HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 281, Issue 42, 31517-31527, October 20, 2006

This Article Abstract Full Text (PDF) All Versions of this Article: 281/42/31517    most recent M604641200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kauth, C. W. Articles by Bujard, H. Search for Related Content PubMed PubMed Citation Articles by Kauth, C. W. Articles by Bujard, H. Social Bookmarking                      What's this?

Interactions between Merozoite Surface Proteins 1, 6, and 7 of the Malaria Parasite Plasmodium falciparum^*

Christian W. Kauth, Ute Woehlbier, Michaela Kern¹, Zeleke Mekonnen, Rolf Lutz, Norbert Mücke, Jörg Langowski, and Hermann Bujard²

From the Zentrum fuer Molekulare Biologie der Universitaet Heidelberg, Im Neuenheimer Feld 282, D-69120 Heidelberg and Division of Biophysics of Macromolecules, German Cancer Research Center, D-69120 Heidelberg, Germany

Received for publication, May 15, 2006 , and in revised form, August 18, 2006.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Merozoites of the malaria parasite Plasmodium falciparum expose at their surface a large multiprotein complex, composed of proteolytically processed, noncovalently associated products of at least three genes, msp-1, msp-6, and msp-7. During invasion of erythrocytes, this complex is shed from the surface except for a small glycosylphosphatidylinositol-anchored portion originating from MSP-1. The proteolytic cleavage separating the C-terminal portion of MSP-1 is required for successful invasion. Little is known about the structure and function of the abundant and essential multipartite complex. Using heterologously produced MSP-1, MSP-6, and MSP-7 in precursor and with the exception of MSP-7 in processed form, we have studied in vitro the complex formation between the different proteins to identify the interaction partners within the complex. Both MSP-6₃₆ and MSP-7 bind only to MSP-1 subunits that are shed, but although MSP-6₃₆ contacts just subunit p38, MSP-7 interacts with p83, p30, and p38. The intact C-terminal region of MSP-6 is required for the association with p38 as well as for its multimerization into tetramers. Furthermore, our data suggest that only the processed form and not the precursor form of MSP-1 interacts with MSP-6₃₆. MSP-6- as well as MSP-7-specific rabbit antibodies inhibit parasite multiplication in vitro as shown previously for antibodies directed against MSP-1. Our findings raise interesting questions with regard to proteolysis-mediated mechanisms of maturation of the MSP-1-MSP-6-MSP-7 complex and to the mode by which antibodies directed against this complex interfere with parasite multiplication.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The major protein complex at the surface of merozoites of the human malaria parasite Plasmodium falciparum is a noncovalent assembly of proteolytically processed products of at least three genes (msp-1, msp-6, and msp-7) encoding merozoite surface proteins 1, 6, and 7 (1–3). As a major component at the interface between the parasite and the host cell, the role of the MSP-1-MSP-6-MSP-7 complex is intriguing, particularly as it also provides targets for the host's immune response. Indeed, numerous findings support the candidacy of MSP-1 as a component of a malaria vaccine, although this protein has also been implicated in a novel immune evasion mechanism (4). During invasion of erythrocytes by merozoites, the multipartite complex is shed from the surface of the parasite, and there is convincing evidence that MSP-1 plays an essential role in this process (5), although detailed molecular mechanisms have remained elusive. Less is known about the functions of MSP-6 and MSP-7.

MSP-1, initially deposited at the merozoite surface as an 190-kDa precursor (6), is processed during maturation of merozoites into four major products, p83, p30, p38, and p42, which, however, remain noncovalently associated (7). A secondary proteolysis cleaves p42 into p33 and the glycosylphosphatidylinositol-anchored C-terminal fragment, designated p19 (Fig. 1A), which is the only moiety that is carried into the host cell (8, 9). This secondary cleavage is thought to be a prerequisite for successful erythrocyte invasion (5).

MSP-6 is an essentially dimorphic protein (10) exhibiting high conservation within the dimorphic alleles characterized by the 3D7 and the K1 type. Although the 3D7 prototype is widely distributed, the K1 version of MSP-6 is found primarily in Southeast Asia (10). Both dimorphic forms of MSP-6 are proteolytically processed albeit at different sites of the protein, and only processed forms are found in the complex shed from the merozoite surface (10). Here we have only studied MSP-6 of the 3D7 type. MSP-6 is related to MSP-3 (3) based on a high sequence similarity at the C terminus, which can give rise to antibodies reacting with both proteins (10, 11). Recently, it has been shown that MSP-3 can form highly elongated dimers and tetramers via its C terminus containing a predicted coiled-coil region (12).

MSP-7, which is a member of a multigene family, is highly conserved in P. falciparum, and homologues were identified in other parasite species (2, 13). Because only a processed form of MSP-7 is found at the merozoite surface (14), it was proposed that conversion of MSP-7 into MSP-7₂₂ takes place prior to merozoite release. Apparently, at the same time when p42 is cleaved into p33 and the glycosylphosphatidylinositol-anchored p19, a second proteolysis converts MSP-7₂₂ into MSP-7₁₉, which is exclusively found in the shed complex (1, 14).

Immunological data support the view that the MSP-1-MSP-x6-MSP-7 complex provides multiple targets for antibodies capable of interfering with parasite multiplication in vitro. Accordingly, there is ample evidence for protective antibodies directed toward MSP-1 (for review see Kumar et al. (15)), and antibodies that inhibit parasite growth in vitro are elicited by epitopes distributed throughout the MSP-1 molecule (16). These findings have turned MSP-1 and parts thereof into promising candidates for malaria vaccines. Furthermore, rabbit antibodies raised against MSP-6 exhibit some potential to inhibit parasite growth in vitro (10), and strong interference with parasite multiplication was shown for MSP-6-specific human antibodies in an antibody-dependent cellular inhibition assay (11). Interestingly, in the Plasmodium yoelii system, immunization with the MSRP-2 (MSP-7-related protein 2) but not with MSP-7 was protective (17), whereas disruption of msp-7 in Plasmodium berghei apparently impaired invasion of erythrocytes but not of reticulocytes (18). Together, these data attribute functional importance to the MSP-1 ligands MSP-6 and MSP-7, justifying a more detailed analysis of their interactions.

View larger version (16K): [in this window] [in a new window]   FIGURE 1. Schematic outline of MSP-1, MSP-6, and MSP-7, as well as their tagged and processed versions. The numbers below the individual schemes denote amino acid positions; SP, signal peptide; H, His6 tag fusions. A, outline of MSP-1 precursor of P. falciparum strain 3D7 (MSP-1D), a representative of the MAD20 prototype. The arrows indicate the sites where the precursor protein is cleaved into its major subunits p83 to p42 as defined by Stafford et al. (1). A secondary proteolysis cleaves p42 into p33 and p19. The latter protein is anchored in the parasite membrane via a glycosylphosphatidylinositol moiety (GA). White, gray, and hatched boxes represent conserved, dimorphic, and oligomorphic regions, respectively. The amino acid positions delineate the heterologously produced fragments p83, p30, p38, and p42 as described in detail by Kauth et al. (20). B, outline of MSP-6 of P. falciparum strain 3D7. The arrow indicates the processing site, and the coiled-coil region is shown in dark gray. gMSP-6 is a fusion protein between GST and the MSP-6 precursor without signal peptide. MSP-636 is the processed form of MSP-6. MSP-636 is the cleavage product of MSP-636 spontaneously generated in E. coli by proteolysis. C, outline of MSP-7. The arrows indicate the sites where proteolytic cleavage converts MSP-7 into MSP-722 and MSP-719, respectively. gMSP-7 is the GST fusion protein used in our studies.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cloning and Expression of msp-1, msp-6, and msp-7 from P. falciparum Strain 3D7—Cloning and expression of the msp-1 gene of P. falciparum strain 3D7, designated msp-1d (MSP-1D for the protein), were described in previously (19–21). The sequences encoding the MSP-7 and MSP-6 precursor, respectively, without signal sequences were obtained by PCR amplification from genomic DNA of P. falciparum 3D7. The following primers were used: msp7ClaI5', GCGATCGATACACCAGTAAATAATGAAGAAGAT; msp7PstI3', GCGCTGCAGTTACATTGTGTTTTAGTAAATTAAATG; msp6ClaI5', GCGATCGATGAAAATAACTTTATCAGAAATGAAC; msp6XbaI3', GCGTCTAGATTAATTATTACTAAATAGATGGAT; and msp6p36ClaI5', GCGCATCGATATCGAAGGTCGTTCTGAAACAAATAA. The unique ClaI cleavage sites generated at the 5' end of the two genes allowed their cloning downstream of a glutathione S-transferase (GST)³ or His₆ encoding sequence within appropriately modified pZ expression vectors (22). The DNAs cloned were verified by sequence analysis. The different pZE constructs were transferred into E. coli strain W3110Z1 or DH5Z1 (22) where the expression of the target gene is inducible by isopropyl 1-thio--D-galactopyranoside.

Purification of MSP-1D Precursor and MSP-1D Subunits—All protein purifications were performed using theÁKTA system, and columns and resins were from GE Healthcare. Purification of His₆-tagged MSP-1D fragments p83, p30, p38, and p42 was described previously (20, 21). In brief, proteins were expressed in E. coli as insoluble inclusion bodies, which after solubilization were purified under denaturing conditions by affinity chromatography on Ni²⁺-Sepharose before they were renatured either by dialysis or by pulse renaturation.

The MSP-1D precursor, p190, N-terminally fused to GST and C-terminally to His₆ (pg190) was expressed in E. coli at 25 °C as a soluble protein. It was purified by Ni²⁺-chelate chromatography followed by separation on GSH-Sepharose 4B. A good manufacturing practice, compatible production process, and characterization of the resulting protein will be described in detail in a forthcoming publication.

GST-tagged p30 (pg30) of MSP-1D was recovered from E. coli extracts as soluble protein by affinity chromatography on GSH-Sepharose FF. The material was eluted from the column with phosphate-buffered saline (PBS), pH 7.4, containing 5 mM DTT and 10 mM GSH. It was dialyzed against PBS, pH 7.4, and stored at –80 °C.

His₆-tagged pA2b, a fragment of p83 (amino acids 119–406) of MSP-1D (Fig. 1A), was synthesized as a soluble protein. E. coli extracts containing the protein were loaded onto a Ni²⁺-chelating Sepharose HiTrap column equilibrated with buffer A (PBS, pH 7.4, 10 mM imidazole, 3 mM 2-mercaptoethanol). After washing with buffer B (PBS, pH 7.4, 1 M NaCl, 10% glycerol, 3 mM 2-mercaptoethanol, 0.1% (w/v) lauroylsarcosine) and buffer A containing 50 mM imidazole, the protein was eluted with buffer A containing 500 mM imidazole and subsequently dialyzed against PBS, pH 7.4.

Purification of MSP-6, MSP-6₃₆, and MSP-7—MSP-6 precursor as well as processed MSP-6₃₆ were produced in E. coli as soluble proteins with either a GST (gMSP-6) or a His₆ tag (Fig. 1B). E. coli extracts containing gMSP-6 were applied onto GSH-Sepharose FF columns equilibrated with buffer C (PBS, pH 7.4, containing 5 mM DTT). After washing thoroughly with the same buffer, the protein was eluted with buffer C containing 10 mM GSH. The eluate was dialyzed against buffer D (20 mM Tris, pH 8.0, 20 mM NaCl) and loaded onto a Q-Sepharose column equilibrated with the same buffer. After washing with buffer D containing 300 mM NaCl, gMSP-6 was eluted with buffer D containing 1 M NaCl and subsequently dialyzed against PBS, pH 7.4.

The E. coli extracts containing soluble His₆-tagged MSP-6₃₆ were loaded onto a Ni²⁺-chelating Sepharose HiTrap column and purified like pA2b of MSP-1D. The eluate was dialyzed against buffer E (20 mM L-histidine-HCl, pH 5.4, 50 mM NaCl) and loaded onto a Q-Sepharose column equilibrated with the same buffer. After washing with buffer E containing 250 mM NaCl, MSP-6₃₆ was differentially eluted with buffer E containing 350 mM NaCl, and MSP-6₃₆ was recovered from the column with buffer E containing 500 mM NaCl. Both proteins were subsequently dialyzed against PBS, pH 7.4. The overall yield per g of E. coli wet paste was around 0.25 mg for MSP-6₃₆ as well as for MSP-6₃₆.

The gMSP-7 precursor protein (Fig. 1C) was also produced as a soluble protein and purified via GSH-Sepharose FF using the same protocol as for gMSP-6 precursor protein. After concentration by ultrafiltration in a Amicon stirring cell using a 10-kDa cut-off membrane (Millipore), the protein was applied to a Superdex 200 size exclusion column with PBS, pH 7.4, as running buffer. The overall yield per g of E. coli wet paste was around 0.2 mg.

Protein contents of the eluted fractions were determined according to Bradford, and purity was examined by electrophoresis in polyacrylamide gels (12% acrylamide, 0.4% SDS, 100 mM DTT, i.e. SDS-PAGE standard conditions). Nonreducing conditions were achieved by omission of DTT. Gels were Coomassie-stained and subsequently destained in an aqueous acetic acid/ethanol mixture.

Assembly of Merozoite Surface Protein Complexes—To examine the association of MSP-1D assembled from its subunits with gMSP-7 or gMSP-6, respective proteins were incubated in PBS, pH 7.4, for 8–12 h at 4 °C. Complex formation was monitored by affinity chromatography either via an antibody column or via GSH-Sepharose. In brief, for immunoaffinity chromatography, mAb 5.2 (21), specific for a conformational epitope within p42 of MSP-1, was fixed to Sepharose via protein A. The protein mixture was applied to the equilibrated column (PBS, pH 7.4), and after washing with PBS, pH 7.4, the protein complexes were eluted with 0.1 M glycine, pH 2.5. The acidic eluate was immediately neutralized with 0.1 volumes of 1 M Tris, pH 8.0. For retaining complexes via GST tags, protein mixtures were applied to GSH-Sepharose columns equilibrated with PBS, pH 7.4. After thorough washing with the same buffer, proteins were eluted with PBS, pH 7.4, 15 mM GSH.

For assembling merozoite surface protein complexes via co-renaturation of different proteins, affinity-purified and solubilized proteins, each denatured in 50 mM Tris, pH 8.0, 4 M guanidine hydrochloride, were mixed in near equimolar concentrations and dialyzed overnight at 4 °C against refolding buffer (1 M arginine, 100 mM Tris, pH 8.0, 1 mM GSH, 0.1 mM GSSG, 2 mM EDTA) followed by dialysis against PBS, pH 7.4, for 16 h at 4 °C. Complex formation was monitored as described above.

Analytical Size Exclusion Chromatography—MSP-6₃₆ and MSP-6₃₆ in PBS, pH 7.4, in concentrations ranging from 5 to 40 µM were loaded onto a Superdex 200 HR 10/30 size exclusion column with a loading volume of 1% of the column volume and a flow rate of 0.25 ml/min. The theoretical molecular mass of the proteins in the different peak fractions was calculated by using a standard of globular proteins that were chromatographed under identical conditions. Samples of all major peak fractions were analyzed by SDS-PAGE for their protein composition.

Chemical Cross-linking—Proteins were cross-linked by either ethylene glycol bis-succinimidylsuccinate (EGS) or glutaraldehyde. MSP-6₃₆ and MSP-6₃₆ in PBS, pH 7.4, in concentrations ranging from 10 to 40 µM, were mixed with a 0.2–10-fold molar excess of EGS over the lysine residues of the proteins. In the case of glutaraldehyde the cross-linker concentration was 0.025%. The mixtures were incubated at 4 or 23 °C, and aliquots were taken at different time points. The reaction was stopped by adding SDS-PAGE sample buffer and Tris, pH 8.0, to a final concentration of 100 mM. The unboiled samples were analyzed by SDS-PAGE.

Sedimentation Analysis (23)—Analytical ultracentrifugation experiments were carried out using a Beckman analytical ultra-centrifuge (Optima XLA) equipped with an ultraviolet absorption optical system.

Sedimentation velocity experiments were carried out in double-sector charcoal-Epon cells at 4 and 37 °C at 42,000 rpm. Scans were recorded at a protein concentration of 0.08–0.15 mg/ml at 230 nm or at 0.6–1.1 mg/ml at 280 nm using a spacing of 0.003 cm with four averages in a continuous scan mode. Data analysis was performed using the program DCDT+ (version 2.0.4) (24).

Sedimentation equilibrium runs were carried out at 4 °C. A volume of 150 µl of each sample was loaded in double-sector charcoal-Epon cells. Scans were recorded at 280 nm using a spacing of 0.001 with 10 averages in a step scan mode at 7,000 rpm (MSP6₃₆) and at 15,000 rpm (MSP-6₃₆) every 4 h until no change could be detected between successive scans. The base line of the centrifugation run was determined by spinning the sample down at the end of the experiment (42,000 rpm) and averaging the absorbance in the first one-third of the scan.

To calculate the apparent molecular mass versus the observed protein concentration, a single ideal exponential fit (25) was generated with fixed base lines in an overlapping fashion for every 30 data points. Extrapolation to zero protein concentration yields the molecular mass of the smallest soluble components (25). The molecular mass according to the amino acid sequence, the absorbance per mg/ml at 280 nm, the hydration, the partial specific volume, and the density and viscosity of the buffer, respectively, were calculated with the program SEDNTERP version 1.05 (available on line). The SEDNTERP version 1.05 program was used for calculating the molecular masses of the complexes as well as cylindrical models that were based on the observed s_20,w values.

Preparation of Antibodies, Preparation of Synchronized Parasite Cultures, Assaying Inhibition of Parasite Replication, and Flow Cytometric Assays—These procedures have recently been described in detail (16).

Examination of MSP-6 and MSP-7 Antibodies by Western Blot—To probe the specificity of antibodies with schizont proteins, schizonts were fully developed and isolated by magnetic cell separation as described (16), and aliquots of parasitized red blood cells were taken up in sample buffer for SDS-PAGE. To examine antibodies with merozoite proteins, naturally released merozoites were isolated as described previously (26), and samples were prepared for SDS-PAGE analysis. Electrophoretically separated proteins were transferred onto polyvinylidene difluoride membranes (Millipore), and Western blots were developed as described previously (21).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cloning and Expression of msp-7 and msp-6 Variants—The coding sequences of MSP-6, MSP-6₃₆, and MSP-7 were recovered from genomic DNA isolated from P. falciparum strain 3D7 by PCR. By using appropriate primers, the sequences were obtained, which upon cloning and expression in E. coli yielded proteins N-terminally fused to either a GST or to a His₆ tag facilitating their isolation via affinity chromatography. The MSP-1D precursor p190 was obtained as an N-terminal GST and C-terminal His₆ fusion as described previously (20). It is designated in the following as pg190. All coding sequences were integrated into vectors of the pZ plasmid family, where their expression is controlled by isopropyl 1-thio--D-galactopyranoside (22). Interestingly, when fused to a His₆ tag neither MSP-6 nor MSP-7 showed detectable expression even when analyzed by Western blot (data not shown). By contrast, the GST-tagged versions of these proteins, henceforth denoted as gMSP-7 and gMSP-6, could be produced in good yields as soluble proteins reaching up to 1% of total E. coli protein as judged by SDS-PAGE. The various expression levels are most likely due to different mRNA folding patterns, which in turn lead to different translation efficiencies. On the other hand the His₆ fusion of MSP-6₃₆, denoted in the following MSP-6₃₆, could be recovered from the soluble fraction.

Because we have included in our study only MSP-6 and MSP-7 of strain 3D7, we do not refer to this fact in our nomenclature (in contrast to MSP-1D). Also for simplicity, we refer to GST fusions by the prefix "g" only when this tag was used for affinity chromatography (Fig. 1).

Purification of gMSP-7, gMSP-6, and MSP-6₃₆—Western blot analysis of the E. coli cell extracts containing gMSP-7 or gMSP-6, respectively, indicated that both proteins were considerably degraded by endogenous proteases (data not shown). Nevertheless, both proteins could be purified in good yield to near-homogeneity by employing two separate two-step chromatographic procedures (Fig. 2, A and B). Interestingly, the processing product of MSP-6, MSP-6₃₆, behaved not only differently with regard to expression levels but also to its susceptibility toward E. coli proteases; E. coli extracts containing MSP-6₃₆ consistently showed a single distinct cleavage product (Fig. 2C, lane 3) that is not visible in gMSP-6 preparations. This cleavage product, which we term MSP-6₃₆, could be quantitatively separated from MSP-6₃₆ by anion exchange chromatography (Fig. 2C). Analysis of MSP-6₃₆ by mass spectroscopy revealed that it is a C-terminally truncated cleavage product of MSP-6₃₆ with a molecular mass of 20,203 Da (including His₆ and a 6-amino acid linker sequence) lacking 51 amino acids at its C terminus. Both variants of MSP-6₃₆ did not differ in solubility. It should be noted that the extent of cleavage increased upon prolonged incubation of the cell lysate and was significantly reduced, although not abrogated, by the addition of protease inhibitors (data not shown). A corresponding cleavage was not observed with gMSP-6 (Fig. 1A, lane 3) indicating that in E. coli the cleavage site between Asn-320 and Leu-321 is less accessible in the precursor protein.

Probing Interactions between MSP-1D and MSP-6₃₆—Previously, we have shown that MSP-1D can be reconstituted from its processing products p83, p30, p38, and p42 in vitro by either co-renaturation or association of the separately refolded subunits (20). Following this experimental approach, we examined whether we could assemble the MSP-1D complex together with its ligands MSP-6, MSP-6₃₆, and as described below with MSP-7. We first incubated MSP-6₃₆ with MSP-1D previously assembled from its four subunits. MSP-6₃₆ is able to bind to MSP-1D (Fig. 3A). To identify subunits of MSP-1D responsible for the interaction with MSP-6₃₆, the protein was exposed to MSP-1D complexes lacking either p83 or both p83 and p30. In both cases, a complex was formed (Fig. 3, B and C). By contrast, when MSP-6₃₆ was incubated with either p42 or pg30, no interaction was detected (Fig. 3, D and E). A possible interaction with p83 could not be directly examined, because the GST fusion of p83 is hardly soluble and highly susceptible to degradation. Our results strongly indicate that p38 is the main and most likely the sole interaction partner of MSP-6₃₆ within the MSP-1D complex. The interaction between MSP-6₃₆ and p38 is confirmed by sedimentation analysis that revealed an increased s_20,w value of 4.3 S when both proteins are co-sedimented, whereas MSP-6₃₆ and p38, when analyzed individually at the same concentrations, sedimented with 3.7 S and 3.6 S, respectively (data not shown).

View larger version (50K): [in this window] [in a new window]   FIGURE 2. Isolation of MSP-6 and MSP-7 fused to GST and of MSP-636 and MSP-636 fused to a His6 tag. The electrophoretic analyses (SDS-PAGE, standard conditions) show extracts of noninduced and induced E. coli cultures (lanes 1 and 2) and samples taken at different steps of chromatographic purification (lanes 3–5). A, isolation of gMSP-6; lane 3 shows the material after GSH and lane 4 the final product after Q-Sepharose chromatography. B, isolation of gMSP-7; lane 3 shows the material after GSH and lane 4 the final product after size exclusion chromatography. C, preparation of MSP-636 and MSP-636; lane 3 shows the result of a Ni2+ chelate chromatography. The material obtained was fractionated on Q-Sepharose that separates MSP-636 (lane 4) from MSP-636 (lane 5). The arrows indicate the positions of MSP-6, MSP-7, MSP636, and MSP-636 in A–C, respectively.

To define more precisely the sites within MSP-6₃₆, which are responsible for the interaction with MSP-1D, we conducted the same experiments as described above using MSP-6₃₆. Remarkably, this C-terminally shortened protein neither associated with the intact MSP-1 complex (Fig. 3G) nor with the complex formed between p38 and p42 (Fig. 3H).

Characterization of MSP-6₃₆ and MSP-6₃₆ by Size Exclusion Chromatography and Chemical Cross-linking—The similarity between MSP-6 and MSP-3 (12) stipulated us to probe the conformation of MSP-6. Size exclusion chromatography revealed that MSP-6₃₆, which is lacking the C-terminal region, eluted at a volume corresponding to a globular protein with an 7-fold higher molecular weight than calculated (Fig. 4A). By contrast, the mobility of MSP-6₃₆ resembled a globular protein of 700–800 kDa (Fig. 4B), which would be 29-fold higher than the theoretical molecular weight. These results indicated a multimerization of MSP-6 caused by the presence of the C-terminal region.

To provide further proof for the multimeric conformation of MSP-6₃₆, we performed cross-linking experiments using EGS and glutaraldehyde. In case of MSP-6₃₆, none of the cross-linkers could generate defined higher molecular mass species even when used at high concentrations that caused internal cross-linking and led to faster migrating species (Fig. 4, C and D). When MSP-6₃₆ was incubated with EGS, even low concentrations of the cross-linker stabilized specific oligomeric conformations which, by comparison with molecular mass standards, could be dimers and tetramers, whereby the dimers appeared early within the time course (Fig. 4E). Peptide mapping ensured that the high molecular mass species originated from MSP-6₃₆. Using glutaraldehyde, a less specific cross-linker, at a concentration of 0.025%, MSP-6₃₆ was almost completely shifted to the higher molecular mass bands (Fig. 4F). Neither the concentration of the protein (10–40 µM) nor the temperatures at which the cross-linking experiments were carried out (4 °C, 23 °C) influenced the final band pattern observed (data not shown).

Hydrodynamic Parameters of MSP-6₃₆ and MSP-6₃₆—To gain some insights into the size and shape of MSP-6₃₆, we subjected both MSP-6₃₆ and MSP-6₃₆ to analytical ultracentrifugation. The state of association of MSP-6₃₆ and MSP-6₃₆ was probed by sedimentation equilibrium ultracentrifugation that revealed an apparent molecular mass of 20 and 88 kDa for MSP-6₃₆ and MSP-6₃₆, respectively (Fig. 5A). For MSP-6₃₆ the apparent molecular mass is in good agreement with the value predicted for a monomer. By contrast, the observed molecular mass for MSP-6₃₆ of 88 kDa is only 15% off from the theoretical molecular mass of a MSP-6₃₆ tetramer (104 kDa). This tetrameric form of MSP-6₃₆ is confirmed by our cross-linking studies (Fig. 4).

To probe the homogeneity of our protein populations and the shape of the two molecular species, sedimentation velocities were measured at 4 and 37 °C and at different concentrations (1.1, 0.6, 0.15, and 0.075 mg/ml for MSP-6₃₆; 0.8 and 0.08 mg/ml for MSP-6₃₆). Our data show that MSP-6₃₆ sediments as a uniform species with a mean s_20,w value of 1.64 S (range, 1.62–1.65 S) (Fig. 5B). By contrast, for MSP-6₃₆ the profile of the moving boundary revealed a main species comprising more than 80% of the material, which sedimented with a mean s_20,w value of 3.68 S (range, 3.54–3.83 S) (Fig. 5B).

Probing Interactions between gMSP-6 and MSP-1D Assembled from Its Subunits—It was of interest to see whether full-length MSP-6 precursor would also interact with MSP-1. Accordingly, gMSP-6 was incubated with the pre-assembled MSP-1D complex, but no complex formation could be detected by GSH affinity chromatography (Fig. 6A). However, when the five proteins, i.e. the four MSP-1 subunits and the gMSP-6 precursor, were denatured and then renatured together, a complex containing all proteins could be isolated via immunoaffinity chromatography (Fig. 6B) but not by chromatography on GSH-Sepharose. The results show that, as previously observed,⁴ the GST moiety of the MSP-6 fusion does not refold into a functional domain under the conditions used, suggesting that the N-terminal GST tag of gMSP-6 in its native conformation interferes with the binding of MSP-6 to MSP-1. This interference is possibly because of the known dimerization of the GST domain that may prevent the formation of the MSP-6 tetramer.

View larger version (71K): [in this window] [in a new window]   FIGURE 3. Probing the interaction of MSP-1 with MSP-636 and MSP-636 and between MSP-636 and MSP-7. Analysis of the various assays by SDS-PAGE under standard conditions. Designation of lanes: L, load; F, flow-through; E, eluate. Molecular mass standards and positions of the various proteins are indicated. A–C, exposure of MSP-636 to pre-assembled MSP-1 complexes consisting of the subunits indicated. MSP-636 associated with MSP-1 complexes is recovered by immunoaffinity chromatography with mAb 5.2 which binds p42. D, exposure of MSP-636 to p42 and subsequent affinity chromatography on a mAb 5.2 column. E, exposure of MSP-636 to GST-tagged p30 (pg30) followed by GSH-Sepharose chromatography. F, exposure of MSP-636 to the MSP-1D precursor fused to GST (pg190) followed by GSH-Sepharose chromatography. G and H, probing the binding between MSP-636 and pre-assembled full size MSP-1 and pre-assembled p38 + p42, respectively. Analysis via mAb 5.2 affinity chromatography; I, incubation of MSP-636 with MSP-7 fused to GST followed by GSH-Sepharose chromatography.

Finally, we explored whether MSP-6 and MSP-7 interact with each other in the absence of MSP-1D and, as shown in Fig. 3I, whether these two proteins did not show a detectable affinity for each other.

Effect of MSP-6 and MSP-7 Antibodies on Parasite Replication in Vitro—To explore whether a humoral immune response directed against MSP-6 or MSP-7 may be protective, we raised rabbit antibodies against gMSP-6 and gMSP-7 to examine their potential of inhibiting parasite growth in vitro. When schizont extracts were probed with MSP-6 antibodies, a single band was stained (Fig. 8A, lane S), which migrates as expected for full size MSP-6 (apparent molecular mass around 50 kDa) in agreement with its aberrant migration behavior (10). By contrast, processed MSP-6₃₆ could only be observed in the merozoite preparation (Fig. 8A, lane M), indicating that at the stage of schizont harvest cleavage of MSP-6 has not yet occurred to a measurable extent. Moreover, potentially cross-reacting MSP-3 was not detected, revealing that antibodies obtained with gMSP-6 under our conditions are not directed toward C-terminal epitopes conserved between MSP-6 and MSP-3. A more complex picture was expected and indeed obtained when schizont extracts were probed with our rabbit antibodies raised against MSP-7 (Fig. 8A); besides MSP-7 and MSP-7₂₂, three further bands are visible, migrating with apparent molecular masses of around 33, 55, and >150 kDa. As MSP-7 is a member of the MSRP gene family (13), the 33-kDa species likely identifies MSRP-2 or MSRP-4 and the 55-kDa species MSRP-5 (assuming no grossly aberrant migration behavior or processing of the proteins). The identification of the >150-kDa species is presently ongoing and will be described elsewhere.

View larger version (48K): [in this window] [in a new window]   FIGURE 4. Size exclusion chromatography and chemical cross-linking of MSP-636 and MSP-636. A and B, MSP-636 and MSP-636 were analyzed on Superdex 200 HR. Elution volumes of standard proteins are as follows and are indicated by arrows: arrow a, ferritin, 450 kDa, 10.0 ml; arrow b, catalase, 240 kDa, 11.6 ml; arrow c, aldolase, 158 kDa, 12.0 ml; and arrow d, chymotrypsin, 25 kDa, 16.0 ml. C, cross-linking of MSP-636 (30 µM) with EGS (molar ratio EGS:lysine residues = 10:1). D, cross-linking of MSP-636 (20 µM) with 0.025% glutaraldehyde. E, cross-linking of MSP-636 (30 µM) with EGS (molar ratio EGS:lysine residues = 1:5, *, ratio = 2:1). F, cross-linking of MSP-636 (20 µM) with 0.025% glutaraldehyde. Samples were taken at time points indicated and analyzed by SDS-PAGE under nonreducing conditions. D, dimer; T, tetramer; C, protein without cross-linker.

View larger version (15K): [in this window] [in a new window]   FIGURE 5. Sedimentation analysis of MSP-636 and MSP-636. A, sedimentation equilibrium centrifugation analysis revealing apparent molecular masses of 88 and 20 kDa for MSP-636 and MSP-636, respectively; , MSP-636, 0.6 mg/ml; , MSP-636, 1.1 mg/ml; •, MSP-636, 0.8 mg/ml. Scans were recorded at 280 nm. Extrapolation to zero concentration yields the molecular mass of the smallest components. B, sedimentation velocity analysis of MSP-636 and MSP-636. The curves displayed are normalized g(s*) plots based on runs at 4 °C. MSP-636 peaked at 3.7 S and MSP-636 at 1.6 S. . MSP-636, 0.15 mg/ml; •. MSP-636, 0.075 mg/ml; . MSP-636, 0.08 mg/ml. Scans were recorded at 230 nm.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Invasion of erythrocytes by merozoites of P. falciparum is a complex and poorly understood process involving numerous parasitic proteins. Several of the participating surface proteins undergo specific proteolytic processing (27), whereas the merozoite is maturing for invasion, and at least for one, MSP-1, such processing is apparently required to allow its orderly shedding from the surface of the parasite, which accompanies the invasion process. The most abundant complex at the merozoite surface to be shed is made up of MSP-1, MSP-6, MSP-7 (and possibly other proteins) that are noncovalently associated. To eventually understand the role of this important multiprotein complex at the parasiteerythrocyte interface, it appeared of interest to us to identify direct interaction partners within the complex using heterologously produced proteins recovered from E. coli.

Probing complex formation between processed and unprocessed forms of MSP-1 with those of MSP-6 and with MSP-7 precursor has revealed interesting commonalities and divergencies. Both proteins interact exclusively with MSP-1D subunits that are shed from the surface. But although MSP-6 appears to bind to p38 only, MSP-7 contacts all MSP-1D subunits except p42, namely p83, p30, and p38.

Analyzing various versions of the MSP-6-MSP-6 precursor, its processed form MSP-6₃₆, and the C-terminally truncated MSP-6₃₆ and their interactions with MSP-1 led to an intriguing picture. First, MSP-6₃₆ and MSP-6₃₆ differ unproportionally in their apparent molecular masses as revealed by size exclusion chromatography indicating asymmetric molecules as well as multimerization. Indeed equilibrium sedimentation analysis and cross-linking experiments confirm that MSP-6₃₆ but not MSP-6₃₆ forms a tetramer. Accepting that both proteins are properly folded, it appears that the structural motifs required for tetramerization are embedded within the 51 C-terminal amino acids not present in MSP-6₃₆. Second, even accounting for the tetramerization in case of MSP-6₃₆, both MSP-6₃₆ and MSP-6₃₆ exhibit hydrodynamic parameters that indicate highly elongated molecules. Thus, assuming a cylindrical shape for either protein, sedimentation data show that monomeric MSP-6₃₆ would have a dimension of 17 x 1.9 nm and tetrameric MSP-6₃₆ of 48 x 2.5 nm. Furthermore, assuming that the C-terminal 51 amino acids missing in MSP-6₃₆, which are predicted to largely form a coiled-coil region, would form an -helix, the length of the monomeric MSP-6₃₆ would be 24 nm, i.e. half the value derived for the tetramer. Thus the structural model for MSP-6₃₆, a highly elongated tetramer held together via the C termini of the monomers as sketched in Fig. 9, closely resembles the structure proposed for MSP-3 (12). Third, our data reveal that the C terminus of MSP-6 is not only crucial for the tetramerization of the protein but also for its interaction with MSP-1; it binds specifically to p38 independent of whether the latter is offered as individual protein or as a subunit embedded within the MSP-1 complex. By contrast, MSP-6₃₆ shows no affinity to any of the MSP-1 subunits as well as to the assembled complex.

View larger version (47K): [in this window] [in a new window]   FIGURE 6. Probing the interaction of MSP-6 precursor with MSP-1. A, MSP-6 fused to GST (gMSP-6) was incubated with the pre-assembled MSP-1 complex and analyzed by GSH-Sepharose chromatography and SDS-PAGE (standard conditions). B, gMSP-6 was denatured and renatured in the presence of all four MSP-1 subunits under conditions described previously (20). The assay mixture was subjected to affinity chromatography using mAb 5.2 followed by SDS-PAGE (standard conditions). Nomenclature L, F, and E as introduced in Fig. 3.

View larger version (74K): [in this window] [in a new window]   FIGURE 7. Probing the interaction of MSP-7 with the full size MSP-1 complex and with individual subunits. Complexes were formed between MSP-7 fused to GST (gMSP-7) and purified MSP-1 subunits containing N-terminal His6 tags. The full MSP-1 complex was assembled as described previously (20). Complex formation was monitored by chromatographing aliquots of the assays on GSH-Sepharose followed by SDS-PAGE (standard conditions). The following combinations are shown: gMSP-7 + MSP-1 full complex (A); gMSP-7 + p83 (B); gMSP-7 + p30 (C); gMSP-7 + p38 (D); gMSP-7 + p42 (E); gMSP-7 + pA2b (F); inset in E, Western blot of PAGE analysis using an His6 mAb. Nomenclature L, F, and E as introduced in Fig. 3.

View larger version (39K): [in this window] [in a new window]   FIGURE 8. Inhibition of parasite growth by rabbit antibodies directed against MSP-7, MSP-6, and p42 of MSP-1, respectively. A, specificity of antibodies raised in rabbits with purified MSP-6 and MSP-7 precursor protein, both fused to GST. Blots were prepared with schizont extracts (S), merozoite extracts (M), and extracts of uninfected erythrocytes as control (C). The various protein species detected are indicated. Molecular masses (MM) are given at the left border. B, growth of P. falciparum strain 3D7 monitored via quantitative flow cytometry. Equal amounts of rabbit sera containing MSP-7, MSP-6, or p42 antibodies, respectively, were assayed as described previously (16). Lowering the antibody concentrations in the assays by 2- and 4-fold, respectively, reduced the extent of growth inhibition (from left to right). PI, preimmune serum.

View larger version (34K): [in this window] [in a new window]   FIGURE 9. Model of the overall structure of the MSP-1-MSP-636-MSP-7 complex. The processing fragments of MSP-1 (p83, p30, p38, and p42) are given in light gray and are arranged according to Kauth et al. (20). MSP-636 and MSP-7 are highlighted in dark gray. Interacting subunits overlap with their circumferences. MSP-636 interacts with p38 via its C terminus (C). With the exception of the C-terminal p19 (30, 31), which is part of p42, there is no detailed structural information available for the various interacting proteins, which are roughly drawn to scale.

Finally, when MSP-6 precursor, i.e. gMSP-6, is exposed to the preassembled MSP-1D complex, no association is observed. By contrast, once denatured and subsequently refolded in the presence of the four MSP-1D subunits, complex formation occurred. This finding indicates that the MSP-6 precursor does not properly expose the domain responsible for the interaction with MSP-1D. In this context, it is interesting to note that the proteolytic attack in E. coli resulting in MSP-6₃₆ is only seen when MSP-6₃₆ but not MSP-6 is being produced, indicating again a significant conformational difference between MSP-6 and MSP-6₃₆ at least with respect to the C-terminal domain. Because the MSP-6 precursor is N-terminally fused to GST, we can at present not exclude that the latter observations reflect a specific property of the fusion protein.

Together, our data support the view that complex formation between MSP-1D and MSP-6 takes place only after primary processing of both proteins and suggest that proteolytic cleavages are a prerequisite for exposing the domains required for specific contacts between p38 of MSP-1 and the C terminus of MSP-6. This interpretation is in agreement with the finding that MSP-6 precursor has never been detected in association with MSP-1D. Primary processing of the two proteins could therefore serve as a timing mechanism during merozoite maturation as discussed by Carruthers and Blackman (29). How MSP-6 localizes to the surface of the parasite is not explained by these results, however, and thus remains to be elucidated.

In contrast to MSP-6, the precursor of MSP-7 does not require processing for binding to the assembled MSP-1D complex and appears capable of simultaneously contacting the three subunits p83, p30, and p38. Whether MSP-7 would associate also with the MSP-1D precursor could not be examined under our experimental conditions. It would for example require His₆-tagged MSP-7, which we did not succeed to produce in E. coli. Also, the question whether processed MSP-7₂₂ is contacting all three subunits of MSP-1 as the precursor protein does remains to be answered. Nevertheless, our data show that the MSP-7 precursor associates with MSP-1 which then may function as a carrier during translocation. Future experiments may reveal whether the two proteins associate, for example, within the lumen of the endoplasmic reticulum and subsequently translocate together to the surface of the parasite, or whether MSP-7 is secreted separately and then associates with MSP-1D in its processed form or as precursor. Finally, under our experimental conditions, we did not detect an affinity between MSP-7 and MSP-6₃₆. Thus, we propose a model for the overall structure of the MSP-1-MSP-6₃₆-MSP-7 complex as shown in Fig. 9.

Being exposed to the human immune system, the MSP-1-MSP-6-MSP-7 complex elicits strong humoral responses in P. falciparum-infected individuals, and numerous findings show that antibodies directed toward MSP-1 can be protective. Here, we have examined rabbit antibodies raised against MSP-6 and MSP-7 for their potential to inhibit parasite multiplication in vitro using the lactate dehydrogenase assay (data not shown) as well as quantitative flow cytometry. Our results with MSP-6 antibodies show efficient in vitro inhibition of parasite growth in agreement with earlier reports (10, 11). However, the inhibition seen with MSP-7 antibodies cannot be interpreted as straightforwardly. They are on one side consistent with the findings of Tewari et al. (18) who, using the P. berghei mouse model, showed that disruption of msp-7 led to a reduced ability of the parasite to invade erythrocytes. On the other side, as revealed by Western blot (Fig. 6A), our MSP-7 antibodies cross-react with three further parasite proteins and thus may exert their inhibitory function not through or not exclusively through MSP-7.

It is interesting to speculate how inhibitory antibodies targeting the two surface proteins, MSP-6 and MSP-7, may function. MSP-6 antibodies may be effective via cross-reaction with MSP-3 (11). However, in our Western blot, we could not detect a respective affinity (Fig. 6A). It therefore appears more likely that they prevent the formation of a complex between MSP-6 and MSP-1 or that they interfere directly with the function of the complex. The inaccessibility of the C terminus of the MSP-6 precursor lends itself to a particularly interesting interpretation. As essential interaction sites of this domain appear occluded, complex formation with MSP-1 does not take place before a proteolytic event converts MSP-6 into MSP-6₃₆. MSP-6 antibodies may thus be effective by preventing this conversion. Indeed, a mechanism as demonstrated for the secondary cleavage of MSP-1, where antibody-mediated inhibition of proteolysis inhibits invasion of erythrocytes, may apply also to MSP-6, MSP-7, and other parts of MSP-1. Further mechanisms how antibodies interacting with MSP-1, MSP-6, and MSP-7 could interfere with the erythrocytic cycle of the parasite can be imagined, and their exploration remains an interesting challenge. We feel that insights gained in this study will be helpful for addressing a number of further long standing questions that concern structure and function of the MSP-1-MSP-6-MSP-7 complex, its generation and functional maturation, as well as its potential as target for drugs and vaccine-induced immune responses.

	FOOTNOTES

 
^* This work was supported by funds from the State of Baden-Wuerttemberg and by Deutsche Forschungsgemeinschaft Grant SFB 544. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ Present address: Institute of Molecular Medicine and Experimental Immunology, D-53105 Bonn, Germany.

² To whom correspondence should be addressed. Tel.: 49-6221-54-8214; Fax: 49-6221-54-5892; E-mail: h.bujard{at}zmbh.uni-heidelberg.de.

³ The abbreviations used are: GST, glutathione S-transferase; PBS, phosphate-buffered saline; DTT, 1,4-dithio-DL-threitol; EGS, ethylene glycol bis-succinimidylsuccinate; mAb, monoclonal antibody.

⁴ C. W. Kauth and U. Woehlbier, unpublished data.

	ACKNOWLEDGMENTS

 
We thank Michael Blackman for a sample of protein extract from merozoites, Michael Lanzer for a probe of DNA of P. falciparum strain 3D7, Thomas Ruppert (Zentrum fuer Molekulare Biologie) for carrying out mass spectroscopic analyses, and Matthias Mayer for helpful discussions. The patient help of Sibylle Reinig in preparing the manuscript is gratefully acknowledged.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Stafford, W. H., Blackman, M. J., Harris, A., Shai, S., Grainger, M., and Holder, A. A. (1994) Mol. Biochem. Parasitol. 66, 157–160[CrossRef][Medline] [Order article via Infotrieve]
2. Pachebat, J. A., Ling, I. T., Grainger, M., Trucco, C., Howell, S., Fernandez-Reyes, D., Gunaratne, R., and Holder, A. A. (2001) Mol. Biochem. Parasitol. 117, 83–89[CrossRef][Medline] [Order article via Infotrieve]
3. Trucco, C., Fernandez-Reyes, D., Howell, S., Stafford, W. H., Scott-Finnigan, T. J., Grainger, M., Ogun, S. A., Taylor, W. R., and Holder, A. A. (2001) Mol. Biochem. Parasitol. 112, 91–101[CrossRef][Medline] [Order article via Infotrieve]
4. Guevara Patino, J. A., Holder, A. A., McBride, J. S., and Blackman, M. J. (1997) J. Exp. Med. 186, 1689–1699[Abstract/Free Full Text]
5. Blackman, M. J., Scott-Finnigan, T. J., Shai, S., and Holder, A. A. (1994) J. Exp. Med. 180, 389–393[Abstract/Free Full Text]
6. Holder, A. A., and Freeman, R. R. (1984) J. Exp. Med. 160, 624–629[Abstract/Free Full Text]
7. McBride, J. S., and Heidrich, H. G. (1987) Mol. Biochem. Parasitol. 23, 71–84[CrossRef][Medline] [Order article via Infotrieve]
8. Blackman, M. J., Heidrich, H. G., Donachie, S., McBride, J. S., and Holder, A. A. (1990) J. Exp. Med. 172, 379–382[Abstract/Free Full Text]
9. Blackman, M. J., and Holder, A. A. (1992) Mol. Biochem. Parasitol. 50, 307–315[CrossRef][Medline] [Order article via Infotrieve]
10. Pearce, J. A., Triglia, T., Hodder, A. N., Jackson, D. C., Cowman, A. F., and Anders, R. F. (2004) Infect. Immun. 72, 2321–2328[Abstract/Free Full Text]
11. Singh, S., Soe, S., Roussilhon, C., Corradin, G., and Druilhe, P. (2005) Infect. Immun. 73, 1235–1238[Abstract/Free Full Text]
12. Burgess, B. R., Schuck, P., and Garboczi, D. N. (2005) J. Biol. Chem. 280, 37236–37245[Abstract/Free Full Text]
13. Mello, K., Daly, T. M., Morrisey, J., Vaidya, A. B., Long, C. A., and Bergman, L. W. (2002) Eukaryot. Cell 1, 915–925[Abstract/Free Full Text]
14. Stafford, W. H., Gunder, B., Harris, A., Heidrich, H. G., Holder, A. A., and Blackman, M. J. (1996) Mol. Biochem. Parasitol. 80, 159–169[CrossRef][Medline] [Order article via Infotrieve]
15. Kumar, S., Epstein, J. E., and Richie, T. L. (2002) Chem. Immunol. 80, 262–286[Medline] [Order article via Infotrieve]
16. Woehlbier, U., Epp, C., Kauth, C. W., Lutz, R., Long, C. A., Coulibaly, B., Kouyate, B., Arevalo-Herrera, M., Herrera, S., and Bujard, H. (2006) Infect. Immun. 74, 1313–1322[Abstract/Free Full Text]
17. Mello, K., Daly, T. M., Long, C. A., Burns, J. M., and Bergman, L. W. (2004) Infect. Immun. 72, 1010–1018[Abstract/Free Full Text]
18. Tewari, R., Ogun, S. A., Gunaratne, R. S., Crisanti, A., and Holder, A. A. (2005) Blood 105, 394–396[Abstract/Free Full Text]
19. Pan, W., Ravot, E., Tolle, R., Frank, R., Mosbach, R., Turbachova, I., and Bujard, H. (1999) Nucleic Acids Res. 27, 1094–1103[Abstract/Free Full Text]
20. Kauth, C. W., Epp, C., Bujard, H., and Lutz, R. (2003) J. Biol. Chem. 278, 22257–22264[Abstract/Free Full Text]
21. Epp, C., Kauth, C. W., Bujard, H., and Lutz, R. (2003) J. Chromatogr. B. 786, 61–72
22. Lutz, R., and Bujard, H. (1997) Nucleic Acids Res. 25, 1203–1210[Abstract/Free Full Text]
23. Mücke, N., Wedig, T., Burer, A., Marekov, L. N., Steinert, P. M., Langowski, J., Aebi, U., and Herrmann, H. (2004) J. Mol. Biol. 340, 97–114[CrossRef][Medline] [Order article via Infotrieve]
24. Philo, J. S. (2000) Anal. Biochem. 279, 151–163[CrossRef][Medline] [Order article via Infotrieve]
25. Ralston, G. (1993) Beckman Instruments, pp. 43–49, Fullerton, CA
26. Blackman, M. J. (1994) Methods Cell Biol. 45, 213–220[Medline] [Order article via Infotrieve]
27. Blackman, M. J. (2000) Curr. Drug Targets 1, 59–83[CrossRef][Medline] [Order article via Infotrieve]
28. Mills, K. E., Pearce, J. A., Crabb, B. S., and Cowman, A. F. (2002) Mol. Microbiol. 43, 1401–1411[CrossRef][Medline] [Order article via Infotrieve]
29. Carruthers, V. B., and Blackman, M. J. (2005) Mol. Microbiol. 55, 1617–1630[CrossRef][Medline] [Order article via Infotrieve]
30. Morgan, W. D., Birdsall, B., Frenkiel, T. A., Gradwell, M. G., Burghaus, P. A., Syed, S. E., Uthaipibull, C., Holder, A. A., and Feeney, J. (1999) J. Mol. Biol. 289, 113–122[CrossRef][Medline] [Order article via Infotrieve]
31. Pizarro, J. C., Chitarra, V., Verger, D., Holm, I., Petres, S., Dartevelle, S., Nato, F., Longacre, S., and Bentley, G. A. (2003) J. Mol. Biol. 328, 1091–1103[CrossRef][Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				M. Kadekoppala, R. A. O'Donnell, M. Grainger, B. S. Crabb, and A. A. Holder Deletion of the Plasmodium falciparum Merozoite Surface Protein 7 Gene Impairs Parasite Invasion of Erythrocytes Eukaryot. Cell, December 1, 2008; 7(12): 2123 - 2132. [Abstract] [Full Text] [PDF]

				M. D. Dyer, T. M. Murali, and B. W. Sobral Computational prediction of host-pathogen protein protein interactions Bioinformatics, July 1, 2007; 23(13): i159 - i166. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 281/42/31517    most recent M604641200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kauth, C. W. Articles by Bujard, H. Search for Related Content PubMed PubMed Citation Articles by Kauth, C. W. Articles by Bujard, H. Social Bookmarking                      What's this?