JBC Ideal method for primary cell transfection

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M603762200 on August 22, 2006

J. Biol. Chem., Vol. 281, Issue 42, 31369-31379, October 20, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/42/31369    most recent
M603762200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, H.-J.
Right arrow Articles by Bernier, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, H.-J.
Right arrow Articles by Bernier, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Pyrrolidine Dithiocarbamate Inhibits Interleukin-6 Signaling through Impaired STAT3 Activation and Association with Transcriptional Coactivators in Hepatocytes*

Hua-Jun He{ddagger}1, Tie-Nian Zhu{ddagger}1, Yi Xie{ddagger}1, Jinshui Fan§2, Sutapa Kole{ddagger}, Satya Saxena, and Michel Bernier{ddagger}3

From the {ddagger}Diabetes Section, Laboratory of Clinical Investigation, §Laboratory of Cellular and Molecular Biology, and Proteomics and Mass Spectrometry Unit, NIA, National Institutes of Health, Baltimore, Maryland 21224

Received for publication, April 19, 2006 , and in revised form, August 22, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Interleukin (IL)-6 is a proinflammatory cytokine that has been implicated in the expression of acute phase plasma proteins and hepatic insulin resistance through activation of the JAK/STAT3 pathway. Although previous studies have demonstrated that pyrrolidine dithiocarbamate (PDTC) exerts protection against inflammatory responses, its role in the regulation of IL-6 receptor signaling remains unclear. Here we show that treatment of cultured HepG2 hepatoma cells with PDTC inhibits IL-6-stimulated tyrosine phosphorylation and subsequent nuclear translocation of STAT3 in a dose- and time-dependent fashion. No inhibition of JAK-1 activity was observed. To provide insight into PDTC signaling, we constructed a conditionally active STAT3 by fusing it with the ligand binding domain of the estrogen receptor (STAT3-ER). In the presence of 4-hydroxytamoxifen STAT3-ER was translocated in the nucleus of HepG2 cells in a phosphorylation-independent manner, and treatment with PDTC mitigated the response. Although STAT3 coprecipitated with heat-shock protein 90 (Hsp90) in control cells, coprecipitation of the two proteins was greatly reduced after PDTC treatment or after exposure to geldanamycin, an Hsp90 inhibitor. As a result there was a decrease in IL-6-induced association of STAT3 with the transcriptional coactivators FOXO1a and C/EBPbeta together with significant reduction in the expression of SOCS-3 protein and that of two major acute phase plasma proteins. Importantly, treatment of HepG2 cells and a primary culture of rat hepatocytes with PDTC restored insulin responsiveness that was abrogated by IL-6. These studies are consistent with the ability of PDTC to down-regulate IL-6-induced STAT3 activation by altering the stability of STAT3-Hsp90 complex.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Signal transducer and activator of transcription 3 (STAT3)4 is a critical regulator of the expression of genes involved in interleukin (IL)-6 signaling, including the inflammatory response and development (1, 2). Exposure of cells to IL-6 leads to the activation of its cell surface receptor, which consists of two subunits, an 80-kDa ligand binding unit and a 130-kDa transmembrane signal transducer termed gp130, thus resulting in the activation of associated cytoplasmic Janus tyrosine kinases (Jak1, Jak2, and Tyk2) with subsequent tyrosine phosphorylation of gp130 and STAT3 (3, 4). Phosphorylated STAT3 dimerizes via reciprocal SH2-phosphotyrosine interaction and translocates to the nucleus, where it regulates the transcription of target genes through binding to specific DNA-responsive elements (5). Phosphorylation of Ser727 located in the C-terminal transactivation domain of STAT3 is required to achieve maximal transcriptional activity (6). IL-6 contributes via the gp130/JAK/STAT3 cascade to the increased production of acute phase plasma proteins (APP) by the liver (7). Studies with hepatocyte-specific targeted inactivation of gp130 or STAT3 gene in mice have confirmed the role of these proteins in the control of acute phase gene expression and other IL-6-induced biological responses (8, 9).

Specific cis elements on the promoters of APP genes have been defined and were shown to bind several transcription factors. For example, CAAT/enhancer-binding protein (C/EBP) beta, originally identified and named nuclear factor IL-6 (10), and STAT3 are capable of cooperative activation of the haptoglobin promoter (11). The synthesis of {alpha}2-macroglobulin ({alpha}2M), an APP protein, is also enhanced in response to IL-6 during acute phase reaction and may require C/EBPbeta (12). Acute phase reaction induces a specific interaction of c-Jun and STAT3 to result in the transcriptional activation of the {alpha}2 M gene (13) and that of diverse genes (14). Moreover, FOXO1a, a member of the FOXO subfamily of Forkhead transcription factors, was reported to act as coactivator of STAT3-dependent expression of {alpha}2M gene in HepG2 hepatoma cells (15). Forkhead transcription family members are related to the liver-specific hepatocyte nuclear factor 3 (16). In the basal state these FOXO proteins are localized to the nucleus and interact with specific DNA sequences within the promoters of multiple target genes to modulate various cellular activities (17–19). The activation of Akt (also called protein kinase B) induces the phosphorylation and nuclear exclusion of the FOXO proteins, resulting in inhibition of FOXO-dependent transactivation mechanisms (20). These observations suggest that coactivators of transcription play critical roles in STAT3-mediated regulation of APP gene expression in response to IL-6.

Because of the important role of activated STAT3 in inflammation and the development of a number of cancers (21), intervention aimed at blocking the JAK/STAT3 pathway represents an attractive target for an antagonist where excessive IL-6 signaling occurs. Toward this aim, a JAK-2-specific inhibitor related to the tyrphostin class of compounds has been identified (22). Pyrrolidine dithiocarbamate (PDTC) is a low molecular weight compound that exerts numerous effects in biological systems by acting both as biological thiol antioxidant and metal chelator. For example, PDTC blocks DNA fragmentation and restores acute glucose-stimulated insulin release in human pancreatic islets maintained in high glucose for 4 days (23). It also inhibits cytokine-induced activation of nuclear factor (NF)-{kappa}B (24), which is involved in the transcriptional activation of a number of gene products during inflammation.

Accumulating evidence suggests that STAT3 exhibits redox sensitivity, and reactive oxygen species trigger tyrosine phosphorylation and nuclear translocation of STAT3 (25, 26). The importance of cell redox in STAT3 signaling and the rationale for identifying modulators of IL-6 action has prompted us to ascertain the effectiveness of PDTC in regulating the functionality of STAT3. Our observations that PDTC elicits STAT3 dissociation from Hsp90 represents a mechanism by which IL-6-induced STAT3 transcriptional activation is inhibited and insulin responsiveness is restored in hepatocytes.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Antibodies and Reagents—PDTC (Sigma-Aldrich) was prepared in phosphate-buffered saline, pH 7.4, as a 100 mM stock solution and used at a final concentration of 50 µM unless indicated otherwise. Recombinant human insulin (Calbiochem/Novabiochem) was prepared in 0.01 N HCl as a 100 µM stock solution, separated into aliquots, and stored frozen at –20 °C. Recombinant human and rat IL-6 (R&D Systems, Inc., Minneapolis, MN) were prepared in phosphate-buffered saline supplemented with 0.1% bovine serum albumin as a 10 µg/ml stock solution, separated into aliquots, and stored frozen at –70 °C. Polyclonal antibodies against phospho-STAT3 (Tyr705), phospho-STAT3 (Ser727), phospho-JAK1 (Tyr1022/1023), phospho-Akt (Ser473), and phospho-p44/42 mitogen-activated protein kinase (Thr202/Tyr204) as well as anti-glycogen synthase kinase 3beta were purchased from Cell Signaling Technology, Inc. (Beverly, MA). Antibodies against STAT3 (sc-482, sc-8019), gp130 (sc-655), p89TFIIH (sc-293), SOCS3 (sc-9023), estrogen receptor (ER)-{alpha} (sc-8002), and C/EBPbeta (sc-150) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-JAK1 and anti-Hsp90 monoclonal antibodies and horseradish peroxidase-conjugated RC20 were purchased from BD Biosciences (San Diego, CA).

Plasmid Construction—STAT3 was fused with the ligand binding domain of the estrogen receptor (STAT3-ER). The human STAT3 cDNA was amplified by PCR from pcEF-STAT3-Myc (gift from Paritosh Ghosh, NIA, NIH) using 5'-NotI (5'-TAGCGGCCGCATGGCCCAATGGAATCAGCTAC; sense) and 3'-XhoI (5'-TACTCGAGCATGGGGGAGGTAGCGCACTC; antisense)-containing primers (underlining indicates restriction enzyme sites). The ligand binding domain of the human estrogen receptor {alpha} (ER-LBD) sequence encoding amino acids 282–595 was amplified by PCR from ER/pRSET (gift from T. Skaar, Lombardi Cancer Center, Washington, D. C.) using 5'-XhoI (5'-ATCTCGAGGCTGGAGACATGAGAGCTGCCAACCTTTGGCCAAGCCCGCTCATGATC; sense) and 3'-ApaI (5'-TAGGGCCCTCAGACCGTGGCAGGGAAAC; antisense)-containing primers. The PCR products were digested as indicated and cloned into the NotI/ApaI sites of pcDNA3.1(+) (Invitrogen) generating pSTAT3ER-3.1.

Cell Culture—HepG2 cells were purchased from the American Type Cell Collection (ATCC, Manassas, VA). Cells were cultured in minimal essential medium supplemented with 10% fetal bovine serum, 1 mM pyruvate, 50 units/ml penicillin/50 µg/ml streptomycin, and 2 mM L-glutamine.

Parenchymal liver cells were prepared from adult Fisher 344 male rats by in situ retrograde perfusion of the liver with collagenase (27). The cells were seeded onto collagen-coated dishes (BD Discovery Labware) and cultured for 4 h in William's E medium supplemented with 5% fetal bovine serum, 2 mML-glutamine, and penicillin/streptomycin to allow attachment of adherent liver cells. The medium was then replaced with William's E medium containing 5% fetal bovine serum. After 18 h the hepatocytes were subjected to 4 h of serum starvation before the addition of PDTC and IL-6 as indicated.

Transfection, Cell Treatment, and Nuclear Extraction—HepG2 cells and rat hepatocytes were treated in serum-free medium in the presence or absence of PDTC for the times indicated and stimulated with 20 ng/ml recombinant IL-6 for an additional 10 min. The cells were lysed in radioimmune precipitation buffer (25 mM HEPES, pH 7.4, 134 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 0.5% sodium deoxycholate, 100 mM NaF, 1 mM orthovanadate, and protease mixture inhibitor set I (Calbiochem)) and then used in immunoprecipitation and Western blot analysis.

In some experiments serum-starved HepG2 cells were treated with either the macrolide rapamycin (100 nM) for 1 h or geldanamycin (2 µM) for 16 h before the addition of IL-6 for 15 min. Both inhibitors were purchased from Calbiochem-Novabiochem and prepared as 1000x stock solution in Me2SO. Cells were lysed, and nuclear extracts were prepared by using the NE-PERTM extraction reagents according to the manufacturer's protocol (Pierce).

In other experiments HepG2 cells maintained in phenol red-free {alpha}-minimal essential medium (Invitrogen) and supplemented with 10% charcoal, dextran-treated serum (Hyclone, Logan, UT) were transfected by Lipofectamine2000 method with pcDNA3.1 as control vector or a plasmid encoding STAT3-ER construct. Twenty-four hours later cells were serum-starved for 4 h then either left alone or treated with 50 µM PDTC for 2 h followed by the addition of 1 µM 4-hydroxytamoxifen (Sigma) or recombinant human IL-6 (20 ng/ml) for 16 h. Cells were lysed, and nuclear extracts were prepared as described above.


Figure 1
View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 1.
PDTC inhibits IL-6-induced phosphorylation and nuclear localization of STAT3 and its stimulation of SOCS3 expression. A, serum-starved HepG2 cells were incubated with 20 ng/ml IL-6 for the indicated periods of time. Cell lysates were resolved by SDS-PAGE followed by Western blot analysis with anti-phospho-STAT3 (Tyr705)(py-STAT3)(top panel), SOCS3 (middle panel), or STAT3 antibodies (bottom panel). B and C, HepG2 cells were treated with 50 µM PDTC for the times indicated (B) or various concentrations of PDTC for 2 h before the stimulation with IL-6 (20 ng/ml) for 10 min. Total cell extracts were subjected to Western blot analysis with Tyr(P)-STAT3 and STAT3 antibodies. The Tyr(P)-STAT3 and STAT3 signals were quantitated by densitometry using ImageQuant software, and a value of 1.0 was assigned to the Tyr(P)-STAT3/STAT3 ratio of untreated cells stimulated with IL-6. The results are the means ± S.E. from four independent experiments. D and E, HepG2 cells were left untreated or treated with 50 µM PDTC for 2 h before the addition IL-6 for 10 min. Total cell extracts (D) and nuclear fractions (E) were prepared followed by Western blot analysis with phospho-STAT3 (Ser727)(pS-STAT3) or STAT3 antibody (panel D) or Tyr(P)-STAT3, STAT3, and HSP70 antibodies (panel E).

 
Chloramphenicol Acetyltransferase (CAT) Reporter Assay—HepG2 cells were transfected by the Lipofectamine2000 method with a CAT reporter construct driven by 190 bp of the rat haptoglobin promoter (Hp (190)-CAT) (a gift from Heinz Bauman, Roswell Park Cancer Institute, Buffalo, NY (28)) and a control plasmid expressing beta-galactosidase (Clontech). Twenty-four hours later cells were serum-starved for 4 h, then either left alone or treated with 50 µM PDTC for 2 h followed by the addition of recombinant human IL-6 (20 ng/ml) for 16 h. Cells were lysed, and CAT and beta-galactosidase activities were determined according to the manufacturers' instructions (Promega, Madison, WI). For each sample the normalized response was determined by dividing relative cpm measured in a CAT assay with the beta-galactosidase activity in the same lysate. The -fold induction was calculated by using the average normalized responses from two independent experiments performed in duplicate dishes.

Northern Blot Analysis—We used the method of Fan et al. (29) in performing Northern blot analysis. Briefly, HepG2 cells were plated on 100-mm dishes and grown to near confluency. Total RNA was extracted with STAT-60 (Tel-Test "B", Friendswood, TX). 20-µg RNA samples were denatured, size-fractionated by electrophoresis in 1.2% agarose-formaldehyde gels, and transferred onto GeneScreen Plus nylon membranes (PerkinElmer Life Sciences). For the detection of haptoglobin, human {alpha}2M and 18 S rRNA (serves as the loading control), oligomers complementary to the corresponding RNAs (haptoglobin, 5'-CCACATACTGCTTCACATTCAGGAAGTTTATCTCCAACAGC-3'; {alpha}2M, 5'-CACCCTCTAACTGGAACTCTGCCATTGTGCGATGCGATT-3'; 18S, 5'-ACGGTATCTGATCGTCTTCGAACC-3') were 3'-end-labeled with [{alpha}-32P]dATP by terminal deoxynucleotidyltransferase (Invitrogen). Blots were prehybridized (2 h) and hybridized (overnight) at 63 °C in a buffer containing 1% bovine serum albumin, 7% SDS, 0.25 M phosphate buffer, and 1 mM EDTA. The hybridized membranes were washed twice with wash buffer A (0.5% bovine serum albumin, 5% SDS, 0.5 M phosphate buffer, and 0.5 mM EDTA) and twice with wash buffer B (5% SDS, 0.5 M phosphate buffer, and 0.5 mM EDTA). The signals were visualized, quantified using a PhosphorImager and the ImageQuant program (GE Healthcare), and then normalized against 18 S rRNA.

Immunoprecipitation and Western Blot Analysis—HepG2 cells grown on 100-mm dishes were lysed in radioimmune precipitation buffer for 30 min on ice with occasional vortexing. The clarified lysates were precleared with 20 µl of protein A/G-coupled agarose (Upstate%20Biotechnology">Upstate Biotechnology, Lake Placid, NY) for 90 min at 4 °C and separated into aliquots before the addition of monoclonal antibody against STAT3 or JAK1, polyclonal antibodies against gp130, STAT3, or C/EBPbeta, or rabbit IgG for overnight incubation at 4 °C. The immune complexes were sedimented with protein G-coupled agarose and extensively washed. The samples were separated by SDS-polyacrylamide gel electrophoresis under reducing conditions, transferred onto polyvinylidene difluoride membranes, and analyzed by Western blot with primary antibodies and chemiluminescence using ECL or ECL-plus detection method (Amersham Biosciences).

Analysis of STAT3-associated Proteins—Anti-STAT3 immunoprecipitates were washed extensively with 50 mM HEPES, pH 7.4, supplemented with 0.5 M NaCl and 0.1% Triton X-100, and the proteins in the immune complex were resolved by SDS-PAGE followed by staining of the gels with EZ Blue (Sigma-Aldrich). The ~90-kDa protein bands were excised and subjected to in-gel digestion with trypsin (Promega). The peptide mixture was acidified with 0.5% acetic acid and loaded onto a reverse phase C18 trap column for desalting, after which the sample was transferred onto a PicoFrit (75 x 100 mm) column packed with ProteoPepTM II C18, 300 Å, 5-µm particles (New Objective) connected to a nano-liquid chromatography system (Dionex, Sunnyvale, CA) on-line with an LTQ ion trap mass spectrometer (Thermo Finnigan, San Jose, CA). The peptides were eluted using a linear gradient of 0–65% acetonitrile over 90 min at a flow rate of 250 nl/min directly into the mass spectrometer, which was operated to generate collision-induced dissociation spectra (data-dependent MS/MS mode). The resultant tandem mass spectrometry data were processed with a "suite" of software modules assembled in a data analysis "pipeline" (www.proteomecenter.org). The collected spectra were searched against the NCBI non-redundant human protein sequence data base using the computer algorithm SEQUEST. The statistical analysis and validation of the search results were done using the software modules PeptideProphet and Protein-Prophet developed at the Institute for Systems Biology (Seattle, WA).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
PDTC Inhibits STAT3 Activation by IL-6 without Attenuating JAK1 Tyrosine Kinase Activity—The dimerization, nuclear translocation, and increase in transcriptional activity of STAT3 require phosphorylation of tyrosine residue 705. To study the kinetics of STAT3 phosphorylation, lysates from non-stimulated and IL-6-treated HepG2 cells were prepared and analyzed by Western blot using a STAT3 phosphospecific antibody (Fig. 1). An increase in Tyr(P)-STAT3 level was observed within 2 min upon IL-6 stimulation and reached a maximum at 30 min (Fig. 1A, upper panel). A sharp reduction in Tyr(P)-STAT3 level accompanied the induction of SOCS-3, an inhibitor of JAK signaling, at both 1- and 2-h post-IL-6 stimulation (Fig. 1A, middle panel) under conditions where equal expression of STAT3 protein was observed (Fig. 1A, bottom panel).

To determine whether IL-6-induced tyrosine phosphorylation of STAT3 would be altered by treatment with PDTC, HepG2 cells were pretreated with vehicle or 50 µM PDTC for different time points followed by stimulation with IL-6 for 10 min (Fig. 1B). A time-dependent reduction in IL-6-stimulated Tyr(P)-STAT3 levels was observed with the steady-state level of STAT3 being unaffected by PDTC over a 4-h period. Similarly, treatment of HepG2 cells with PDTC for 2 h led to a dose-dependent inhibition of STAT3 phosphorylation in response to IL-6 with an IC50 ~ 30 µM (Fig. 1C). Moreover, pretreatment with PDTC decreased phosphorylation of serine residue 727 of STAT3 upon cell stimulation with IL-6 (Fig. 1D), with concomitant reduction in STAT3 nuclear translocation (Fig. 1E). Western blot analysis of the nuclear extracts showed equivalent expression of Hsp70 (Fig. 1E, bottom panel). These results demonstrate that IL-6-induced phosphorylation and nuclear translocation of STAT3 are sensitive to PDTC.


Figure 2
View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 2.
A, PDTC does not alter JAK1 autophosphorylation and kinase activity after IL-6 stimulation. Serum-starved HepG2 cells were treated with 50 µM PDTC for 2 h before the addition of IL-6 (20 ng/ml) for 10 min. Cell extracts were immunoprecipitated (IP) with gp130 (top two panels) or JAK1 (third and fourth panels) antibodies followed by Western blot analysis with antibodies directed against phosphotyrosine (pY) or phospho-active JAK1 (Tyr1022/1023). Total cell extracts were also subjected to Western blot analysis with Tyr(P)-STAT3 and STAT3 antibodies (bottom two panels). Similar results were obtained in two independent experiments. B, activation of protein tyrosine phosphatases is not involved in PDTC action. HepG2 cells were pretreated with PDTC for 1 h, and then 200 µM orthovanadate was added for an additional 1 h before the stimulation with IL-6 (20 ng/ml) for 10 min. Total cell extracts were subjected to Western blot analysis with Tyr(P)-STAT3 and STAT3 antibodies.

 
IL-6-stimulated tyrosine phosphorylation of STAT3 depends on JAK activity. We ascertained whether JAK1 would be a target of PDTC action. Lysates were prepared from control and treated HepG2 cells and then immunoprecipitated with antibodies directed against JAK1 or the gp130 signal transduction subunit of the IL-6 receptor. Western blot analysis was carried out using phosphospecific JAK1 antibody (pY-JAK1) or anti-phosphotyrosine (pY) (Fig. 2A). As anticipated, IL-6 stimulation induced a robust phosphorylation of JAK1 and its target gp130 on tyrosine residues; however, pretreatment with PDTC had no inhibitory effect despite marked attenuation of IL-6-stimulated Tyr(P)-STAT3 level (Fig. 2A, first and third panels versus the fifth panel). Reprobing these membranes showed equivalent expression of gp130, JAK1, and STAT3 proteins (Fig. 2A, second, fourth, and sixth panels). Likewise, PDTC did not inhibit JAK1 autophosphorylation when examined in an immunoprecipitation-based kinase assay (data not shown). These results indicate that PDTC does not suppress JAK1 activity nor does it attenuate phosphorylation of the gp130 cytoplasmic domain, a critical event in the recruitment and JAK-mediated tyrosine phosphorylation of STAT3.


Figure 3
View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 3.
A, PDTC inhibits phosphorylation-independent nuclear translocation of STAT3-ER. HepG2 cells transiently transfected with empty vector (lane 1) or STAT3-ER plasmid (lanes 2–6) were serum-starved and then treated with PDTC for 2 h before the addition of IL-6 or 1 µM 4-HT for 16 h. Nuclear extracts were prepared and immunoblotted (IB) with Tyr(P) (pY)-STAT3 (upper panel) or STAT3 (middle panel) antibodies. Nuclear extracts were also immunoprecipitated (IP) with anti-ER{alpha} antibody and analyzed by Western blotting using anti-STAT3 antibody (bottom panel). The asterisks indicate the migration position of endogenous Tyr(P)-STAT3. B, physical interaction between STAT3-ER and Hsp90 is blocked by PDTC. HepG2 cells transfected for 24 h with empty vector or STAT3-ER were treated with PDTC for 2 h and then incubated with 4-HT. Sixteen hours later cells were lysed, immunoprecipitated with an anti-Hsp90 antibody, and immunoblotted with anti-ER{alpha} (upper panel) or anti-Hsp90 (middle panel). Immunoprecipitation was also carried out with anti-ER{alpha} antibody and blotted with anti-STAT3. C, exposure to PDTC causes a dissociation of the complex formed between Hsp90 and cellular STAT3. HepG2 cells were left untreated or treated with PDTC and IL-6 as described previously. Cells were lysed and immunoprecipitated with control IgG (C) or anti-STAT3 antibody followed by immunoblotting using antibodies directed against Hsp90 (upper panel) or STAT3 (bottom panel). D, treatment of cells with geldanamycin results in impaired nuclear translocation of STAT3. HepG2 cells were preincubated with GA (2 µM) or rapamycin (100 nM) as indicated, and IL-6 (20 ng/ml) was added for an additional 15 min. Nuclear extracts were blotted with anti-STAT3 (upper panel) or anti-beta-actin (bottom panel) antibodies. For A–D, one representative experiment is shown, and similar results were obtained in two to three independent experiments.

 
Cellular protein-tyrosine phosphatase activity acts as negative modulator of STAT3 activation. To determine whether enhancement of tyrosine phosphatase activity is involved in the action of PDTC, we compared the effect of PDTC in the absence and the presence of the broad spectrum tyrosine phosphatase inhibitor orthovanadate (Fig. 2B). The addition of vanadate was without significant effect on PDTC ability to block IL-6-stimulated Tyr(P)-STAT3.

Disruption of the Complex between STAT3 and Hsp90 by Either PDTC Treatment or Exposure of Cells to Geldanamycin—STAT3 dimerization has been found to be sufficient for nuclear translocation even in the absence of tyrosine phosphorylation (21, 30). Therefore, we designed a conditionally active STAT3 by fusing the transcription factor with the ligand binding domain of the ER{alpha}, which contains a dimerization domain. This approach has been used earlier to demonstrate the nuclear translocation of similar chimeric constructs after cell stimulation with the synthetic ligand 4-hydroxytamoxifen (4-HT) (30). To reduce low level activation induced by serum estrogens and estrogen-like activities, we maintained HepG2 cells in phenol red-free medium supplemented with charcoal/dextran-treated fetal bovine serum for two passages before carrying out transfection experiments. HepG2 cells were transiently transfected with the STAT3-ER construct, and its nuclear entry was evaluated by immunoblot analysis (Fig. 3A). The nuclear extracts contained detectable amount of STAT3-ER in response to IL-6, which was inhibited by PDTC (Fig. 3A, middle panel; lane 4 versus 3). Importantly, STAT3-ER was markedly increased in the nucleus of 4-HT-treated cells, and PDTC mitigated the response (middle panel, lane 6 versus 5). Note as well that neither IL-6 nor 4-HT promoted phosphorylation of STAT3-ER, whereas IL-6 elicited tyrosine phosphorylation of endogenous STAT3 (Fig. 3A, upper panel). Immunoprecipitation assays were then performed using an anti-ER{alpha} antibody. As expected, the levels of immunoprecipitated STAT3-ER in the nucleus of IL-6- or 4-HT-treated cells were decreased by PDTC (Fig. 3A, bottom panel). These findings demonstrate that PDTC impairs the nuclear translocation of STAT3 independently of a bona fide defect in its tyrosine phosphorylation.

A recent study has shown that the chaperone Hsp90 is a key component of the multimeric protein complex encompassing STAT3 (31). We investigated whether Hsp90 was indeed associated with the endogenous STAT3. For this study extracts from HepG2 cells were prepared, and STAT3 immunoprecipitates were resolved by SDS-PAGE followed by staining of the gel. Two closely migrating bands of ~90 kDa were subjected to trypsin digestion followed by liquid chromatography-MS/MS analysis of the eluted peptides. In addition to 10 peptides covering 19.2% of STAT3, 18 peptides covering 28.3% of Hsp90{alpha} were also sequenced (Table 1). These peptides covered various regions of both STAT3 and Hsp90{alpha}. Subsequent Western blot analyses confirmed the cosedimentation of Hsp90{alpha} with STAT3 (see below).


View this table:
[in this window]
[in a new window]
  		TABLE 1
Amino acid sequences of STAT3 and Hsp90{alpha} determined by LC-MS/MS

Peptides associated with STAT3 were identified by data-dependent reverse-phase liquid chromatography/tandem mass spectrometry analysis on an LTQ ion trap mass spectrometer and included the peptides that are found in human Hsp90{alpha}.

 
Hsp90 is thought to contribute to many steps in STAT3 activation, such as binding to its docking sites on gp130 and subsequent phosphorylation by associated JAKs as well as facilitates trafficking of the activated cytosolic STAT3 to the nucleus. Thus, we examined whether treatment of HepG2 cells with PDTC might lead to STAT3 dissociation from Hsp90. Cells transiently expressing STAT3-ER were pretreated with PDTC for 2 h followed by the addition of 4-HT. Incubation with 4-HT caused an increase in the interaction of Hsp90 with STAT3-ER, which was adversely affected by the PDTC treatment (Fig. 3B, upper panel). Comparable results were obtained for endogenous STAT3, whereby IL-6-induced recruitment of Hsp90 to STAT3 was blocked upon the addition of PDTC (Fig. 3C).

Because of recent reports showing suppression of IL-6 signaling through inhibition of STAT3-Hsp90 interaction by the selective Hsp90 inhibitor geldanamycin (GA) (31, 32), we examined whether GA had any effect on IL-6-mediated nuclear translocation of STAT3. Analysis was carried out on nuclear extracts prepared from HepG2 cells, which had been pretreated in the absence or presence of GA. As shown in Fig. 3D, the IL-6-induced nuclear accumulation of STAT3 was markedly suppressed by the addition of GA. In contrast, the macrolide rapamycin had no inhibitory effect. These data indicate that the suppression of STAT3 nuclear translocation by PDTC or GA is likely due to destabilization of the Hsp90-STAT3 complex.

PDTC Blocks IL-6-induced Association of STAT3 with Transcriptional Coactivators—To determine whether PDTC alters IL-6-mediated association of STAT3 with transcriptional coactivators, nuclear extracts were prepared, and anti-STAT3 immunoprecipitates were analyzed by Western blot (Fig. 4A). Stimulation of HepG2 cells with IL-6 resulted in the co-sedimentation of STAT3 with FOXO1a and C/EBPbeta, which was sharply reduced in the presence of PDTC (Fig. 4A, top and middle panels). Treatment of the cells with insulin markedly attenuated STAT3 association with FOXO1a upon the addition of IL-6, in agreement with the recent observations of Kortylewski et al. (15). Note also that insulin attenuated the nuclear accumulation of STAT3 in response to IL-6 (Fig. 4A, bottom panel). Reciprocal immunoprecipitation assays with C/EBPbeta antibody showed that the amount of STAT3 coprecipitating with C/EBPbeta was greatly increased by IL-6 and that pretreatment of the cells with PDTC or insulin abrogated the response (Fig. 4B). The expression and cellular redistribution of C/EBPbeta were not affected under these experimental conditions (data not shown). Thus, we concluded that PDTC blocks IL-6-mediated STAT3 signaling, presumably by reducing cellular redistribution of STAT3, which leads in turn to impaired formation of functional multiprotein complex encompassing STAT3 and its transcriptional coactivators.


Figure 4
View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 4.
PDTC reduces IL-6-induced association of STAT3 with transcriptional coactivators. HepG2 cells were pretreated with 100 µM LY294002 for 1 h, after which cells were washed with medium and incubated either with 50 µM PDTC or 100 nM insulin for 2 h or 15 min, respectively, before the addition of IL-6 (20 ng/ml) for 10 min. Nuclear extracts were prepared and immunoprecipitated (Ip) with monoclonal anti-STAT3 (A), anti-C/EBPbeta, or control IgG (n.i.) (B) followed by Western blot analysis using antibodies directed against FOXO1a, C/EBPbeta, or STAT3. Blots were quantitated by densitometry, and the average of two independent experiments is shown below each lane in panel B.

 
To extend these results, a primary culture of rat hepatocytes was utilized to test whether IL-6-induced STAT3 signaling would be blocked by PDTC. Rat hepatocytes were treated with either vehicle or PDTC for 2 h before IL-6 stimulation. Western blot analysis was performed in total cell lysates and nuclear extracts (Fig. 5, A and B). After IL-6 stimulation, STAT3 was phosphorylated on tyrosine and translocated into the nucleus (Fig. 5, A and B, upper panels, first and third lanes) where it associated with FOXO1a (Fig. 5C). Similar to the effect in HepG2 cells, pretreatment of hepatocytes with PDTC markedly reduced IL-6-induced STAT3 phosphorylation and its nuclear entry (Fig. 5, A and B, fourth lane versus third lane), and formation of the FOXO1a-STAT3 complex no longer was observed (Fig. 5C).


Figure 5
View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 5.
Effects of PDTC on IL-6-induced STAT3 activation in rat hepatocytes. A primary culture of rat hepatocytes was treated without or with 50 µM PDTC for 2 h before the stimulation with IL-6 (20 ng/ml) for 10 min. Total cell lysates (A) and nuclear extracts (B) were analyzed by Western blot with Tyr(P) (pY)-STAT3, STAT3, FOXO1a, or p89TFIIH antibodies as indicated. C, immunoprecipitation (IP) assays were performed with anti-STAT3 followed by Western blot analysis with antibodies directed against FOXO1a or STAT3. Similar results were obtained in two independent sets of dishes.

 
IL-6-mediated Gene Expression Is Sensitive to PDTC in HepG2 Cells—STAT3 is required for stimulation of acute-phase response by IL-6 in hepatic cell types (33). As a first step in defining the impact of PDTC in IL-6-induced STAT3 signaling, we measured mRNA production of two acute phase proteins by Northern blot analysis (Fig. 6, A and B). The expression of haptoglobin was significantly increased by IL-6 and was sharply reduced after cell pretreatment with PDTC. On the other hand, {alpha}2M mRNA expression was constitutively high but remained sensitive to IL-6 and the inhibitory effect of PDTC (Fig. 6A, top and middle panels, lanes 6 versus 5). To determine whether the effects of PDTC occurred at the level of gene transcription, HepG2 cells were transiently transfected with a CAT reporter construct driven by 190 bp of the rat haptoglobin promoter. Cell treatment with PDTC led to an ~50% decrease in IL-6-stimulated haptoglobin promoter activity (Fig. 6C). These findings parallel those obtained for the endogenous gene, arguing that PDTC exerts its inhibitory effects at the level of transcription. Finally, we addressed whether the transcriptional activity of STAT3-ER was altered after PDTC treatment. HepG2 cells were transfected with pcDNA or STAT3-ER together with expression vectors encoding HpCAT and beta-galactosidase. At 30 h post-transfection, the cells were left untreated or treated with IL-6 for 16 h before assaying CAT activity (Fig. 6D). Basal HpCAT activity was increased 1.7-fold in cells expressing STAT3-ER as compared with pcDNA-transfected cells (p < 0.05). The cells expressing STAT3-ER also exhibited significantly higher haptoglobin promoter activity post-IL-6 treatment (Fig. 6D). PDTC sharply reduced IL-6-mediated increases in HpCAT activity while having no effect in unstimulated cells (data not shown). These results provide evidence that STAT3-ER is transcriptionally active and that PDTC attenuated the IL-6-induced transcriptional effect of this construct.


Figure 6
View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 6.
Influence of PDTC and insulin on IL-6-induced expression of acute phase protein genes and SOCS3 protein. Serum-starved HepG2 cells were treated with either 50 µM PDTC or 100 nM insulin for 2 h and 30 min, respectively, before the addition of 20 ng/ml recombinant human IL-6 for 16 h. Twenty µg of total RNA were analyzed by Northern blot. Blots were probed with haptoglobin, {alpha}2M, and the 18 S radiolabeled cDNAs. A, autoradiograms from a representative experiment. B, data are the means ± S.E. from three independent experiments, expressed as -fold changes over IL-6-treated cells. C, HepG2 cells were cotransfected with HpCAT reporter construct and a beta-galactosidase expression vector. At 24 h post-transfection the cells were left alone or incubated with PDTC for 2 h before the addition of IL-6 and harvested 16 h later. CAT and beta-galactosidase activity was then determined. The CAT activity was presented as -fold induction above the activity obtained in control cells without PDTC or IL-6 treatment. These experiments were repeated twice with comparable results. Bars are the means ± S.E. D, HepG2 cells were transfected with pcDNA (2 µg) or a vector encoding STAT3-ER (2 µg) together with HpCAT and beta-galactosidase expression vector. At 30 h post-transfection, the cells were left alone or incubated with IL-6 and harvested 16 h later. The CAT activity was presented as -fold induction above the activity obtained in unstimulated pcDNA-transfected cells. These experiments were repeated three times with comparable results. Bars are the means ± S.D. E, HepG2 cells were treated with PDTC for 2 h or insulin (25 nM) for 30 min before the addition of IL-6 for 90 min. Cell lysates were analyzed by Western blot with anti-SOCS3 and then anti-glycogen synthase kinase 3beta (GSK3beta) as loading control. Bars are the means ± S.E. from six independent experiments, expressed as changes over IL-6-treated cells. *, p < 0.05; **, p > 0.01; ***, p > 0.001.

 
Suppressor of cytokine signaling (SOCS)-3 is induced rapidly by activated STATs via the presence of a STAT binding element in its promoter (34, 35). To investigate the role of PDTC on the expression of SOCS3 protein, HepG2 cells were treated with the drug for 2 h before the addition of IL-6 for 90 min, and protein lysates were subjected to immunoblot analysis. PDTC was effective at reducing selectively IL-6-induced expression of SOCS3 protein by 42 ± 4% (p < 0.05) but not that of glycogen synthase kinase 3beta (Fig. 6E). Similarly, treatment with insulin abrogated the IL-6 response (Fig. 6E, sixth lane).

PDTC Mitigates IL-6-induced Defects in Akt Activation in Response to Insulin—IL-6 stimulation promotes insulin resistance in hepatocytes (36, 37). To determine whether PDTC could offer protection against a reduction in insulin responsiveness by IL-6, we used HepG2 cells (Fig. 7A) and a primary culture of rat hepatocytes (Fig. 7B). Control experiments indicated that incubation with IL-6 for 90 min resulted in ~40–50% inhibition of insulin-dependent activation of Akt, an enzyme that plays an important role in mediating various cellular responses of insulin (38). In comparison, cells pretreated with PDTC were resistant to IL-6 inhibition and exhibited normal insulin responsiveness. Reprobing the blots with anti-glycogen synthase kinase 3beta antibody confirms equal protein loading in each lane (Fig. 7, bottom panels). HepG2 cells showed an activation of Akt phosphorylation in response to PDTC and insulin that was comparable with that seen with insulin alone (data not shown).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
STAT3 plays important roles in the regulation of diverse cellular responses initiated by IL-6, which includes the expression of acute phase plasma proteins in the liver. After exposure of cells to IL-6, there is rapid activation of the gp130/JAK/STAT3 cascade and subsequent stimulation of STAT3 transcriptional activity through formation of multiprotein complexes encompassing STAT3, accessory proteins, and coactivators. Although the importance of cell redox in STAT3 signaling has been reported, the mechanisms by which biological thiol antioxidants regulate STAT3 activity are still largely unknown. In this paper we focused on the role of PDTC and demonstrated that the anti-inflammatory agent inhibits IL-6-mediated STAT3 signaling both in HepG2 hepatoma cells and in a primary culture of rat hepatocytes. We provide evidence that the action of PDTC on STAT3 functions was associated with the inhibition of inducible interaction between STAT3 and the chaperone Hsp90, thereby preventing STAT3 to translocate to the nucleus and bind transcriptional coactivators within responsive elements on target genes, such as those of haptoglobin and {alpha}2M. By blocking IL-6-induced STAT3 transcriptional activity and restoring insulin responsiveness that was inhibited by IL-6, PDTC or derivatives thereof may provide new strategies against a number of pro-inflammatory conditions.


Figure 7
View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 7.
PDTC antagonizes IL-6 action by restoring insulin responsiveness. HepG2 cells (A) and rat hepatocytes in primary culture (B) were incubated with 50 µM PDTC for 2 h before the addition of 20 ng/ml IL-6 for 90 min. Insulin (25 nM) was then added for 10 min. Total cell lysates were analyzed by Western blot with phospho (p)-Akt (Ser473) or glycogen synthase kinase 3beta (GSK3beta) antibodies. Bars are the means ± S.E. from four independent experiments, expressed as changes over insulin. ***, p < 0.001.

 
PDTC has been shown to inhibit NF-{kappa}B activation (24) while inducing activator protein-1 activity (39, 40). In a human liver (AKN-1) epithelial cell line, PDTC significantly suppresses inducible nitric-oxide synthase expression and NO synthesis after cytokine stimulation (41). It exerts also protection in rat models of liver injury (42, 43) and inhibits the production of IL-6 by human endothelial cells in response to inflammatory mediators (44). Therefore, it is likely that PDTC is involved in attenuating the inflammatory response. The discovery of the intracellular signaling pathways activated by IL-6 has made it possible to test whether PDTC is a compound capable of antagonizing the JAK/STAT3 cascade. PDTC has been found to inhibit the constitutive activation of STAT3 that is elicited in response to the nonstructural protein 5A encoded by the human hepatitis C virus (45). A more recent study has established that this antioxidant may function to inhibit the activity of upstream kinases that stimulate STAT3 phosphorylation by hepatitis C virus (46). Our study provides evidence for additional mechanisms involved in STAT3 inhibition by PDTC. As was shown in this study, treatment of HepG2 cells with PDTC reduced STAT3 phosphorylation at Tyr-705 but did not alter the extent of JAK1 autophosphorylation and tyrosine phosphorylation of gp130 after IL-6 stimulation. As a consequence, STAT3 was not translocated to the nucleus, thereby causing cells to become refractory to IL-6 challenge. Moreover, we examined whether treatment of cells with orthovanadate, a broad protein-tyrosine phosphatase inhibitor, might confer protection against PDTC. Our study shows that cells after PDTC exhibited marked reduction in IL-6-stimulated STAT3 tyrosine phosphorylation with or without pretreatment with orthovanadate.

The use of the STAT3-ER construct has allowed us to clearly distinguish the effect of PDTC on nuclear translocation from tyrosine phosphorylation of STAT3. The STAT3-ER chimera was found to be responsive to tamoxifen, unmasking the latent nuclear localization signal of STAT3 and activating its nuclear entry in the absence of detectable tyrosine phosphorylation. It has been recently demonstrated that endogenous STAT3 can undergo nuclear translocation in the absence of tyrosine phosphorylation events (47, 48). In this report we show that treatment of HepG2 cells with PDTC blocked STAT3-ER nuclear translocation induced by 4-HT and IL-6, suggesting the convergence of PDTC actions toward the inducible nucleocytoplasmic shuttling of STAT3. Thus, PDTC exerts an inhibitory function both in IL-6-stimulated phosphorylation of STAT3 as well as interfering with components of the nuclear translocation machinery. Additional work will be required to assess the role of PDTC on other members of the STAT family, especially STAT1 and STAT5.

What is the mechanism(s) by which the inducible STAT3 pathway is rendered refractory after cell exposure to PDTC? Recent studies have shown the association of Hsp90 with STAT3 in cytosol and plasma membrane complexes where the gp130/JAK signaling module is known to reside (31, 49). Therefore, we examined whether cell treatment with PDTC can cause release of STAT3 from Hsp90. Treatment of HepG2 cells with PDTC resulted in a reduction in the extent of Hsp90 interaction with endogenous STAT3 and STAT3-ER. As was shown previously by others (31, 32), the inhibitor geldanamycin, known to bind tightly to Hsp90, has been found to disrupt STAT3-Hsp90 interactions. Prompted by these observations, we examined the redistribution of STAT3 by IL-6 in HepG2 cells subjected to geldanamycin. Not surprisingly, geldanamycin treatment resulted in an inhibition of IL-6-induced nuclear translocation of STAT3. These results and those with PDTC demonstrate that interaction of STAT3 with Hsp90 (and its cochaperones, e.g. GRP58 (49, 50)) may play a key role for STAT3 recruitment to various cellular compartments and, therefore, its function. Interestingly, PDTC stimulation of HepG2 cells elicits translocation of the transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2) into the nucleus to induce genes involved in antioxidant response (51). These results indicate that the inhibitory effects of PDTC on STAT3 nuclear translocation are selective rather than global.

FOXO1a is a prototypical inducible transcription factor that associates with STAT3 to regulate its activity (15). Activation of the phosphatidylinositol 3-kinase/Akt cascade has been reported to down-regulate STAT3 transcriptional activity (52) through phosphorylation-dependent inactivation of FOXO1a (15). Specifically, insulin has been shown to induce nuclear export and degradation of FOXO1a through the ubiquitination-mediated proteasomal degradation pathway (53).5 Our studies similarly concluded that cells exposed to insulin resulted in marked reduction in IL-6-induced STAT3 interaction with FOXO1a and C/EBPbeta, which in turn led to an inhibition of APP gene expression by IL-6.

The role of C/EBPbeta as coactivator in STAT3 transcriptional activity has been well established (54–56). C/EBPbeta is phosphorylated at multiple sites by stimulation of the mitogen-activated protein kinase cascade and subsequent activation of ribosomal S6 kinase in response to several treatments, including cytokines and growth factors (57–60). For instance, the phosphorylation on Ser-239 within the nuclear localization signal of murine C/EBPbeta is critical for its nuclear export and inhibition of tumor necrosis factor {alpha}-stimulated albumin gene transcription in primary mouse hepatocytes (59). Moreover, phosphorylation on Thr residue 188 or 217 was found to be a key determinant for the cellular redistribution and biological role of C/EBPbeta in gene transcription and cell survival (58, 61). Phosphorylation of rat C/EBPbeta on Ser-105 is involved in hepatocyte proliferation in response to transforming growth factor {alpha} (57). Therefore, it is likely that several kinase pathways are responsible for C/EBPbeta phosphorylation and that C/EBPbeta complexed with STAT3 may render the DNA binding complex transcriptionally active through posttranslational modification.

Our results support the notion that inhibition of STAT3 association with Hsp90 explains most if not all of the downstream effects of PDTC on STAT3-mediated reporter gene activity and endogenous gene expression. For instance, the partial dissociation of the STAT3-Hsp90 complex means a lower STAT3 tyrosine phosphorylation and nuclear import, which will result in loss of association of STAT3 with coactivators FOXO1a and C/EBPbeta. We cannot rule out the possibility that PDTC exerts also indirect effects on STAT3 signaling by interfering with the ability of coactivators to interact with the nuclear pool of STAT3. Such interference may be the result of activation of redox-sensitive kinases acting on these coactivators. Clearly, more work is needed to unravel the mechanism of PDTC action on STAT3 activation.

Activation of the JAK/STAT pathway by IL-6 plays an important role in the development of hepatic insulin resistance in vivo (37, 62). IL6–/– mice were found to be more insulin-sensitive as evidenced by the fact that they did not demonstrate obesity, fasting hyperglycemia, or abnormal lipid metabolism (63). Recently, Senn et al. (64) reported that IL-6-induced expression of SOCS-3 was responsible for down-regulating the insulin signaling pathway in hepatocytes mainly through interaction of SOCS-3 with the insulin receptor and IRS-1 protein, a scaffold molecule whose phosphotyrosine motifs serve as docking sites for several effectors, including phosphatidylinositol 3-kinase (65). In this study we present a model in which the attenuation of IL-6-induced insulin resistance is associated with a decrease in SOCS-3 gene expression after exposure of HepG2 cells to PDTC. As mentioned earlier, PDTC-mediated impairment in the formation of multiprotein complexes encompassing STAT3, molecular chaperones (e.g. Hsp90), and/or coactivators (e.g. FOXO1a, C/EBPbeta) might account for its effect in down-regulating expression of SOCS-3 and that of other genes involved in the mediation of insulin resistance and other pathological conditions in response to proinflammatory cytokines (66, 67).


   FOOTNOTES
 
* This research was supported by the Intramural Research Program of the NIA, National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 These authors contributed equally to this work. Back

2 Present address: Division of Allergy and Clinical Immunology, Johns Hopkins Asthma and Allergy Center, Baltimore, MD 21224. Back

3 To whom correspondence should be addressed: Diabetes Section, National Institute on Aging, Box 23, 5600 Nathan Shock Dr., Baltimore, MD 21224-6825. Tel.: 410-558-8199; Fax: 410-558-8381; E-mail: Bernierm{at}mail.nih.gov.

4 The abbreviations used are: STAT3, signal transducer and activator of transcription 3; STAT3-ER, fusion protein encompassing STAT3 with the ligand binding domain of the human estrogen receptor (ER)-{alpha}; APP, acute phase plasma protein; C/EBP, CAAT/enhancer-binding protein; Hsp, heat shock protein; IL-6, interleukin-6; JAK, Janus tyrosine kinase; {alpha}2M, {alpha}2-macroglobulin; PDTC, pyrrolidine dithiocarbamate; SOCS, suppressor of cytokine signaling; CAT, chloramphenicol acetyltransferase; MS, mass spectroscopy; 4-HT, 4-hydroxytamoxifen; GA, geldanamycin. Back

5 H.-J. He and M. Bernier, unpublished results. Back


   ACKNOWLEDGMENTS
 
We thank Rafael DeCabo for the preparation of rat hepatocytes. We gratefully acknowledged Drs. Skaar, Baumann, and Ghosh for providing reagents.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Darnell, J. E., Jr. (1997) Science 277, 1630–1635[Abstract/Free Full Text]
  2. Leonard, W. J., and O'Shea, J. J. (1998) Annu. Rev. Immunol. 16, 293–322[CrossRef][Medline] [Order article via Infotrieve]
  3. Kamimura, D., Ishihara, K., and Hirano, T. (2003) Rev. Physiol. Biochem. Pharmacol. 149, 1–38[Medline] [Order article via Infotrieve]
  4. Ernst, M., and Jenkins, B. J. (2004) Trends Genet. 20, 23–32[CrossRef][Medline] [Order article via Infotrieve]
  5. Bromberg, J., and Darnell, J. E., Jr. (2000) Oncogene 19, 2468–2473[CrossRef][Medline] [Order article via Infotrieve]
  6. Wen, Z., Zhong, Z., and Darnell, J. E., Jr. (1995) Cell 82, 241–250[CrossRef][Medline] [Order article via Infotrieve]
  7. Ramadori, G., and Christ, B. (1999) Semin. Liver Dis. 19, 141–155[Medline] [Order article via Infotrieve]
  8. Yoo, J. Y., Huso, D. L., Nathans, D., and Desiderio, S. (2002) Cell 108, 331–344[CrossRef][Medline] [Order article via Infotrieve]
  9. Streetz, K. L., Wustefeld, T., Klein, C., Kallen, K. J., Tronche, F., Betz, U. A., Schutz, G., Manns, M. P., Muller, W., and Trautwein, C. (2003) Gastroenterology 125, 532–543[CrossRef][Medline] [Order article via Infotrieve]
  10. Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., and Kishimoto, T. (1990) EMBO J. 9, 1897–1906[Medline] [Order article via Infotrieve]
  11. Wang, Y., Kinzie, E., Berger, F. G., Lim, S. K., and Baumann, H. (2001) Redox Rep. 6, 379–385[CrossRef][Medline] [Order article via Infotrieve]
  12. Milosavljevic, T. S., Petrovic, M. V., Cvetkovic, I. D., and Grigorov, I. I. (2002) Biochemistry (Mosc) 67, 918–926[CrossRef][Medline] [Order article via Infotrieve]
  13. Schaefer, T. S., Sanders, L. K., and Nathans, D. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 9097–9101[Abstract/Free Full Text]
  14. Shuai, K. (2000) Oncogene 19, 2638–2644[CrossRef][Medline] [Order article via Infotrieve]
  15. Kortylewski, M., Feld, F., Kruger, K. D., Bahrenberg, G., Roth, R. A., Joost, H. G., Heinrich, P. C., Behrmann, I., and Barthel, A. (2003) J. Biol. Chem. 278, 5242–5249[Abstract/Free Full Text]
  16. Kops, G. J., and Burgering, B. M. (1999) J. Mol. Med. 77, 656–665[CrossRef][Medline] [Order article via Infotrieve]
  17. Nakae, J., Biggs, W. H., III, Kitamura, T., Cavenee, W. K., Wright, C. V., Arden, K. C., and Accili, D. (2002) Nat. Genet. 32, 245–253[CrossRef][Medline] [Order article via Infotrieve]
  18. Hribal, M. L., Nakae, J., Kitamura, T., Shutter, J. R., and Accili, D. (2003) J. Cell Biol. 162, 535–541[Abstract/Free Full Text]
  19. Birkenkamp, K. U., and Coffer, P. J. (2003) J. Immunol. 171, 1623–1629[Free Full Text]
  20. Zhang, X., Gan, L., Pan, H., Guo, S., He, X., Olson, S. T., Mesecar, A., Adam, S., and Unterman, T. G. (2002) J. Biol. Chem. 277, 45276–45284[Abstract/Free Full Text]
  21. Bromberg, J. F., Wrzeszczynska, M. H., Devgan, G., Zhao, Y., Pestell, R. G., Albanese, C., and Darnell, J. E., Jr. (1999) Cell 98, 295–303[CrossRef][Medline] [Order article via Infotrieve]
  22. Meydan, N., Grunberger, T., Dadi, H., Shahar, M., Arpaia, E., Lapidot, Z., Leeder, J. S., Freedman, M., Cohen, A., Gazit, A., Levitzki, A., and Roifman, C. M. (1996) Nature 379, 645–648[CrossRef][Medline] [Order article via Infotrieve]
  23. Maedler, K., Sergeev, P., Ris, F., Oberholzer, J., Joller-Jemelka, H. I., Spinas, G. A., Kaiser, N., Halban, P. A., and Donath, M. Y. (2002) J. Clin. Investig. 110, 851–860[CrossRef][Medline] [Order article via Infotrieve]
  24. Schreck, R., Meier, B., Mannel, D. N., Droge, W., and Baeuerle, P. A. (1992) J. Exp. Med. 175, 1181–1194[Abstract/Free Full Text]
  25. Simon, A. R., Rai, U., Fanburg, B. L., and Cochran, B. H. (1998) Am. J. Physiol. 275, C1640–C1652[Medline] [Order article via Infotrieve]
  26. Carballo, M., Conde, M., El Bekay, R., Martin-Nieto, J., Camacho, M. J., Monteseirin, J., Conde, J., Bedoya, F. J., and Sobrino, F. (1999) J. Biol. Chem. 274, 17580–17586[Abstract/Free Full Text]
  27. de Cabo, R., Furer-Galban, S., Anson, R. M., Gilman, C., Gorospe, M., and Lane, M. A. (2003) Exp. Gerontol. 38, 631–639[CrossRef][Medline] [Order article via Infotrieve]
  28. Baumann, H., Morella, K. K., Jahreis, G. P., and Marinkovic, S. (1990) Mol. Cell. Biol. 10, 5967–5976[Abstract/Free Full Text]
  29. Fan, J., Yang, X., Wang, W., Wood, W. H., III, Becker, K. G., and Gorospe, M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 10611–10616[Abstract/Free Full Text]
  30. Milocco, L. H., Haslam, J. A., Rosen, J., and Seidel, H. M. (1999) Mol. Cell. Biol. 19, 2913–2920[Abstract/Free Full Text]
  31. Shah, M., Patel, K., Fried, V. A., and Sehgal, P. B. (2002) J. Biol. Chem. 277, 45662–45669[Abstract/Free Full Text]
  32. Sato, N., Yamamoto, T., Sekine, Y., Yumioka, T., Junicho, A., Fuse, H., and Matsuda, T. (2003) Biochem. Biophys. Res. Commun. 300, 847–852[CrossRef][Medline] [Order article via Infotrieve]
  33. Kim, H., and Baumann, H. (1997) J. Biol. Chem. 272, 14571–14579[Abstract/Free Full Text]
  34. He, B., You, L., Uematsu, K., Matsangou, M., Xu, Z., He, M., McCormick, F., and Jablons, D. M. (2003) Biochem. Biophys. Res. Commun. 301, 386–391[CrossRef][Medline] [Order article via Infotrieve]
  35. Gatto, L., Berlato, C., Poli, V., Tininini, S., Kinjyo, I., Yoshimura, A., Cassatella, M. A., and Bazzoni, F. (2004) J. Biol. Chem. 279, 13746–13754[Abstract/Free Full Text]
  36. Senn, J. J., Klover, P. J., Nowak, I. A., and Mooney, R. A. (2002) Diabetes 51, 3391–3399[Abstract/Free Full Text]
  37. Kim, H. J., Higashimori, T., Park, S. Y., Choi, H., Dong, J., Kim, Y. J., Noh, H. L., Cho, Y. R., Cline, G., Kim, Y. B., and Kim, J. K. (2004) Diabetes 53, 1060–1067[Abstract/Free Full Text]
  38. Kido, Y., Nakae, J., and Accili, D. (2001) J. Clin. Endocrinol. Metab. 86, 972–979[Abstract/Free Full Text]
  39. Meyer, M., Schreck, R., and Baeuerle, P. A. (1993) EMBO J. 12, 2005–2015[Medline] [Order article via Infotrieve]
  40. Munoz, C., Castellanos, M. C., Alfranca, A., Vara, A., Esteban, M. A., Redondo, J. M., and de Landazuri, M. O. (1996) J. Immunol. 157, 3587–3597[Abstract]
  41. Taylor, B. S., de Vera, M. E., Ganster, R. W., Wang, Q., Shapiro, R. A., Morris, S. M., Jr., Billiar, T. R., and Geller, D. A. (1998) J. Biol. Chem. 273, 15148–15156[Abstract/Free Full Text]
  42. Tsuchihashi, S., Tamaki, T., Tanaka, M., Kawamura, A., Kaizu, T., Ikeda, A., and Kakita, A. (2003) Surgery 133, 556–567[CrossRef][Medline] [Order article via Infotrieve]
  43. Bruck, R., Schey, R., Aeed, H., Hochman, A., Genina, O., and Pines, M. (2004) Liver Int. 24, 169–176[CrossRef][Medline] [Order article via Infotrieve]
  44. Munoz, C., Pascual-Salcedo, D., Castellanos, M. C., Alfranca, A., Aragones, J., Vara, A., Redondo, M. J., and de Landazuri, M. O. (1996) Blood 88, 3482–3490[Abstract/Free Full Text]
  45. Gong, G., Waris, G., Tanveer, R., and Siddiqui, A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 9599–9604[Abstract/Free Full Text]
  46. Waris, G., Turkson, J., Hassanein, T., and Siddiqui, A. (2005) J. Virol. 79, 1569–1580[Abstract/Free Full Text]
  47. Bhattacharya, S., and Schindler, C. (2003) J. Clin. Investig. 111, 553–559[CrossRef][Medline]