

View larger version (20K): [in this window] [in a new window]   FIGURE 8. Analysis of the products synthesized by DSR-S vardel Core from 290 mM sucrose at 0, 15, 30, 45, 60, 120, 180, 240, 300, 360, 420, and 480 min of reaction. LMW 10,000 Da, short population of dextran of about 10,000 Da; DP2, disaccharides; DP1, monosaccharides. Arrows indicate an increase or decrease of the products over time.

View larger version (14K): [in this window] [in a new window]   FIGURE 9. HPSEC profiles showing the effect of initial sucrose concentration on product synthesis by A, DSR-S vardel 3 (from 290 to 730 mM sucrose) and B, ASR C-APY del (from 50 to 1000 mM substrate).

The mutant was strongly affected for its ability to synthesize HMW polymer (Fig. 12A), and preferentially synthesized oligosaccharides. HPAEC-PAD analyses further revealed that it mainly produced isomaltooligosaccharides compared with the wild-type enzyme (Fig. 12B).

Acceptor reactions confirmed that linkage specificity was altered. The mutant did not produce oligoalternans of DP higher than 4 but did produce more oligodextrans (-1,6-linked glucosyl residues onto maltose). The variant was still able to synthesize OA4 (oligoalternan of DP4, Glcp-(13)-Glcp-(16)-maltose), representing 46% of the total oligosaccharides produced compared with 22% for the ASR C-APY del (Fig. 12C). Thus, this mutant can transfer glucosyl residues onto panose through either -1,6 or -1,3 linkage formation, seemingly without regiospecificity. However, the OA4 is not recognized as an acceptor, and consequently, the OA4 accumulates, almost no oligoalternans of higher DP are synthesized, and more oligosaccharides of the oligodextran series are produced.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Family 70 of the Glycoside-Hydrolases contains polymerases which, by utilizing sucrose, can catalyze production of HMW glucans. Previous work including sequence analysis and secondary structure predictions, especially in comparison with enzymes from GH-family 13, suggested that the mode of action of these catalysts is likely to resemble that of the -retaining transglucosidases of GH-family 13 (7, 13, 24–26). Clearly, the first step of polymer synthesis consists in the formation of a covalent glucosyl-enzyme intermediate, as indicated by Mooser & Iwaoka (22), and recently proved for the N. polysaccharea amylosucrase (11). The subsequent steps of the reaction are however less well understood. The previous work dealing with the mode of polymer formation of GH-family 70 enzymes suggested that elongation followed a single chain (or processive) mechanism, which occurred from the reducing end and involved two active sites (19). On the contrary, amylosucrases of GH-family 13 were shown to follow a non-processive mechanism involving only one active site, with elongation occurring at the non reducing end of the growing chain (13).

View larger version (34K): [in this window] [in a new window]   FIGURE 10. Sequence alignment of regions flanking the catalytic residues of glucansucrases of various linkage specificities. GTF-I (S. downei), GTF-C (S. mutans), and GTF-L (S. salivarius) are specific for -1,3 linkages, GTF-D (S. mutans), DSR-S (L. mesenteroides NRRL B-512F), DSR-C (L. mesenteroides NRRL B-1355), and DSR-E1 (L. mesenteroides NRRL B-1299) are specific for -1,6 linkages, ASR (L. mesenteroides NRRL B-1355) specific for alternated -1,6 and -1,3 linkages, DSR-E2 (L. mesenteroides NRRL B-1299) is specific for -1,2 linkages. GTF-A (Lactobacillus reuteri 121) catalyzes the synthesis of a glucan composed of about 50% of -1,4 linkages. AS (N. polysaccharea) is specific for -1,4 linkages and is the only glucansucrase classified in GH-family 13. , -strands from the putative (/)8 barrel. +1 +4 represent AS subsites shown to accept the molecules to be elongated (14). Catalytic amino acids are in bold. Residues which differ significantly from the consensus are in bold and underlined.

View larger version (28K): [in this window] [in a new window]   FIGURE 11. Acceptor reactions with DSR-S vardel 4N mutants. Product identification: G, glucose; F, fructose; S, sucrose; L, leucrose; I2, isomaltose, P, panose; OD4, oligodextran of DP4 (Glcp-(16)-Glcp-(16)-maltose).

Initial Phase of Polymer Formation—For both dextransucrase and alternansucrase, the use of HPAEC-PAD enabled the identification of products formed from 290 mM sucrose when less than 1% of the substrate was consumed. These analyses clearly demonstrate that catalysis starts by sucrose hydrolysis, as glucose and fructose are the only carbohydrates detected in the reaction medium during the first minutes of reaction. Rapidly, sucrose can start to act in the role of acceptor (after 2 min), latter followed by glucose. Initial sucrose glucosylation leads to the formation of oligosaccharides. The presence of a sucrose molecule in the glucan produced by GH-70 glucansucrase from S. sobrinus GFT-S3 was also previously proposed by Cheetham et al. (18) and consequently probably is a common feature for most of GH-70 enzymes. In addition, it was demonstrated for both dextransucrase and alternansucrase that increasing the initial sucrose concentration favored the acceptor reaction onto sucrose and redirects the glucan synthesis toward oligosaccharide production.

Elongation—The elongation process occurs by addition of glucosyl residues onto the non reducing end of previously formed acceptors. With dextransucrase, a series of isomaltooligosaccharides of increasing DP is preferentially formed, sucrose acceptor reaction products being minor products. These products are still present at the end of the reaction. This is in agreement with the high -1,6 linkage specificity of the enzyme. Glucose released is subsequently used as an acceptor to form isomaltose, that is released and glucosylated to form isomaltotriose, and so forth until formation of a HMW dextran of molecular weight up to 10⁷–10⁸ Da. Transfers onto fructose are favored at the end of the reaction, when fructose is in large excess, and results in leucrose synthesis (not exceed 22 mM). Alternansucrase elongation results in various series of oligosaccharides, mainly containing -1,6 and -1,3 linkages in the main chain, as shown by methylation analysis. Some of them are also branched, and contain sucrose, glucose or fructose at their reducing extremity. Part of these oligosaccharides will not be elongated and will accumulate in the medium (DP 8) whereas the others will be elongated until formation of a HMW alternan (1.7 x 10⁶ Da).

In similarity with amylosucrase from N. polysaccharea, the polymerization mechanism we describe here for both enzymes requires only one active site, capable of both glucan synthesis and exogenous molecule glucosylation. This mechanism agrees with the fact that only one catalytic site was found by primary structure analysis in all glucansucrases known, and that mutation of the catalytic residue Asp-551 of the DSR-S in asparginine destroyed both the polymer synthesis from sucrose alone, as the acceptor glucosylation reaction (26).

View larger version (18K): [in this window] [in a new window]   FIGURE 12. Effect of mutations on alternansucrase activity. Effect on polymer synthesis analyzed by HPSEC (A) and HPAEC-PAD (B). Effect on acceptor reaction with maltose, analyzed by HPAEC-PAD (C). I2, isomaltooligosaccharide of DP2; M, maltose; P, panose; OD4, oligodextran of DP4 (Glcp-(16)-Glcp-(16)-maltose); OA4, oligoalternans of DP4 (Glcp-(13)-Glcp-(16)-maltose).

Concerning the alternansucrase, two major populations of products are formed, increasing concomitantly after 30 min of reaction (Fig. 5B). The diversity of oligosaccharide structures observed on HPAEC-PAD chromatograms suggests that among the structures initially formed, some of them may have better affinity with the enzyme and are preferentially elongated. Thus, the population of oligosaccharides of DP 8 would represent less efficient acceptors which accumulate in the medium. In similarity to the situation with the dextransucrase, we suggest that longer alternan molecules are capable of interacting with surface alternan binding site and hence promote their own elongation.

Consequently, taking into account the dual nature of the elongation mechanism highlighted, we propose here a semiprocessive mechanism of polymerization for GH-70 glucansucrases. Comparison of dextransucrase and alternansucrase kinetic of polymer formation also permit to conclude that glucan binding zones (like those found at the C-terminal end of DSR-S) support elongation and the efficiency of polymer formation. These zones can be proposed to act as mediator of the shift between the processive and non processive elongation process.

One must also keep in mind that the size of the polymer formed is also dependant on the intrinsic physicochemical property of the reaction product, all these factors being part of the variety in size of the glucans formed by glucansucrases. Of course, resolution of the three-dimensional structure of one glucansucrase of this GH-family 70 is now attempted to confirm this model.

Linkage Specificity—Dextransucrase mutants constructed in this study all retained the wild-type linkage specificity but were severely affected in their activity, loosing their ability to form glucan. For instance the purified mutant SEV663YDA displayed a specific activity reduced by 98% compared with the wild type. It can be seen in this example that our attempt to alter linkage specificity instead resulted in a destruction of enzyme activity. By modifying the residues immediately downstream of Asp-662, which we proposed were responsible in forming subsites +1 and +2 using AS as model, we have inadvertently severely restricted acceptor recognition. As previously shown, the DSR-S linkage specificity is susceptible to change, as the mutation of the Thr-667 (corresponding to subsite +3 for AS) to arginine increased the -1,3 linkage content of polymer synthesized from less than 5% to 13% (43). Recently, Funane et al. (44) also shown that it was possible to introduce 4% of -1,2 linkages in the dextran synthesized by a DSR-S variant where lysine replaced two residues at positions Thr-350 and Ser-445. In that example, the mutations were however not localized within the ((/)₈ barrel.

Concerning the alternansucrase, the mutant YDA768SEV clearly looses the ability to alternate linkage formation. While it was able to create an -1,3 linkage after an -1,6 one (i.e. DP4 oligoalternan), it was unable to recognize this -1,3-linked glucosyl as an acceptor and extend it on turn. Consequently, the mutant synthesized a high content of oligodextrans composed of -1,6-linked glucosyl residues compared with the wild-type. As for the S663Y mutation in DSR-S sequence, the aromatic tyrosine modified to serine is the most significant change, and probably at the origin of the strong effect on the catalysis. Considering that the tyrosine Tyr-768 in the alternansucrase align with the Asp-394 residue of N. polysaccharea AS (Fig. 10), which as been shown to have interactions with glucosyl units in positions +1 and +2 on the protein, we propose here that the alternansucrase aromatic residue displays stacking interactions with the glucosyl in position +2. After the formation of the covalent glucosyl-enzyme intermediate, the non-reducing end of the acceptor would bind into the +1 subsite with the C₃ or the C₆ hydroxyl orientated so to attack the C₁ of the glucosyl covalently linked to the enzyme. We suggest here that the non-reducing end of the acceptor, positioned in +1 subsite, is not well stabilized in the alternansucrase. On the contrary, the glucan in the +2 subsite would be more stabilized through interactions via the aromatic residue 768. Taking into account these considerations, C₃ and C₆ accessibility would depend on the linkage between the +1 and +2 glucosyl units. As a consequence, an -1,6 linkage induces the formation of an -1,3 linkage, and an -1,3 linkage induces the formation of an -1,6 linkage. Such a model could explain the catalytic property of alternansucrase that alternate linkages. Accordingly, the mutation of the Tyr-667 removes the staking interactions and thus affects the alternating process, redirecting the synthesis to the -1,6 linkage formation, a more favorable reaction probably for steric hindrance or energy reasons. Indeed, according to Robyt (45), the -1,6 link requires less energy to be formed than the -1,2; -1,3 or -1,4. These considerations may explain why the replacement of the three residues YDA with SEV in alternansucrase permitted an increase of -1,6 links in glucans synthesized, whereas it was impossible to change the linkage pattern of the DSR-S. Similar arguments may explain why it was recently shown that mutation of the peptide NNS in SEV in the L. reuteri GTF-A permitted the rational transformation of the reuteransucrase into a dextransucrase (46).

Finally, this work highlighted the importance of gaining a better understanding of the glucansucrase mode of action thus improving rational engineering of these enzymes. Hopefully, in the near future, it will be possible to rationally engineer glucansucrases so to have a better control of glucan size, structures, and physicochemical properties.

	FOOTNOTES

 
^* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ To whom correspondence should be addressed. Tel.: 33-561-55-94-46; Fax: 33-561-55-94-00; E-mail: remaud{at}insa-toulouse.fr.

² The abbreviations used are: GH, Glycoside-Hydrolase; DSR-S, L. mesenteroides NRRL B-512F dextransucrase; IMW, intermediate molecular weight polymer; HMW, high molecular weight polymer; LMW, low molecular weight polymer.

³ Coutinho, P. M., and Henrissat, B. (1999) Carbohydrate-Active Enzymes server.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Monsan, P., Bozonnet, S., Albenne, C., Joucla, G., Willemot, R. M., and Remaud-Simeon, M. (2001) Int. Dairy J. 11, 675–685[CrossRef]
2. Koepsell, H. J., Tsuchiya, H. M., Hellman, N. N., Kazenko, A., Hoffman, C. A., Sharpe, E. S., and Jackson, R. W. (1953) J. Biol. Chem. 200, 793–801[Free Full Text]
3. Richard, G., Morel, S., Willemot, R. M., Monsan, P., and Remaud-Simeon, M. (2003) Carbohydr. Res. 338, 855–864[CrossRef][Medline] [Order article via Infotrieve]
4. Uitdehaag, J. C. M., Mosi, R., Kalk, K. H., Van Der Veen, B. A., Dijkhuizen, L., Withers, S. G., and Dijkstra, B. W. (1999) Nat. Struct. Biol. 6, 432–436[CrossRef][Medline] [Order article via Infotrieve]
5. Monchois, V., Willemot, R. M., and Monsan, P. (1999) FEMS Microbiol. Rev. 23, 131–151[CrossRef][Medline] [Order article via Infotrieve]
6. Kralj, S., van Geel-Schutten, G. H., Dondorff, M. M., Kirsanovs, S., van der Maarel, M. J., and Dijkhuizen, L. (2004) Microbiology 150, 3681–3690[Abstract/Free Full Text]
7. Macgregor, E. A., Jespersen, H. M., and Svensson, B. (1996) FEBS Lett. 378, 263–266[CrossRef][Medline] [Order article via Infotrieve]
8. Potocki De Montalk, G., Remaud-Simeon, M., Willemot, R. M., Planchot, V., and Monsan, P. (1999) J. Bacteriol. 181, 375–381[Abstract/Free Full Text]
9. Pizzut-Serin, S., Potocki-Veronese, G., van der Veen, B. A., Albenne, C., Monsan, P., and Remaud-Simeon, M. (2005) FEBS Lett. 579, 1405–1410[CrossRef][Medline] [Order article via Infotrieve]
10. Skov, L. K., Mirza, O., Henriksen, A., De Montalk, G. P., Remaud-Simeon, M., Sarcabal, P., Willemot, R. M., Monsan, P., and Gajhede, M. (2001) J. Biol. Chem. 276, 25273–25278[Abstract/Free Full Text]
11. Jensen, M. H., Mirza, O., Albenne, C., Remaud-Simeon, M., Monsan, P., Gajhede, M., and Skov, L. K. (2004) Biochemistry 43, 3104–3110[CrossRef][Medline] [Order article via Infotrieve]
12. Sarcabal, P., Remaud-Simeon, M., Willemot, R., Potocki, d. M., Svensson, B., and Monsan, P. (2000) FEBS Lett. 474, 33–37[CrossRef][Medline] [Order article via Infotrieve]
13. Albenne, C., Skov, L. K., Mirza, O., Gajhede, M., Feller, G., D'Amico, S., Andre, G., Potocki-Veronese, G., van der Veen, B. A., Monsan, P., and Remaud-Simeon, M. (2004) J. Biol. Chem. 279, 726–734[Abstract/Free Full Text]
14. Skov, L. K., Mirza, O., Sprogoe, D., Dar, I., Remaud-Simeon, M., Albenne, C., Monsan, P., and Gajhede, M. (2002) J. Biol. Chem. 277, 47741–47747[Abstract/Free Full Text]
15. Ebert, K. H., and Schenk, G. (1968) Adv. Enzymol. Relat. Areas Mol. Biol. 30, 179–221[Medline] [Order article via Infotrieve]
16. Tsuchiya, H. M., Hellman, N. N., and Koepsell, H. J. (1953) J. Am. Chem. Soc. 75, 757–758[CrossRef]
17. Kobayashi, M., Yokoyama, I., and Matsumada, K. (1986) Agric. Biol. Chem. 50, 2585–2590
18. Cheetham, N. H., Slodki, M. E., and Walker, G. J. (1991) Carbohydr. Polym. 16, 349–353[CrossRef]
19. Robyt, J. F., Kimble, B. K., and Walseth, T. F. (1974) Arch. Biochem. Biophys. 165, 634–640[CrossRef][Medline] [Order article via Infotrieve]
20. Ditson, S. L., and Mayer, R. M. (1984) Carbohydr. Res. 126, 170–175[CrossRef]
21. Robyt, J. F., and Martin, P. J. (1983) Carbohydr. Res. 113, 301–315[CrossRef][Medline] [Order article via Infotrieve]
22. Mooser, G., and Iwaoka, K. R. (1989) Biochemistry 28, 443–449[CrossRef][Medline] [Order article via Infotrieve]
23. Mooser, G., Hefta, S. A., Paxton, R. J., Shively, J. E., and Lee, T. D. (1991) J. Biol. Chem. 266, 8916–8922[Abstract/Free Full Text]
24. Kato, C., Nakano, Y., Lis, M., and Kuramitsu, H. K. (1992) Biochem. Biophys. Res. Commun. 189, 1184–1188[CrossRef][Medline] [Order article via Infotrieve]
25. Devulapalle, K. S., Goodman, S. D., Gao, Q., Hemsley, A., and Mooser, G. (1997) Protein Sci. 6, 2489–2493[Medline] [Order article via Infotrieve]
26. Monchois, V., Remaud-Simeon, M., Russell, R. R., Monsan, P., and Willemot, R. M. (1997) Appl. Microbiol. Biotechnol. 48, 465–472[CrossRef][Medline] [Order article via Infotrieve]
27. Robyt, J. F., and Walseth, T. F. (1978) Carbohydr. Res. 61, 433–445[CrossRef][Medline] [Order article via Infotrieve]
28. Mayer, R. M., Matthews, M. M., Futerman, C. L., Parnaik, V. K., and Jung, S. M. (1981) Arch. Biochem. Biophys. 208, 278–287[CrossRef][Medline] [Order article via Infotrieve]
29. Stodola, F. H. (1952) J. Am. Chem. Soc. 74, 3202–3203
30. Su, D., and Robyt, J. F. (1994) Arch. Biochem. Biophys. 308, 471–476[CrossRef][Medline] [Order article via Infotrieve]
31. Moulis, C., Arcache, A., Escalier, P. C., Rinaudo, M., Bouchu, A., Monsan, P., Remaud-Simeon, M., and Potocki-Veronese, G. (2006) FEMS Microbiol. Lett. 261, 203–210[CrossRef][Medline] [Order article via Infotrieve]
32. Joucla, G., Pizzut-Serin, S., Monsan, P., and Remaud-Simeon, M. (2006) FEBS Lett. 580, 763–768[CrossRef][Medline] [Order article via Infotrieve]
33. Barik, S. (1995) Mol. Biotechnol. 3, 1–7[Medline] [Order article via Infotrieve]
34. Miller, A. W., and Robyt, J. F. (1986) Anal. Biochem. 156, 357–363[CrossRef][Medline] [Order article via Infotrieve]
35. Sumner, J., and Howell, S. (1935) J. Biol. Chem. 108, 51–54[Free Full Text]
36. Ciucanu, I., and Kerek, F. (1984) Carbohydrate Res. 131, 209–217[CrossRef]
37. Monchois, V., Reverte, A., Remaud-Simeon, M., Monsan, P., and Willemot, R. M. (1998) Appl. Environ. Microbiol. 64, 1644–1649[Abstract/Free Full Text]
38. Arguello-Morales, M. A., Remaud-Simeon, M., Pizzut, S., Sarcabal, P., Willemot, R., and Monsan, P. (2000) FEMS Microbiol. Lett. 182, 81–85[Medline] [Order article via Infotrieve]
39. Bozonnet, S., Dols-Laffargue, M., Fabre, E., Pizzut, S., Remaud-Simeon, M., Monsan, P., and Willemot, R. M. (2002) J. Bacteriol. 184, 5753–5761[Abstract/Free Full Text]
40. Kralj, S., van Geel-Schutten, G. H., Rahaoui, H., Leer, R. J., Faber, E. J., van der Maarel, M. J., and Dijkhuizen, L. (2002) Appl. Environ. Microbiol. 68, 4283–4291[Abstract/Free Full Text]
41. Davies, G. J., Wilson, K. S., and Henrissat, B. (1997) Biochem. J. 321, 557–559
42. Funane, K., Ookura, T., and Kobayashi, M. (1998) Biosci. Biotechnol. Biochem. 62, 123–127[CrossRef][Medline] [Order article via Infotrieve]
43. Remaud-Simeon, M., Willemot, R. M., Sarcabal, P., Potocki de Montalk, G., and Monsan, P. (2000) J. Mol. Catal. B: Enzym. 10, 117–128[CrossRef]
44. Funane, K., Ishii, T., Ono, H., and Kobayashi, M. (2005) FEBS Lett. 579, 4739–4745[Medline] [Order article via Infotrieve]
45. Robyt, J. F. (1995) Adv. Carbohydr. Chem. Biochem. 51, 133–168[Medline] [Order article via Infotrieve]
46. Kralj, S., van Geel-Schutten, I. G., Faber, E. J., van der Maarel, M. J., and Dijkhuizen, L. (2005) Biochemistry 44, 9206–9216[CrossRef][Medline] [Order article via Infotrieve]
47. Mooser, G. (1992) The Enzymes Vol. XX, pp. 188–225, Academic Press Inc., New York

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				C. Olvera, J. L. Fernandez-Vazquez, L. Ledezma-Candanoza, and A. Lopez-Munguia Role of the C-terminal region of dextransucrase from Leuconostoc mesenteroides IBT-PQ in cell anchoring Microbiology, December 1, 2007; 153(12): 3994 - 4002. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 281/42/31254    most recent M604850200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Moulis, C. Articles by Remaud-Simeon, M. Search for Related Content PubMed PubMed Citation Articles by Moulis, C. Articles by Remaud-Simeon, M. Social Bookmarking                      What's this?