Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M603419200 on August 10, 2006

J. Biol. Chem., Vol. 281, Issue 42, 31790-31800, October 20, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/42/31790    most recent
M603419200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schmidl, M.
Right arrow Articles by von der Mark, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schmidl, M.
Right arrow Articles by von der Mark, K.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Twisted Gastrulation Modulates Bone Morphogenetic Protein-induced Collagen II and X Expression in Chondrocytes in Vitro and in Vivo*

Martina Schmidl{ddagger}1, Nadia Adam{ddagger}1, Cordula Surmann-Schmitt{ddagger}1, Takako Hattori§2, Michael Stock{ddagger}, Uwe Dietz{ddagger}, Benoit de Crombrugghe§, Ernst Pöschl{ddagger}3, and Klaus von der Mark{ddagger}4

From the {ddagger}Department of Experimental Medicine I, Nikolaus-Fiebiger Center of Molecular Medicine, University of Erlangen-Nuremberg, 91054 Erlangen, Germany and §Department of Molecular Genetics, M. D. Anderson Cancer Center, University of Texas, Houston, Texas 77030

Received for publication, April 10, 2006 , and in revised form, July 10, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Twisted gastrulation (TSG) is an extracellular modulator of bone morphogenetic protein (BMP) activity and regulates dorsoventral axis formation in early Drosophila and Xenopus development. Studies on tsg-deficient mice also indicated a role of this protein in skeletal growth, but the mechanism of TSG activity in this process has not yet been investigated. Here we show for the first time by in situ hybridization and immunohistochemistry that TSG is strongly expressed in bovine and mouse growth plate cartilage as well as in fetal ribs, vertebral cartilage, and cartilage anlagen of the skull. Furthermore we provide evidence that TSG is directly involved in BMP-regulated chondrocyte differentiation and maturation. In vitro, TSG impaired the dose-dependent BMP-2 stimulation of collagen II and X expression in cultures of MC615 chondrocytes and primary mouse chondrocytes. In the presence of chordin, a BMP antagonist, the inhibitory effect of TSG was further enhanced. TSG also inhibited BMP-2-stimulated phosphorylation of Smad factors in chondrocytes, confirming the role of TSG as a modulator of BMP signaling. For analysis of TSG functions in cartilage development in vivo, the gene was overexpressed in transgenic mice under the control of the cartilage-specific Col2a1 promoter. As a result, Col10a1 expression was significantly reduced in the growth plates of transgenic embryos and newborns in comparison with wild type littermates as shown by in situ hybridization and by real time PCR analysis. The data suggest that TSG is an important modulator of BMP-regulated cartilage development and chondrocyte differentiation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bone morphogenetic proteins (BMPs)5 are key regulators in the formation of cartilage models of vertebrate long bones, vertebrae, and ribs and their transition to bone during endochondral ossification (for reviews, see Refs. 1-5). However, the role of BMP factors in cartilage development and chondrocyte differentiation is complex and differs with time and site of chondrogenic differentiation: BMPs control limb outgrowth by negatively modulating apical ectodermal ridge activity (6-8), whereas BMPs are required for the formation of prechondrogenic mesenchyme and chondrocyte differentiation in the limb (9). The ability of BMP-2, BMP-4, and others to induce chondrogenic differentiation of undifferentiated stems cells in vivo and in vitro has been amply demonstrated (10-12). In line with this observation is the finding that chondrogenesis in vivo is impaired by blocking BMP activities with noggin (13, 14) or deletion of the BMP receptor (BMPRIB) (15).

The role of BMPs during chondrocyte maturation and hypertrophy is also complex and controversially discussed: several studies show that BMP factors such as BMP-6 and BMP-7 stimulate hypertrophic differentiation of chondrocytes and promote collagen X expression (16-18), thus preparing growth plate cartilage for replacement by endochondral bone. On the other hand, it was reported that BMP-2 and BMP-4 overexpression in developing chick limbs caused delayed hypertrophy of chondrocytes (10). Similarly overexpression of noggin in mouse limb cultures resulted in advanced chondrocyte maturation of hypertrophic cells, also indicating that BMP signaling can delay certain steps in hypertrophic differentiation (19).

These apparent discrepancies may result from overlapping actions of several BMP factors expressed at different levels during cartilage development but may also reflect the complex local regulation of BMP activity by extracellular BMP antagonists such as noggin (13, 20, 21), follistatin (22-24), chordin (25-27), and twisted gastrulation (Refs. 28-32; for reviews, see Ref. 33). According to their different expression pattern in embryonic development, different antagonists regulate BMP activities at different sites and time points of development (27, 34).

Twisted gastrulation (TSG) is a diffusible, secreted protein of Mr 30,000 that has both BMP agonistic and antagonistic effects in Drosophila and Xenopus development (28-32). Drosophila TSG is necessary for peak BMP activity in early Drosophila development, e.g. in the formation of the amnioserosa, the dorsalmost tissue (32). In Xenopus and zebrafish development, TSG antagonizes BMP- and chordin-regulated formation of the dorsal axis (29-32). It binds directly to BMP-2, -4, and -7 and can form a ternary complex with BMPs and chordin, thus preventing the binding of BMPs to their cell surface receptors (28-30, 32, 35, 36). As reported for chordin, TSG binding to BMP-2 and BMP-4 is mediated by cysteine-rich CR domains (28, 36). As part of the ternary BMP-chordin-TSG complex, however, TSG can also function as BMP agonist and promote BMP activities by facilitating chordin cleavage by the tolloid/BMP-1 protease; this allows BMP release and binding to its receptor (28, 31, 37, 38). In the absence of tolloid activity, TSG stabilizes the ternary BMP-chordin-TSG complex and acts as a BMP antagonist or BMP inhibitor.

In the early mouse embryo, TSG is expressed in extraembryonic tissues, branchial arches, neural ectoderm, prechondrogenic mesoderm, intercostal vascular bundles, and other tissues (35, 39). In later stages at E15.5-17.5, TSG has been identified in the digital rays and the joint surfaces (35). Deletion of the tsg gene in mice resulted in severe growth retardation (40), defects in forebrain and craniofacial development, and kinky tails (39, 41). Yet no information has been available on the expression of TSG in cartilage and the developing skeleton and whether it is directly involved in the regulation of cartilage development.

Here we show for the first time that TSG is strongly expressed in the bovine and mouse growth plate cartilage of long bones, ribs, and digits and to a lesser extent also in the resting zone of the epiphysis, trabecular bone, and vertebral cartilage, but it is absent from other skeletal tissues including muscle, skin, and fibroblasts. We provide experimental evidence that TSG impairs BMP-stimulated collagen II and X expression in chondrocyte cultures and show that overexpression of TSG in transgenic mice under the collagen II promoter impairs collagen X expression in hypertrophic cartilage. Thus, TSG seems to be directly involved in the regulation of cartilage differentiation, which may explain some of the skeletal abnormalities reported in the different tsg-deficient mouse lines.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Subtractive Suppression Hybridization—Chondrocytes were isolated from the growth plates of 4-6-month calf fetuses and separated into four distinct fractions by centrifugation through a linear Percoll gradient as described previously (42). For subtractive suppression hybridization according to Diatchenko et al. (43) mRNA was extracted using the Oligotex mRNAi kit (Qiagen), transcribed into cDNA, and cloned into the pCRII-TOPO vector. Differentially expressed genes in fractions B1, B2, and B3 were identified by several subtractive suppression hybridization experiments using the PCR Select® kit by Promega. The cDNA banks of each fraction B1, B2, and B3 were used alternatively as "tester" and "driver" cDNA. Differentially expressed genes were identified by dot blot Southern hybridization with 32P-labeled total cDNA from either chondrocyte population and sequenced. Their differential expression of several genes in fractions B1-B4 and resting zone chondrocytes was confirmed by reverse transcription (RT)-PCR. For each identified bovine gene, specific primers were designed; the amount of cDNA was standardized to endogenous glyceraldehyde-3-phosphate dehydrogenase levels. The PCR cycle number for each gene was adjusted to 80% of the plateau level to allow quantitative comparison of chondrocytes signals for each gene but not between different genes.

MC615 Cell Cultures and Primary Chondrocytes—The mouse chondrocyte line MC615 (kindly provided by Dr. F. Mallein-Garein, Lyon, France (44)) was cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal serum and antibiotics. Primary mouse chondrocytes were prepared from epiphyseal cartilage or rib cages of newborn mice by collagenase digestion (0.1% collagenase P (Roche Applied Science) in F12/Dulbecco's modified Eagle's medium containing 5% fetal calf serum) after adhering connective tissue and muscle was thoroughly removed by trypsin and collagenase pretreatment. Prior to growth factor treatment, the serum concentration was reduced to 1% fetal calf serum. Various amounts of recombinant BMP-2 (kindly provided by Dr. W. Sebald, University of Wuerzburg, Germany), TSG, and chordin (R&D Systems) were added as indicated, and cells were cultured for another 48 h in Dulbecco's modified Eagle's medium containing 1% fetal calf serum; {alpha}1(II) and {alpha}1(X) mRNA levels were measured both by RT-PCR and real time PCR and normalized to cyclophilin A or actin mRNA (for primers see "Analysis of mRNA Levels by Real Time PCR" below).

RT-PCR—cDNA was prepared from total chondrocytes RNA with oligo-(dT)15 primers and Superscript II reverse transcriptase (Invitrogen). For semiquantitative PCR, aliquots of the cDNA were amplified using Hot Star Taq polymerase (Qiagen) and specific primers: bovine TSG, dw5'-TTGAAATTTAGCTCATGGATGT-3' and up5'-TGGAAACTATTGTTCAAAACC (578 bp; annealing temperature, 53 °C) (sequences of primers of further differentially expressed bovine genes (Fig. 1) are available on request).

Analysis of mRNA Levels by Real Time PCR—Total RNA was isolated from chondrocytes using the RNeasy kit (Qiagen) with the optional DNase digestion step to get rid of genomic DNA. RT was performed with 1 µg of total RNA as above, and the resulting cDNA was amplified in triplicates by the SYBR Green PCR assay (Absolute QPCR SYBR Green Fluorescein Mix, ABgene), and products were detected on a I-Cycler iQ real time PCR detection system (Bio-Rad). PCRs were incubated for 15 min at 95 °C followed by 50 amplification cycles with 30-s annealing at 60 °C, 40-s extension at 72 °C, and 30-s denaturation at 95 °C. Cyclophilin A and/or beta-actin were used to standardize the total amount of cDNA. The primers designed for real time PCR were: Col2a1 (AGAACAGCATCGCCTACCTG and CTTGCCCCACTTACCAGTGT) (161 bp), Col10a1 (CATAAAGGGCCCACTTGCTA and CAGGAATGCCTTGTTCTCCT) (98 bp), TSG (ACACCCAGCTGAACTGGAAC and GCTGGGAACAGACACGTTTT) (125 bp), Sox9 (AGGAAGCTGGCAGACCAGTA and TGTAATCGGGGTGGTCTTTC) (158 bp), Runx2 (ATACCCCCTCGCTCTCTGTT and AGGTTGGAGGCACACATAGG) (94 bp), beta-actin (AGAGGGAAATCGTGCGTGAC and CAATAGTGATGACCTGGCCGT) (138 bp), and cyclophilinA (CCACCGTGTTCTTCGACAT and CAGTGCTCAGAGCTCGAAAG) (114 bp).

Specificity of PCR was checked by analyzing melting curves and by gel electrophoresis of the amplicon. Relative mRNA levels (2{Delta}{Delta}C) were determined by comparing (i) the PCR cycle threshold (C) between cDNA of the gene of interest and of cyclophilin or beta-actin ({Delta}C) and (ii) {Delta}C values between target and control conditions ({Delta}{Delta}C). For control, wild type littermates were used in the analysis of TSG transgenic animals; in MC615 stimulation experiments, data were normalized to mRNA levels achieved at 50 ng of BMP. Standard deviations of relative mRNA levels were calculated ({Delta}{Delta}C ± [rad]{S.D.({Delta}Ctreated)2 + S.D.({Delta}Cuntreated)2}[/rad]).

Analysis of Transgene DNA—Expression of the Col2a1-TSG-IRES-lacZ transgene in embryos or P8 pups was analyzed by X-gal staining (45) of toes clipped for numbering pups and by PCR using the lacZ-specific primers. Quantitative analysis of transgene copies was performed by real time PCR using either primer pairs specific for tsg (see above) or lacZ: LacF (down), 5'-GCATCGAGCTGGGTAATAAGCGTTGGCAAT-3'; LacB (up), 5'-GACACCAGACCAACTGGTAATGGTAGCGAC-3'.

Northern Hybridization—RNA isolated from bovine chondrocytes was separated by electrophoresis in agarose-formaldehyde gels and transferred to a nylon membrane by semidry blotting as described previously (46). For Northern hybridization the following [{alpha}-32P]dCTP-labeled probes were used: {alpha}1(X) mRNA, a 2.2-kb insert form the human clone SX2200 (46); TSG mRNA, a 397-bp probe amplified from the coding region with the primer pair 5'bTSGcod (CTCTGGGATGAGTGCTGTGA) and 3'bTSGcod (TGTGGAACCAGCGATACTTG).

In Situ Hybridization—For in situ hybridization on mouse paraffin sections, digoxigenin-labeled antisense riboprobes were used that were specific for mouse TSG mRNA and {alpha}1(II) and {alpha}1(X) mRNA and cloned into the pCRII-TOPO vector. The vectors were reverse transcribed using Sp6 polymerase (TSG), T7 RNA polymerase ({alpha}1(X)), or T3 polymerase ({alpha}1(II)) with digoxigenin-labeled dNTPs (Roche Applied Science) for antisense strands and linearized with BamHI (TSG), XhoI ({alpha}1(X)), or EcoRI ({alpha}1(II)).

Mouse tissues were fixed overnight in 4% paraformaldehyde, dehydrated, and embedded in paraffin. Six-micrometer sections were analyzed by in situ hybridization as described previously (47) with some modifications: hybridization was processed in Atlas glass hybridization chambers (Clontech) overnight at 55 °C. Several washing steps followed: 2 x 20 min with 2x SSC at room temperature, 20 min with 2x SSC at 50 °C, 20 min with 1x SSC at 55 °C, 20 min with 1x SSC at 60 °C, and 10 min with 1x SSC at room temperature. After RNase treatment further washing steps followed: 1 h with 2x SSC at 50 °C, 1 h with 1x SSC at 55 °C, 1 h with 1x SSC at 60 °C, and 30 min with 1x SSC at room temperature. Blocking was performed with a 10% blocking solution (Roche Applied Science); antibody incubation and detection with anti-digoxigenin-alkaline phosphatase and BM purple were performed according to the manufacturer's descriptions (Roche Applied Science). Sections were mounted with coverslips in Kaiser's glycerol gelatin (Merck) and photographed with a Zeiss Axiophot microscope.

Immunohistochemistry—Paraffin sections were rehydrated and pretreated with testicular hyaluronidase (2 mg/ml) for 1 h at 37 °C. After washing with Tris-buffered saline and blocking with 1% bovine serum albumin, sections were incubated with an affinity-purified polyclonal rabbit antibody against TSG (0.4 µg/ml) overnight at 4 °C. Bound antibody was detected using the Link-Label IHC Detection System (Biogenex) with biotinylated anti-rabbit Ig, streptavidin-coupled alkaline phosphatase, and Fast Red as color substrate according to the manufacturer's descriptions.

Preparation of Recombinant TSG and Rabbit Antibodies to TSG—For generation of a TSG expression vector, the coding sequence of the mouse tsg1 without the signal peptide was amplified by PCR using the primers dwTSGmusexpress (GACTGCTAGCCTGTAACAAAGCACTCTGTGCC) and upTS-Gmusexpress (GACTGCGGCCGCAAACATGCAGTTCATACACTTGAC) to create additional restriction sites and cloned into the pCMV-C-His vector containing the BM40 signal peptide (48). The resulting expression vector is pCMV-TSG1-C-His. This construct then was stably transfected into human embryonic kidney 293 EBNA cells. Recombinant TSG-His6 was collected from serum-free culture medium, concentrated by ultrafiltration on a YM10 Amicon membrane, and purified by affinity chromatography on nickel-nitrilotriacetic acid-agarose (Qiagen). For antibody preparation, a rabbit was injected subcutaneously with 50 µg of purified TSG in complete Freund's adjuvant followed by two booster injections in incomplete adjuvant. The antiserum was purified by affinity chromatography of TSG-Sepharose and tested by Western blotting as described previously (49).

Generation of Transgenic Col2a1-TSG-lacZ Reporter Gene Mouse Lines—The complete coding region of mouse tsg1 cDNA amplified by RT-PCR was cloned into pcDNA3.1(+), digested with HindIII/NotI, and ligated with the IRES-lacZ sequence cut out from the IRES-lacZ-SV40pA (45) vector with NotI/XhoI. The ligated fragment was cloned into a new splice acceptor site introduced into the 3'-part of the Col2a1 intron 1 by restriction cleavage of the Col2a1/pBSM2 vector with XhoI/HindIII. The Col2a1/pBSMA vector contains 3 kb of the mouse Col2a1 promoter, the first exon, and most of the intron 1 of the Col2a1 gene (45). The vector was linearized with PmeI/SwaI to remove the plasmid part, purified by agar gel electrophoresis, electroeluted from the gel into a dialysis bag (Spectrapor), purified by phenol-CHCl3-isoamylalcohol extraction, and precipitated by ethanol. For microinjection, the TSG vector DNA was diluted in microinjection buffer to 1.5 ng/µl. After microinjection into pronuclei of fertilized oocytes isolated from B6D2F1 mice oocytes were implanted into CD1 foster mothers as described previously (45).

X-Gal Staining—LacZ activity was detected by staining with X-gal (Roche Applied Science) for 3-6 h following fixation with glutaraldehyde and formaldehyde as described previously (45). For staining of embryos older than 15 days, the skin was removed before fixation. LacZ-positive embryos were postfixed overnight in 4% formaldehyde, dehydrated, and embedded in paraffin. Sections were counterstained with eosin. Some X-galstained embryos were counterstained with Alizarin red and cleared with KOH-glycerol. For analysis of tsg transgene expression, tail DNA was extracted, purified, and used for lacZ PCR with lacZ-specific primers and for quantitative analysis of transgene copy number by real time PCR specific for lacZ or tsg.

Detection of Smad Protein Phosphorylation by Western Blotting—For Western blot analysis of Smad protein phosphorylation, MC615 cells or primary rib chondrocytes were stimulated with or without BMP-2 and/or TSG in variable amounts. Rib chondrocytes were taken from the same wild type cartilage as used for collagen analysis by real time PCR. Following incubation for the indicated periods, cells were washed with phosphate-buffered saline, lysed in Laemmli sample buffer, and analyzed by SDS-PAGE (50) and Western blotting on SequiBlotTM polyvinylidene difluoride membranes (Bio-Rad) with rabbit anti-phospho-Smad (Smad factors 1, 5, and 8) (Cell Signaling Technology, Inc.) and goat anti-rabbit IgG-horseradish peroxidase conjugate (Dianova) using the enhanced chemoluminescence system. Afterward membranes were stained for 30 min by Coomassie Blue for protein loading control. Quantification of Western blot signals was done using AIDA (Advanced Image Data Analyzer, Fujii Raytest) software. Relative phospho-Smad levels were normalized to maximum Western blot levels.


Figure 1
View larger version (99K):
[in this window]
[in a new window]
  		FIGURE 1.
Differentially expressed genes in three distinct chondrocyte populations of the fetal bovine growth plate (B1-B3) and RZ. Chondrocytes from fetal bovine growth plate were separated into four distinct populations by centrifugation through a linear Percoll gradient as described previously (42). RNA was extracted, and cDNA was prepared for analysis by subtractive suppression hybridization. Selected differentially expressed clones in the prehypertrophic fraction B3 (A) and in the hypertrophic fractions B1/B2 (B) were sequenced, and their expression levels in chondrocyte populations B1-B3 and resting zones were analyzed by RT-PCR and standardized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Highest levels of collagen X, bone sialoprotein, and matrix Gla protein seen in the hypertrophic zone B1 (B) confirm the validity of the method. A gradient of expression from the hypertrophic to the resting zone was also shown for hyaluronan synthase-2, adseverin, and others. A shows that collagen VI, epiphycan, and thrombospondin-2 are highest in the resting and prehypertrophic zone (B3). PHGP, phospholipid hydroperoxide glutathione peroxidase. C, analysis of TSG expression levels, standardized to glyceraldehyde-3-phosphate dehydrogenase, in bovine growth plate chondrocyte populations by Northern hybridization confirmed highest levels of TSG mRNA in the hypertrophic fractions B1 and B2. bTSG, bovine TSG.

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Identification of Differentially Expressed Genes in the Fetal Bovine Growth Plate—Chondrocytes were enzymatically released from growth plate cartilage of calf fetuses (51) and separated into four distinct fractions (B1-B4) by centrifugation in a linear Percoll gradient as described previously (42). RNA was extracted from these fractions and from resting zone chondrocytes (RZ), and cDNA was prepared from each fraction. cDNAs differentially expressed in the combined fraction B1/B2 (late and early hypertrophic chondrocytes) versus B3 (prehypertrophic chondrocytes) were identified by subtractive suppression hybridization. After subtraction of B1/B2 cDNA from B3 cDNA, about 100 clones were spotted on two parallel nylon filters and hybridized with either total radiolabeled B3 or B1/B2 cDNA. Differentially expressed clones were picked, sequenced for identification, and amplified. Their expression levels in the three growth plate chondrocyte populations B1, B2, and B3 (B4 is not shown here) and in resting zone chondrocytes were analyzed by RT-PCR. Fig. 1A shows highest expression levels of selected matrix genes, e.g. epiphycan, {alpha}3(VI) collagen subunit, thrombospondin-2, and other genes, such as the S15a ribosomal subunit in prehypertrophic chondrocytes (B3) and RZ, with decreasing levels in hypertrophic chondrocytes (B1). In another experiment B3 cDNA was subtracted from B1 cDNA, and 200 clones were picked; the majority of cDNA specimens were derived from {alpha}1(X) collagen. As expected, the highest levels of collagen X mRNA were seen in the hypertrophic fractions B1 and B2 but also in the prehypertrophic fraction B3 (Fig. 1B). The levels of {alpha}1(II) mRNA are about equal in all four fractions with a slight maximum in B3 (not shown here; see Ref. 42). After prehybridization with {alpha}1(X) cDNA, remaining predominant genes with highest expression in the B1 fraction and decreasing levels in B3 included MMP13, bone sialoprotein, matrix Gla protein, hyaluronan synthase-2, and adseverin (Fig. 1B). One of the cDNA clones expressed predominantly in the hypertrophic chondrocyte fraction B1 contained sequences that were homologous to the 3'-untranslated region of human TSG. Completion of the sequences by PCR using bovine chondrocyte cDNA and primers derived from the human TSG sequences confirmed more than 90% homology of the bovine gene with human TSG. Semiquantitative analysis of bovine TSG mRNA distribution by RT-PCR and Northern hybridization revealed highest concentrations of TSG mRNA in chondrocytes of the hypertrophic zone (B1) with a decrease toward the proliferating zone (B3) yet significant levels in the resting zone (Fig. 1, B and C).

Expression of Other BMP-modulating Factors in the Growth Plate—The predominance of TSG expression in the hypertrophic chondrocytes raised the question which BMPs and whether other TSG-binding proteins and BMP-modulating factors such as chordin and noggin codistribute with TSG in the growth plate. Semiquantitative analysis of the growth plate chondrocyte populations B1-B4 and RZ by RT-PCR showed the absence of chordin from the hypertrophic and prehypertrophic fractions (B1-B3; Fig. 2), whereas chordin was present in the RZ and to some extent in fraction B4 (proliferating zone). The BMP antagonist noggin showed the same gradient as TSG, and so did BMP-4, whereas BMP-2 and BMP-7 were expressed in a reverse gradient with highest mRNA levels in the prehypertrophic fraction B3 (Fig. 2). Equally high levels of BMP-6 were seen in all fractions B1-B4, and equally low levels of BMP-1/tolloid mRNA were found in all chondrocyte fractions without any recognizable gradient.


Figure 2
View larger version (66K):
[in this window]
[in a new window]
  		FIGURE 2.
Expression levels of BMP factors and BMP-binding proteins in the growth plate chondrocyte fractions B1-B4 and in the resting zone. RT-PCR analysis revealed different gradients for all four BMP factors in the growth plate chondrocytes: BMP-4 showed a gradient similar to TSG, whereas BMP-2 and BMP-7 had the lowest concentration in the hypertrophic zone. The mRNA levels of BMP-6 were about equal in all growth plate fractions but lower in the resting zone. Noggin showed the same gradient as TSG, but chordin was absent from growth plate chondrocyte fractions B1-B3. Equal expression levels for the procollagen protease BMP-1/tolloid were seen in all chondrocyte populations. tld, tolloid; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; n.d., no data.

 
Twisted Gastrulation Is Expressed in Hypertrophic Cartilage, Rib Cartilage, Digits, and Developing Vertebrae—The expression pattern of TSG mRNA was investigated by in situ hybridization analysis of the developing mouse between E15.5 and P1. In accordance with the results obtained with fetal bovine chondrocytes, in 17.5-day embryos and newborn mice, TSG was most prominent in the hypertrophic cartilage zones of the humerus, tibia, radius (Fig. 3, A and C) and scapula (not shown) in a pattern comparable to that of collagen X (Fig. 3B). Only weak signals were obtained in resting cartilage (Fig. 3C), which is strongly positive for type II collagen (Fig. 3D). No TSG mRNA signals were seen in the proliferating zone of the epiphysis (Fig. 3A). Furthermore TSG is strongly expressed in digits (Fig. 3E) and in hypertrophic cartilage and the surface zone of epiphyses (Fig. 3F) and continues to be expressed in the hypertrophic zone of the postnatal growth plate of long bones at least until day 30 (Fig. 3H). TSG mRNA was not seen in muscle and skin but was seen at low levels also in endochondral and periosteal bone trabeculae (Fig. 3G). In E14.5-15.5 embryos TSG is strongly expressed in the growth plate (Fig. 3I), in the long hypertrophic zone of rib cartilage (Fig. 3J), in the cartilage primordia of turbinate bones in the skull (Fig. 3K), and in cartilage anlagen of the vertebrae (Fig. 3L).

To confirm the distribution of TSG at the protein level, full-length recombinant mouse TSG was expressed as His-tagged protein in human embryonic kidney 293 EBNA cells and used for immunization of rabbits and preparation of specific antibodies by affinity chromatography (Fig. 4, A and B). The analysis of TSG distribution by immunofluorescence using the affinity-purified antibody on frozen sections (Fig. 4, C and D) and by immunohistochemistry on paraffin sections (Fig. 4, E and G-J)) showed a strong reaction in the hypertrophic zone (Fig. 4, C, D, E, and G), whereas no reaction was observed in the proliferating zone and in the surface zone of epiphyseal cartilage (Fig. 4, C and E). The antibody also revealed the presence of TSG in resting cartilage (Fig. 4, D and E), consistent with the results of the Northern hybridization (Fig. 1), whereas the signals seen by in situ hybridization were weak in the resting zone (Fig. 4F). Investigation of the TSG distribution in cartilage by immunofluorescence at higher magnification indicated that the majority of TSG is located on the chondrocyte surface or intracellularly but is hardly detectable in the intercellular cartilage matrix (Fig. 4C). Even after hyaluronidase pretreatment TSG could not be visualized in the intercellular cartilage matrix. In E13.5 embryos the TSG antibody stained rib perichondrium, vertebral cartilage, intervertebral disks (Fig. 4, H and I), intercostals tissue, and lung epithelia (Fig. 4J). The TSG staining in perichondrium and intervertebral regions in E13.5 embryos is consistent with the expression pattern of TSG reported elsewhere (39).

Role of TSG in BMP-regulated Collagen II and X Expression in Chondrocytes in Vitro—To find out whether TSG interferes with BMP-regulated chondrocyte differentiation and cartilage development, cultures of mouse MC615 cells (44) were treated with various combinations of recombinant TSG and BMP-2. The data show that both {alpha}1(II) and {alpha}1(X) mRNA levels measured by RT-PCR and real time PCR were stimulated by BMP-2 in a dose-dependent manner between 50 and 200 ng/ml (Fig. 5, A and B) in agreement with a previous study by Valcourt et al. (52). Fig. 5 shows typical results of one experiment of five independent chondrocyte experiments; the standard deviations are from triplicate real time PCR samples. BMP-stimulated collagen II and X expression was impaired by 2 µg/ml TSG. TSG at 2 µg/ml inhibited collagen II and X mRNA levels also in the absence of exogenous BMP-2 probably by modulating endogenous BMP factors (Fig. 5, A and B). Chordin alone partially impaired BMP-stimulated collagen X expression (Fig. 5E), whereas complete suppression of collagen X and II expression was achieved by chordin in combination with TSG (Fig. 5, E and F). Similar effects of TSG on BMP-induced collagen II and X expression were also seen in cultures of primary rib chondrocytes from newborn mice (Fig. 5, C and D) but with a different dose response. TSG at 2 µg/ml impaired BMP-stimulated collagen II and collagen X expression at BMP doses up to 100 ng/ml (Fig. 5).


Figure 3
View larger version (129K):
[in this window]
[in a new window]
  		FIGURE 3.
In situ hybridization analysis of TSG mRNA in the developing mouse with an antisense probe derived from the coding region of TSG mRNA. At E17.5 TSG is predominantly expressed in the hypertrophic zone of all growth plates (A, C, and F) in a pattern similar to collagen X (B) but weakly expressed in proliferating and resting cartilage (A, C, and F), which is positive for collagen II (D). TSG is strongly expressed in growth cartilage of digits (E); it is also found on the surface zone of a metacarpal joint (F). Weak signals for TSG were also seen in trabeculae of long bones (G). TSG expression persists in the growth plate of long bones until at least P30 (H). In E15.5 embryos strongest expression of TSG was also seen in the hypertrophic zones as shown here for the humerus (I) but also in ribs (J), in the cartilage primordia of turbinate bone (tb), in the skull (K), and in the vertebral primordia (L). In situ hybridization with probes from the 3'-untranslated region and from the coding region (not shown) of murine TSG revealed the same pattern. h, humerus; r, radius; p2-p4, proximal of digits; u, distal epiphysis of ulna; m, metacarpals, bm, bone marrow; ma, mandible; g, growth plate, tb, turbinate bone; p, periosteal bone; b, brain; Col, collagen.

 
Because Sox9 and Runx2 are the major transcription factors responsible for transcriptional regulation of Col2a1 and Col10a1 gene expression, respectively, the influence of TSG on BMP-induced Sox9 and Runx2 expression was analyzed in MC615 cells. Similar to the effects on Col2a1 and Col10a1 expression, BMP-2 stimulated Sox9 and Runx2 expression several-fold over unstimulated controls, and TSG suppressed the BMP effect almost down to control levels (Fig. 5, G and H).

TSG Antagonizes BMP-2-induced Phosphorylation of Smad Proteins in Chondrogenic Cells—To define the signaling events involved in TSG modulation of BMP-regulated collagen expression, BMP-2-induced Smad phosphorylation was assayed by Western blotting using phospho-Smad-specific antibodies. MC615 cells and primary mouse rib chondrocytes were treated for 45 min with various amounts of BMP-2 (50-200 ng/ml) in the presence and absence of 2 µg/ml TSG. Cellular levels of phosphorylated BMP receptor-dependent Smads (Smad factors 1, 5, and 8) were markedly increased upon stimulation with BMP-2 in a dose-dependent manner (Fig. 6A, lanes 1-4). Addition of 2 µg/ml TSG completely suppressed BMP-2 induced phospho-Smad levels in MC615 cells, confirming an antagonistic role for TSG in BMP signaling in these cells (Fig. 6B, lanes 5-8). Primary rib chondrocytes responded to increasing doses of BMP-2 in a similar manner, showing increased phospho-Smad levels (Fig. 6B, lanes 1-3). TSG reduced BMP-2-induced phospho-Smad levels by 33% and after treatment with 200 ng/ml by 28% (Fig. 6B, lanes 4-6). Together these results support the proposed role of TSG as an antagonist of the BMP-dependent Smad signaling pathway in chondrogenic cells.

Overexpression of TSG in Transgenic Mice under the Col2a1 Promoter Impairs Collagen X Expression in the Growth Plate—The question remained open whether TSG also affects collagen X or II expression in cartilage in vivo. Therefore TSG was overexpressed in transgenic mice under the cartilage-specific Col2a1 promoter. A TSG-expressing IRES-lacZ vector driven by the Col2a1 promoter (Fig. 7A) was injected into the male pronucleus of fertilized oocytes, which were implanted into foster mothers. Six transgenic founders were generated that revealed strong lacZ expression in all cartilaginous areas (Fig. 7, B and C). Strongly enhanced signals of TSG mRNA were also seen by in situ hybridization throughout all cartilage zones including the proliferating and resting zones in the epiphyses of transgenic animals, corresponding to the expected expression of Col2a1 (Fig. 7, H and J), whereas TSG mRNA was restricted to the hypertrophic and surface zones in wild type mice (Fig. 7, D and E). Immunohistochemical analysis of TSG in transgenic animals revealed strongly enhanced reactions in epiphyseal cartilage (Fig. 7, K and L) compared with wild type littermates stained in parallel under identical conditions (Fig. 7, F and G), confirming that TSG was also overexpressed at the protein level in transgenic cartilage.

From six transgenic founders, three lines were established (F2, G1, and G3). Transgenic line G1 was investigated in detail; transgenic offspring contained about 12 copies of the transgene as determined by Southern hybridization and real time PCR analysis of genomic TSG DNA (Fig. 8A). Quantitative analysis of TSG mRNA levels by real time PCR in chondrocytes prepared from epiphyseal and from rib cage cartilage of transgenic pups of founder G1 revealed about 3-4-fold enhanced TSG mRNA levels in transgenic chondrocytes as compared with wild type littermates (Fig. 8B). Quantitative analysis of collagen mRNA of freshly isolated rib cage chondrocytes by real time PCR revealed 10% reduced levels of {alpha}1(II) mRNA and about 20% reduced {alpha}1(X) mRNA in TSG transgenic mice as compared with wild type littermates (Fig. 8, C and D).


Figure 4
View larger version (107K):
[in this window]
[in a new window]
  		FIGURE 4.
Shown is the localization of TSG in newborn (C-G) and E13.5 (H, I, and J) embryos with affinity-purified rabbit anti-TSG antibodies by immunofluorescence on frozen sections (C and D) and by immunohistochemical staining on paraffin sections (E-J). A and B, preparation of rabbit antibodies against mouse TSG. A, Coomassie Blue staining of recombinant mouse TSG-His6 used for immunization of rabbits and affinity purification of antibodies. Lane 1, 5 µg of TSG; lane 2, 1 µg of TSG. B, Western blot with affinity-purified rabbit anti-TSG (1:2000). Lane 3, 1 µg of TSG; lane 4, 0.5 µg of TSG. C-E, anti-TSG (0.5 µg/ml) revealed the strongest reaction in all hypertrophic zones ("h") as shown here for the humerus (C and D) and radius (D and G). Significant antibody reaction was also seen in the resting zone ("r"in D) but not in the proliferating zone ("p") and in the joint surface zone (E). TSG appears to be restricted to the cell surface but is absent from the intercellular matrix (D). By comparison, in situ hybridization analysis of the same area (F) showed only faint labeling of TSG mRNA in the resting zone. H, I, and J, TSG was also seen in the primordia of the intervertebral disc and vertebral cartilage (H and I), in lung epithelia ("l"in J), and in thoracic vertebrae and intercostal vascular bundles (J). hu, humerus; ra, radius.

 
Also in situ hybridization analysis revealed significantly reduced collagen X expression in the hypertrophic zone of growth plates of TSG-overexpressing mice in comparison with wild type littermates (Fig. 9, C and D). No significant differences between transgenic and wild type were seen with an {alpha}1(II) collagen probe possibly because of the very high levels of Col2a1 mRNA in hyaline cartilage (Fig. 9, A and B). Altogether the results are consistent with the observed inhibition of BMP-induced collagen X expression by TSG in chondrocyte cultures and indicate that TSG is a negative regulator of BMP-induced collagen X expression and chondrocyte maturation in the growth plate.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Twisted gastrulation was originally identified as an extracellular modulator of BMP activity in the control of dorsoventral axis formation in Drosophila and Xenopus development. Detailed in vitro and in vivo studies have given insight into the dual role of TSG either as BMP antagonist by blocking binding of BMPs to their receptors or as agonist by promoting BMP release from the ternary BMP-chordin-TSG complex (28, 35, 38). Recently results from tsg-deficient mice indicated a critical role of TSG also in skeletal development of vertebrates. In a study by Nosaka et al. (40) the inactivation of both alleles of the tsg gene resulted in severe postnatal growth retardation, growth plate abnormalities, a kinky tail, and impaired lymphopoiesis in half of the offspring. Interestingly deletion of the tsg gene in another mouse strain also caused growth retardation, mild vertebral abnormalities, and osteoporosis but no interference with lymphopoiesis (39). The differences may be due to different genetic backgrounds (B6SJ1/F1 versus C56BL/6 in the study by Nosaka et al. (40). In a third knock-out mouse, TSG was inactivated in a C56BL/6 background by deleting exon 3 (41), which allowed the expression of a shortened form of TSG mRNA lacking the domain coding for the BMP binding region. This mutant was perinatally lethal and developed pronounced forebrain defects including rostral truncations, proboscis, cyclopia, single nostrils, and holoprosencephaly in addition to defects in the foregut endoderm and delayed ossification of cervical vertebrae (41). A similar phenotype was reported by Zakin and De Robertis (39) in tsg-/- mutants lacking in addition one allele of BMP-4, indicating a genetic coupling of tsg to the BMP-4 pathway (39). Common to all studies were defects in the vertebral development caused by defective closure of the dorsal neural arches (39). Yet no information concerning the localization and specific role of TSG in cartilage development and chondrocyte differentiation has been available so far.

Here show for the first time that TSG is expressed in cartilage and provide experimental evidence that it impairs BMP-stimulated collagen X and II expression both in vitro and in vivo. Our results indicate that TSG modulates BMP-regulated chondrocyte maturation in the growth plate and may thus explain the growth plate abnormalities observed in the tsg-/- mouse strain by Nosaka et al. (40).

TSG is strongly expressed in hypertrophic chondrocytes of the fetal bovine growth plate with lower levels in chondrocytes in the resting and proliferating zones. In fact, cartilage seems to be a major site of TSG expression in the entire mouse fetus. This expression pattern seen by Northern hybridization and RT-PCR was confirmed at the protein level using an affinity-purified antibody generated against recombinant TSG. In situ hybridization analysis of the developing mouse skeleton revealed strong TSG expression mostly in hypertrophic cartilage but less in the resting zone. This may reflect a reduced half-life of TSG mRNA in the resting zone as compared with the TSG protein. TSG expression was also seen in rib cartilage and vertebrae, in the cartilage model of turbinate bone in the skull, and in endochondral and periosteal bone trabeculae. This is in line with a recent report showing the expression of TSG in osteogenic MC3T3 cells (53) and interference of TSG with BMP-induced osteoblast differentiation (54).


Figure 5
View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 5.
Modulation of BMP-2-stimulated collagen II and X expression in MC615 chondrocytes and primary mouse rib chondrocytes by TSG and chordin. Cells were cultured for 48 h (A, B, and D) or 24 h (C) in the presence of various combinations of BMP-2, TSG, and chordin as indicated in the figure. "BMP50" indicates 50 ng/ml BMP-2, etc. TSG200 indicates 200 ng/ml TSG. In A-D, TSG was used at 2 µg/ml. mRNA levels of {alpha}1(II) and {alpha}1(X) were measured by real time PCR and standardized to actin or cyclophilin A mRNA levels as indicated. The data show that BMP-2 stimulates collagen II and X expression in a dose dependent manner (A and B). In MC615 cells TSG impaired BMP-stimulated collagen II and X expression at concentrations up to 200 ng BMP-2/ml (A and B), whereas in primary chondrocytes 2 µg/µl TSG was only sufficient for inhibition up to 100 ng/ml BMP-2. TSG alone also inhibited collagen II and X expression possibly by blocking endogenous BMP factors. The addition of 1.75 µg/ml chordin to TSG almost completely suppressed BMP-induced collagen X (E) and II (F) induction. Similarly the expression of Sox9 and Runx2 was up-regulated by BMP and down-regulated by TSG to control levels even in the absence of chordin (G and H). Chondr., chondrocytes; rel., relative; cyclo, cyclophilin A; Chrd, chordin.

 


Figure 6
View larger version (63K):
[in this window]
[in a new window]
  		FIGURE 6.
BMP-2-induced increase of cellular phospho-Smad levels is antagonized by TSG in chondrogenic cells. MC615 cells (A) or primary mouse rib chondrocytes (B) were stimulated with BMP-2 and/or TSG as indicated, and after 45 min cell lysates were analyzed for phosphorylation of Smad proteins by SDS-PAGE and Western blotting with antibodies specific for phosphorylated Smad (Smad factors 1, 5, and 8) using the enhanced chemiluminescence detection system. Densitometric analysis of the phospho-Smad bands (upper panel) was performed using AIDA software. Values were normalized against maximum levels. After densitometry, the membrane was stained with Coomassie Brilliant Blue as loading control (middle panel). The primary chondrocytes (B) responded to BMP in a manner similar to MC615 cells (A), but TSG did not suppress phosphorylation of Smad (Smad factors 1, 5, and 8) to the same extent as in MC615 cells. Coom., Coomassie; rel., relative; WB, Western blot; P-Smad, phospho-Smad.

 
The predominance of TSG in growth plate cartilage suggested a regulatory function of TSG in chondrocyte maturation and growth plate development. Here we show that overexpression of TSG under the control of the cartilage-specific Col2a1 promoter in transgenic mice partially inhibited collagen X expression in the growth plate of long bones. Reduced collagen X expression in transgenic rib cage and epiphyseal chondrocytes was confirmed quantitatively by measuring {alpha}1(X) mRNA levels by real time PCR, which also demonstrated reduced levels of {alpha}1(II) mRNA collagen. The observation that only a 10-20% reduction of collagens II and X was achieved in TSG-overexpressing mice despite high TSG mRNA levels in the transgenic chondrocytes may be explained by the fact that TSG can inhibit Col10a1 expression only to the extent at which Col10a1 is stimulated by BMP above basal levels. Additional factors such as Runx2 or AP1 factors have been shown to up-regulate collagen X in hypertrophic chondrocytes (46, 55, 56), therefore even an excess of TSG may not be able to achieve a larger extent of inhibition than seen here.

This may also explain why the TSG-overexpressing mice did not develop significant skeletal abnormalities in contrast to TSG-deficient mice in the study of Nosaka et al. (40), which revealed severe postnatal growth retardation. Furthermore in light of the expression of TSG in early prechondrogenic mesenchyme (57) complete tsg gene deletion as reported in the tsg-/- mouse lines will affect earliest stages of skeletogenesis, whereas overexpression of TSG under the Col2a1 promoter may come into action too late to cause substantial anatomical alterations in the skeleton. However, although the down-regulation of collagen X by TSG overexpression was apparently not sufficient to generate major morphological abnormalities in the skeleton of TSG-misexpressing embryos, the transgenic experiment supported a physiological role of TSG and BMP in cartilage collagen regulation and chondrocyte differentiation.


Figure 7
View larger version (139K):
[in this window]
[in a new window]
  		FIGURE 7.
Generation of transgenic mice overexpressing TSG under the cartilage-specific Col2a1 promoter. A, in the pCol2a1-TSG-lacZ vector transcription of the tsg and lacZ genes, which are separated by an IRES element, is under the control of the 6-kb Col2a1 promoter containing the enhancer in the first intron (45). B, example of a transgenic embryo (E17.5) showing lacZ expression in the cartilage. C, digits and metacarpals of a transgenic E17.5 embryo showing lacZ expression in all chondrocytes. D-L, overexpression of TSG mRNA and protein in cartilage of newborn transgenic (H-L) mice in comparison with wild type littermates (D-G). In situ hybridization (D, E, H, and J) shows strongly enhanced TSG mRNA signals in all chondrocytes of the epiphysis including the resting and proliferating zones of transgenic animals compared with wild type tissues (D and H, humerus; E and J, metacarpals). Similarly staining of transgenic cartilage for TSG with an affinity-purified antibody reveals enhanced TSG protein levels in all chondrocytes of the transgenic humerus (K and L), whereas in the wild type littermates a significant antibody reaction was only seen in the hypertrophic cartilage (F and G). prom., promoter; wt, wild type; tg, transgenic; m1, metacarpal 1; m2, metacarpal 2; n, naviculare; r, distal epiphysis of radius; u, distal epiphysis of ulna.

 
The observation of reduced collagen X expression in the growth plate of TSG-overexpressing mice was in line with our in vitro studies in chondrocyte cultures. Both MC615 chondrocytes and primary mouse rib chondrocytes responded to BMP-2 by enhanced collagen II and X expression, and TSG inhibited this effect, acting as a BMP antagonist. TSG alone without exogenous BMP also inhibited collagen II and X expression presumably by blocking endogenous BMP activity. Down-regulation of BMP-induced collagen II and X expression involved the Smad signaling pathway; phosphorylation of the BMP receptor-coupled Smad factors 1, 5, and 8 was completely impaired by TSG in MC615 cells but was only partially impaired in primary chondrocytes, indicating different levels of BMP receptors I or II or possibly different levels of endogenous BMP factors produced by primary chondrocytes versus MC615 cells.

Both BMP-stimulated collagen II and collagen X expression were completely blocked by the combination of TSG and chordin, consistent with the model of a stable ternary BMP-TSG-chordin complex, which prevents BMP binding to its receptor (28, 38). Chordin is a large secreted protein characterized by four cysteine-rich CR domains, which allow direct interaction with BMPs and prevent binding of BMPs to their cognate receptors (25, 36, 37). As a major active component of the Spemann organizer, it controls dorsoventral axis formation by BMP and causes dorsalization of Xenopus embryos when overexpressed (33, 58). The complex role of chordin in regulating BMP activity is illustrated by the fact that BMP can be released from the BMP-chordin complex after proteolytic cleavage by metalloproteinases called tolloid in Drosophila, Xolloid in Xenopus, or BMP-1 in Mammalia (Refs. 59-61; for reviews, see Refs. 62 and 63). Previously it has been shown that misexpression of chordin inhibited maturation of chondrocytes in the growth plate (34), but whether chordin plays a physiological role in TSG modulation of BMP activity in cartilage remains questionable in view of in situ hybridization studies of the developing mouse skeleton showing the absence of chordin from cartilage proper (27, 34). Our RT-PCR results also show the absence of chordin from all fetal bovine growth plate chondrocyte populations except for resting chondrocytes, although the presence of putative shorter bovine chordin splice variants such as described for human chordin (64) cannot be excluded. However, chordin is strongly expressed in perichondrium and distal ends of developing long bones (27, 34) and thus may influence BMP-TSG interactions as it has been shown to diffuse over long distances in the Xenopus embryo (65). Further studies will have to show whether other splice variants of chordin or other CR domain-containing, TSG-binding proteins such as chordin-like (ChL-2) (66-68) modulate TSG-BMP interactions in the growth plate. However, there is also experimental evidence for a chordin-independent mechanism of BMP regulation by TSG in the zebrafish (69).

The similar gradient of noggin and TSG mRNA levels in the four chondrocyte populations of the fetal bovine growth plate (Fig. 2) was intriguing and suggested that noggin instead of chordin might be involved in TSG modulation of BMP activities in growth plate cartilage. This would be consistent with studies showing that the inactivation of noggin caused cartilage hyperplasia and oversized growth plates and interfered with the formation of articulating joint surfaces (70). Similarly overexpression of noggin severely impaired chondrogenic differentiation of somite and limb mesenchyme (13) and cartilage growth (71). However, there is no evidence for TSG binding to noggin (31).


Figure 8
View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 8.
A, TSG copy number in wild type and transgenic mice of one litter (F2 generation of founder G1) determined by real time PCR. Transgenic pups of founder G1 contain about 12 copies of the transgene (standardized to two copies in the wild type). B, TSG mRNA levels in chondrocytes of G1 offspring are 3-4-fold enhanced in transgenic chondrocytes as compared with chondrocytes from wild type littermates (C and D). Levels of {alpha}1(X) collagen mRNA in the growth plates of TSG transgenic mice (founder G1) were reduced by about 20% compared with wild type littermates, levels of {alpha}1(II) mRNA were reduced by about 10%. wt, wild type; tg, transgenic; Nr, number; rel., relative.

 


Figure 9
View larger version (170K):
[in this window]
[in a new window]
  		FIGURE 9.
In situ hybridization analysis of the skeleton of transgenic newborn mice (D) shows significantly reduced {alpha}1(X) expression in the growth plate as compared with the wild type (C), consistent with the quantitative analysis of {alpha}1(X) mRNA shown in Fig. 8 and with the suppression of collagen X expression by TSG in chondrocytes cultures. However, the in situ hybridization analysis did not allow visualize of the differences in the {alpha}1(II) signals because of the extremely high expression levels of {alpha}1(II) mRNA (A and B). wt, wild type; tg, transgenic.

 
The question remains which of the BMP factors and BMP-modulating proteins identified so far in growth cartilage are actually binding to TSG and involved in the TSG effect on chondrocyte maturation and collagen X expression. Zakin and De Robertis (39) have shown that the additional deletion of one BMP-4 allele in their tsg-/- mouse line caused a dramatic disruption of brain and head development, indicating a direct coupling of TSG and BMP-4 pathways. This is consistent with our results of the quantitative analysis of BMP levels in the distinct growth plate populations showing significant differences in the distribution of BMP-2, BMP-4, BMP-6, and BMP-7 but a similar gradient of TSG and BMP-4. In vitro, TSG has been shown to bind directly with its N-terminal domain to BMP-2 and -4 (28) but also to BMP-7 (57). In fact, loss of BMP-7 in combination with half-dose or complete loss of TSG caused fusion of legs (sirenomelia) in mice (57), and BMP-4/7 heterozygote mice develop minor defects in the rib cage and the distal part of the limbs (72), also suggesting a physiological link of TSG with BMP-7 signaling in cartilage development. However, the concentration gradient of BMP-7 in the growth plate chondrocytes was in the reverse order as compared with BMP-4.

In conclusion, our results indicate a modulatory role for TSG in BMP-regulated collagen II and X expression and chondrocyte maturation during skeletal development. The TSG effect involves the Smad signaling pathway. Which BMP factors in the growth plate are regulated by TSG and whether chordin or chordin-like molecules and/or proteolytic activities by tolloid/BMP-1 are involved in TSG-BMP interactions in the growth plate remains to be investigated.


   FOOTNOTES
 
* This work was supported by Deutsche Forschungsgemeinschaft Grant Ma-534-18/1 (to K. v. d. M.) and National Institutes of Health Grant PO1 AR042919 (to B. d. C.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 These authors contributed equally to this work. Back

2 Present address: Dept. of Biochemistry and Molecular Dentistry, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, Okayama 700-8525, Japan. Back

3 Present address: University of East Anglia, School of Biological Sciences, Norwich NR4 7TJ, UK. Back

4 To whom correspondence should be addressed: Dept. of Experimental Medicine I, Nikolaus-Fiebiger Center of Molecular Medicine, University of Erlangen-Nuremberg, Glueckstr. 6, 91054 Erlangen, Germany. Fax: 49-9131-8526341; E-mail: kvdmark{at}molmed.uni-erlangen.de.

5 The abbreviations used are: BMP, bone morphogenetic protein; TSG, twisted gastrulation; RT, reverse transcription; IRES, internal ribosome entry site; RZ, resting zone chondrocytes; E, embryonic day; P, postnatal day; X-gal, 5-bromo-4-chloro-3-indolyl-D-galactopyranoside. Back


   ACKNOWLEDGMENTS
 
We are most grateful for the elaborate microinjection work performed by Chad Smith, for expert help in histological work by Heidi Eberspaecher, and for the help in animal handling by Zhaoping Zhang and to all M. D. Anderson Cancer Center, which has been central for this work. We also thank Karoline Schwarz and Britta Schlund of help in the histology.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Reddi, A. H. (2001) Arthritis Res. 3, 1-5[CrossRef][Medline] [Order article via Infotrieve]
  2. Hogan, B. L. (1996) Genes Dev. 10, 1580-1594[Free Full Text]
  3. Karsenty, G., and Wagner, E. F. (2002) Dev. Cell 2, 389-406[CrossRef][Medline] [Order article via Infotrieve]
  4. Canalis, E., Economides, A. N., and Gazzerro, E. (2003) Endocr. Rev. 24, 218-235[Abstract/Free Full Text]
  5. Balemans, W., and Van Hul, W. (2002) Dev. Biol. 250, 231-250[CrossRef][Medline] [Order article via Infotrieve]
  6. Niswander, L., and Martin, G. R. (1993) Nature 361, 68-71[CrossRef][Medline] [Order article via Infotrieve]
  7. Pizette, S., and Niswander, L. (1999) Development 126, 883-894[Abstract]
  8. Wang, C. K., Omi, M., Ferrari, D., Cheng, H. C., Lizarraga, G., Chin, H. J., Upholt, W. B., Dealy, C. N., and Kosher, R. A. (2004) Dev. Biol. 269, 109-122[CrossRef][Medline] [Order article via Infotrieve]
  9. Pizette, S., and Niswander, L. (2000) Dev. Biol. 219, 237-249[CrossRef][Medline] [Order article via Infotrieve]
  10. Duprez, D., Bell, E. J., Richardson, M. K., Archer, C. W., Wolpert, L., Brickell, P. M., and Francis-West, P. H. (1996) Mech. Dev. 57, 145-157[CrossRef][Medline] [Order article via Infotrieve]
  11. Chen, P., Carrington, J. L., Hammonds, R. G., and Reddi, A. H. (1991) Exp. Cell Res. 195, 509-515[CrossRef][Medline] [Order article via Infotrieve]
  12. Shukunami, C., Ohta, Y., Sakuda, M., and Hiraki, Y. (1998) Exp. Cell Res. 241, 1-11[CrossRef][Medline] [Order article via Infotrieve]
  13. Capdevila, J., and Johnson, R. L. (1998) Dev. Biol. 197, 205-217[CrossRef][Medline] [Order article via Infotrieve]
  14. Capdevila, J., and Izpisua Belmonte, J. C. (2001) Annu. Rev. Cell Dev. Biol. 17, 87-132[CrossRef][Medline] [Order article via Infotrieve]
  15. Yi, S. E., Daluiski, A., Pederson, R., Rosen, V., and Lyons, K. M. (2000) Development 127, 621-630[Abstract]
  16. Grimsrud, C. D., Romano, P. R., D'Souza, M., Puzas, J. E., Schwarz, E. M., Reynolds, P. R., Roiser, R. N., and O'Keefe, R. J. (2001) J. Orthop. Res. 19, 18-25[CrossRef][Medline] [Order article via Infotrieve]
  17. Enomoto-Iwamoto, M., Iwamoto, M., Mukudai, Y., Kawakami, Y., Nohno, T., Higuchi, Y., Takemoto, S., Ohuchi, H., Noji, S., and Kurisu, K. (1998) J. Cell Biol. 140, 409-418[Abstract/Free Full Text]
  18. Volk, S. W., Luvalle, P., Leask, T., and Leboy, P. S. (1998) J. Bone Miner. Res. 13, 1521-1529[CrossRef][Medline] [Order article via Infotrieve]
  19. Minina, E., Wenzel, H. M., Kreschel, C., Karp, S., Gaffield, W., McMahon, A. P., and Vortkamp, A. (2001) Development 128, 4523-4534[Medline] [Order article via Infotrieve]
  20. Smith, W. C., Knecht, A. K., Wu, M., and Harland, R. M. (1993) Nature 361, 547-549[CrossRef][Medline] [Order article via Infotrieve]
  21. Zimmerman, L. B., De Jesus-Escobar, J. M., and Harland, R. M. (1996) Cell 86, 599-606[CrossRef][Medline] [Order article via Infotrieve]
  22. Fainsod, A., Deissler, K., Yelin, R., Marom, K., Epstein, M., Pillemer, G., Steinbeisser, H., and Blum, M. (1997) Mech. Dev. 63, 39-50[CrossRef][Medline] [Order article via Infotrieve]
  23. Ohyama, A., Saito, F., Ohuchi, H., and Noji, S. (2001) Mech. Dev. 100, 331-333[CrossRef][Medline] [Order article via Infotrieve]
  24. Iemura, S., Yamamoto, T. S., Takagi, C., Uchiyama, H., Natsume, T., Shimasaki, S., Sugino, H., and Ueno, N. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 9337-9342[Abstract/Free Full Text]
  25. Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K., and De Robertis, E. M. (1994) Cell 79, 779-790[CrossRef][Medline] [Order article via Infotrieve]
  26. Piccolo, S., Sasai, Y., Lu, B., and De Robertis, E. M. (1996) Cell 86, 589-598[CrossRef][Medline] [Order article via Infotrieve]
  27. Scott, I. C., Steiglitz, B. M., Clark, T. G., Pappano, W. N., and Greenspan, D. S. (2000) Dev. Dyn. 217, 449-456[CrossRef][Medline] [Order article via Infotrieve]
  28. Oelgeschlager, M., Larrain, J., Geissert, D., and De Robertis, E. M. (2000) Nature 405, 757-763[CrossRef][Medline] [Order article via Infotrieve]
  29. Ross, J. J., Shimmi, O., Vilmos, P., Petryk, A., Kim, H., Gaudenz, K., Hermanson, S., Ekker, S. C., O'Connor, M. B., and Marsh, J. L. (2001) Nature 410, 479-483[CrossRef][Medline] [Order article via Infotrieve]
  30. Chang, C., Holtzman, D. A., Chau, S., Chickering, T., Woolf, E. A., Holmgren, L. M., Bodorova, J., Gearing, D. P., Holmes, W. E., and Brivanlou, A. H. (2001) Nature 410, 483-487[CrossRef][Medline] [Order article via Infotrieve]
  31. Blitz, I. L., Cho, K. W., and Chang, C. (2003) Development 130, 4975-4988[Abstract/Free Full Text]
  32. Mason, E. D., Konrad, K. D., Webb, C. D., and Marsh, J. L. (1994) Genes Dev. 8, 1489-1501[Abstract/Free Full Text]
  33. De Robertis, E. M., Larrain, J., Oelgeschlager, M., and Wessely, O. (2000) Nat. Rev. Genet 1, 171-181[CrossRef][Medline] [Order article via Infotrieve]
  34. Zhang, D., Ferguson, C. M., O'Keefe, R. J., Puzas, J. E., Rosier, R. N., and Reynolds, P. R. (2002) J. Bone Miner. Res. 17, 293-300[CrossRef][Medline] [Order article via Infotrieve]
  35. Scott, I. C., Blitz, I. L., Pappano, W. N., Maas, S. A., Cho, K. W., and Greenspan, D. S. (2001) Nature 410, 475-478[CrossRef][Medline] [Order article via Infotrieve]
  36. Oelgeschlager, M., Reversade, B., Larrain, J., Little, S., Mullins, M. C., and De Robertis, E. M. (2003) Development 130, 4047-4056[Abstract/Free Full Text]
  37. Larrain, J., Bachiller, D., Lu, B., Agius, E., Piccolo, S., and De Robertis, E. M. (2000) Development 127, 821-830[Abstract]
  38. Larrain, J., Oelgeschlager, M., Ketpura, N. I., Reversade, B., Zakin, L., and De Robertis, E. M. (2001) Development 128, 4439-4447[Medline] [Order article via Infotrieve]
  39. Zakin, L., and De Robertis, E. M. (2004) Development 131, 413-424[Abstract/Free Full Text]
  40. Nosaka, T., Morita, S., Kitamura, H., Nakajima, H., Shibata, F., Morikawa, Y., Kataoka, Y., Ebihara, Y., Kawashima, T., Itoh, T., Ozaki, K., Senba, E., Tsuji, K., Makishima, F., Yoshida, N., and Kitamura, T. (2003) Mol. Cell. Biol. 23, 2969-2980[Abstract/Free Full Text]
  41. Petryk, A., Anderson, R. M., Jarcho, M. P., Leaf, I., Carlson, C. S., Klingensmith, J., Shawlot, W., and O'Connor, M. B. (2004) Dev. Biol. 267, 374-386[CrossRef][Medline] [Order article via Infotrieve]
  42. Weisser, J., Riemer, S., Schmidl, M., Suva, L. J., Poschl, E., Brauer, R., and von der Mark, K. (2002) Exp. Cell Res. 279, 1-13[CrossRef][Medline] [Order article via Infotrieve]
  43. Diatchenko, L., Lau, Y. F., Campbell, A. P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E. D., and Siebert, P. D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 6025-6030[Abstract/Free Full Text]
  44. Mallein-Gerin, F., and Olsen, B. R. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3289-3293[Abstract/Free Full Text]
  45. Zhou, G., Garofalo, S., Mukhopadhyay, K., Lefebvre, V., Smith, C. N., Eberspaecher, H., and de Crombrugghe, B. (1995) J. Cell Sci. 108, 3677-3684[Abstract]
  46. Gebhard, S., Poschl, E., Riemer, S., Bauer, E., Hattori, T., Eberspaecher, H., Zhang, Z., Lefebvre, V., de Crombrugghe, B., and von der Mark, K. (2004) Matrix Biol. 23, 309-322[CrossRef][Medline] [Order article via Infotrieve]
  47. Dietz, U. H., Ziegelmeier, G., Bittner, K., Bruckner, P., and Balling, R. (1999) Dev. Dyn. 216, 233-243[CrossRef][Medline] [Order article via Infotrieve]
  48. Poschl, E., Mayer, U., Stetefeld, J., Baumgartner, R., Holak, T. A., Huber, R., and Timpl, R. (1996) EMBO J. 15, 5154-5159[Medline] [Order article via Infotrieve]
  49. Kirsch, T., and von der Mark, K. (1991) Eur. J. Biochem. 196, 575-580[Medline] [Order article via Infotrieve]
  50. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
  51. Riemer, S., Gebhard, S., Beier, F., Poschl, E., and von der Mark, K. (2002) J. Cell. Biochem. 86, 688-699[CrossRef][Medline] [Order article via Infotrieve]
  52. Valcourt, U., Ronziere, M. C., Winkler, P., Rosen, V., Herbage, D., and Mallein-Gerin, F. (1999) Exp. Cell Res. 251, 264-274[CrossRef][Medline] [Order article via Infotrieve]
  53. Petryk, A., Shimmi, O., Jia, X., Carlson, A. E., Tervonen, L., Jarcho, M. P., O'Connor M, B., and Gopalakrishnan, R. (2005) Bone 36, 617-626[Medline] [Order article via Infotrieve]
  54. Gazzerro, E., Deregowski, V., Vaira, S., and Canalis, E. (2005) Endocrinology 146, 3875-3882[Abstract/Free Full Text]
  55. Zheng, Q., Zhou, G., Morello, R., Chen, Y., Garcia-Rojas, X., and Lee, B. (2003) J. Cell Biol. 162, 833-842[Abstract/Free Full Text]
  56. Thomas, D. P., Sunters, A., Gentry, A., and Grigoriadis, A. E. (2000) J. Cell Sci. 113, 439-450[Abstract]
  57. Zakin, L., Reversade, B., Kuroda, H., Lyons, K. M., and De Robertis, E. M. (2005) Development 132, 2489-2499[Abstract/Free Full Text]
  58. Sasai, Y., Lu, B., Steinbeisser, H., and De Robertis, E. M. (1995) Nature 376, 333-336[CrossRef][Medline] [Order article via Infotrieve]
  59. Marques, G., Musacchio, M., Shimell, M. J., Wunnenberg-Stapleton, K., Cho, K. W., and O'Connor, M. B. (1997) Cell 91, 417-426[CrossRef][Medline] [Order article via Infotrieve]
  60. Piccolo, S., Agius, E., Lu, B., Goodman, S., Dale, L., and De Robertis, E. M. (1997) Cell 91, 407-416[CrossRef][Medline] [Order article via Infotrieve]
  61. Scott, I. C., Blitz, I. L., Pappano, W. N., Imamura, Y., Clark, T. G., Steiglitz, B. M., Thomas, C. L., Maas, S. A., Takahara, K., Cho, K. W., and Greenspan, D. S. (1999) Dev. Biol. 213, 283-300[CrossRef][Medline] [Order article via Infotrieve]
  62. Ray, R. P., and Wharton, K. A. (2001) Cell 104, 801-804[CrossRef][Medline] [Order article via Infotrieve]
  63. Harland, R. M. (2001) Nature 410, 423-424[CrossRef][Medline] [Order article via Infotrieve]
  64. Millet, C., Lemaire, P., Orsetti, B., Guglielmi, P., and Francois, V. (2001) Mech. Dev. 106, 85-96[CrossRef][Medline] [Order article via Infotrieve]
  65. Jones, C. M., and Smith, J. C. (1998) Dev. Biol. 194, 12-17[CrossRef][Medline] [Order article via Infotrieve]
  66. Nakayama, N., Han, C. Y., Cam, L., Lee, J. I., Pretorius, J., Fisher, S., Rosenfeld, R., Scully, S., Nishinakamura, R., Duryea, D., Van, G., Bolon, B., Yokota, T., and Zhang, K. (2004) Development 131, 229-240[Abstract/Free Full Text]
  67. Nakayama, N., Han, C. E., Scully, S., Nishinakamura, R., He, C., Zeni, L., Yamane, H., Chang, D., Yu, D., Yokota, T., and Wen, D. (2001) Dev. Biol. 232, 372-387[CrossRef][Medline] [Order article via Infotrieve]
  68. Garcia Abreu, J., Coffinier, C., Larrain, J., Oelgeschlager, M., and De Robertis, E. M. (2002) Gene (Amst.) 287, 39-47[Medline] [Order article via Infotrieve]
  69. Xie, J., and Fisher, S. (2005) Development 132, 383-391[Abstract/Free Full Text]
  70. Brunet, L. J., McMahon, J. A., McMahon, A. P., and Harland, R. M. (1998) Science 280, 1455-1457[Abstract/Free Full Text]
  71. Pathi, S., Rutenberg, J. B., Johnson, R. L., and Vortkamp, A. (1999) Dev. Biol. 209, 239-253[CrossRef][Medline] [Order article via Infotrieve]
  72. Katagiri, T., Boorla, S., Frendo, J. L., Hogan, B. L., and Karsenty, G. (1998) Dev. Genet. 22, 340-348[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
C. Surmann-Schmitt, U. Dietz, T. Kireva, N. Adam, J. Park, A. Tagariello, P. Onnerfjord, D. Heinegard, U. Schlotzer-Schrehardt, R. Deutzmann, et al.
Ucma, a Novel Secreted Cartilage-specific Protein with Implications in Osteogenesis
J. Biol. Chem., March 14, 2008; 283(11): 7082 - 7093.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J.-L. Zhang, Y. Huang, L.-Y. Qiu, J. Nickel, and W. Sebald
von Willebrand Factor Type C Domain-containing Proteins Regulate Bone Morphogenetic Protein Signaling through Different Recognition Mechanisms
J. Biol. Chem., July 6, 2007; 282(27): 20002 - 20014.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/42/31790    most recent
M603419200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schmidl, M.
Right arrow Articles by von der Mark, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schmidl, M.
Right arrow Articles by von der Mark, K.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement