Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M606717200 on August 25, 2006

J. Biol. Chem., Vol. 281, Issue 42, 31995-32003, October 20, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
281/42/31995    most recent
M606717200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Treeck, M.
Right arrow Articles by Gilberger, T. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Treeck, M.
Right arrow Articles by Gilberger, T. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Conserved Region in the EBL Proteins Is Implicated in Microneme Targeting of the Malaria Parasite Plasmodium falciparum*Formula

Moritz Treeck{ddagger}, Nicole S. Struck{ddagger}, Silvia Haase{ddagger}, Christine Langer{ddagger}, Susann Herrmann{ddagger}, Julie Healer§, Alan F. Cowman§1, and Tim W. Gilberger, Recipient of an Emmy-Noether fellowship (DFG){ddagger}2

From the {ddagger}Bernhard Nocht Institute for Tropical Medicine, Malaria II, 20359 Hamburg, Germany and the §The Walter and Eliza Hall Institute of Medical Research, Melbourne, Victoria 3050, Australia

Received for publication, July 14, 2006 , and in revised form, August 23, 2006.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The proliferation of the malaria parasite Plasmodium falciparum within the human host is dependent upon invasion of erythrocytes. This process is accomplished by the merozoite, a highly specialized form of the parasite. Secretory organelles including micronemes and rhoptries play a pivotal role in the invasion process by storing and releasing parasite proteins. The mechanism of protein sorting to these compartments is unclear. Using a transgenic approach we show that trafficking of the most abundant micronemal proteins (members of the EBL-family: EBA-175, EBA-140/BAEBL, and EBA-181/JSEBL) is independent of their cytoplasmic and transmembrane domains, respectively. To identify the minimal sequence requirements for microneme trafficking, we generated parasites expressing EBA-GFP chimeric proteins and analyzed their distribution within the infected erythrocyte. This revealed that: (i) a conserved cysteine-rich region in the ectodomain is necessary for protein trafficking to the micronemes and (ii) correct sorting is dependent on accurate timing of expression.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmodium falciparum is the causative agent of the most severe form of human malaria. Increasing global prevalence of malaria is reported, and it is estimated that mortality reaches 1-2 million per year, with the biggest impact on young African children (1). The invasion, host cell modification and subsequent destruction of erythrocytes by the obligatory intracellular parasite are responsible for the pathobiology in the human host. The invasion process is initiated by merozoites, polar-organized, ~1.8 µm, slightly elongated invasive cells (2, 3). Secretory organelles including the micronemes and rhoptries (4) store and secrete proteins that enable the parasite to (i) adhere to surface receptors of the host cell, (ii) invade the new host cell, and (iii) establish itself within the parasitophorous vacuole (5). Because of compartmentalization, this small protozoan parasite relies on a sophisticated secretory system that delivers proteins to multiple subcellular destinations (6-11).

Trafficking is initiated by classical N-terminal signal sequences that direct proteins across the endoplasmic reticulum (ER) into the secretory pathway (12). In the Golgi and trans-Golgi network (TGN) the proteins are routed either to constitutive or regulated secretory pathways (13). Once the proteins reach the Golgi exit face, they are embedded into transport vesicles according to sequence information or by an acquired label and brought to their final destinations (14). Proteins entering the regulated pathways are sorted to secretory compartments and are released upon a stimulus (15). One intriguing question concerns the nature of the signal(s) necessary and sufficient for post-Golgi protein sorting to the predetermined destinations. In mammalian cells the transport of transmembrane proteins to endosomes and lysosomes is most commonly mediated by distinct cytoplasmic-sorting motifs (16, 17). This has also been shown in the protozoan Toxoplasma gondii, a Plasmodium-related parasite. The cytoplasmic domain of type I transmembrane proteins encodes information required for directing these proteins to the secretory organelles (18-21).

In P. falciparum all known adhesive, micronemal proteins are type I integral membrane proteins containing a classical N-terminal signal peptide, a single transmembrane domain and a short cytoplasmic domain (5, 22). Whereas the consensus targeting sequence for protein trafficking to the apicoplast and host erythrocyte have been elucidated (23-25), no consensus motif for microneme or rhoptry targeting has been identified so far.

The best characterized micronemal protein is erythrocyte binding antigen 175 (EBA-175),3 a member of the erythrocyte binding like (EBL) superfamily of protein ligands in Plasmodium (26-29). EBA-175 and other members of this protein family like EBA-140/BAEBL (30, 31) or EBA-181/JESEBL (32, 33) share an overall domain structure (34). They contain (i) a cysteine-rich Duffy binding-like (DBL) domain, which is responsible for recognition and binding of the appropriate erythrocyte receptor, (ii) a second cysteine-rich domain (3'-cysteine-rich region or domain VI) with an unknown function, (iii) a type I transmembrane domain, and (iv) a short cytoplasmic domain. Here we report the analysis of minimal sequence requirements for the post-Golgi targeting of secretory proteins into the micronemes.


Figure 1
View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 1.
Deletion of the 3·-end of eba-140, eba-181 and eba-175 genes. A, schematic representation of the 3' replacement of the eba-140 gene by single crossover recombination of pHH1 constructs into the eba-140 locus. The positive selection cassette (hDHFR) of the pHH1 vector is represented by the black box. A ~1.1-kb fragment of the C terminus without the cytoplasmic domain (green) was cloned into the pHH1 vector. This fragment is flanked by the 3'-untranslated region of the P. berghei dihydrofolate reductase gene (gray) in the pHH1 vector. The crosses refer to the regions where recombination events were expected. The intron/exon structure of the endogenous eba-140 gene is shown. Blue, signal peptide; yellow,3'-cysteine-rich region; red, transmembrane domain; green, cytoplasmic domain. The BglII restriction sites are marked, and the position of the eba-140 probe used for Southern analysis is indicated. B, Southern Blot analysis of genomic DNA (BglII restricted) of parental and transgenic eba-140 mutant parasites reveals that the plasmid has integrated into the eba-140 gene. The endogenous eba-140 hybridizing fragment of 8.5 kb disappears upon integration of the plasmid. The 4.9- and ~12-kb fragments in transgenic parasites are indicative for the replacement of the 3'-end of eba-140. Sizes of the hybridizing bands are shown in kb. C, schematic representation of the 3' replacement of the eba-181 gene by single crossover recombination of pHH1 constructs into the eba-181 locus. The position of the used restriction enzymes BglII, XhoI, and NcoI are marked. D, Southern blot analysis of genomic DNA (BglII, XhoI, and NcoI restricted) of parental and transgenic eba-181 mutant parasites reveals that the plasmid has integrated into the eba-181 gene. The endogenous eba-181 hybridizing fragment of 6.2 kb disappears upon integration of the plasmid. The 0.9-, 3.3-, and 3.8-kb fragments in the transgenic parasites are indicative for the replacement of the 3'-end of the eba-181 gene. E, schematic representation of the 3' replacement of the eba-175 gene by single crossover recombination of pHH1 constructs into the eba-175 locus. The position of the used restriction enzyme MfeI is marked. F, Southern blot analysis of genomic DNA (MfeI restricted) of parental and transgenic eba-175 mutant parasites reveals integration into the eba-175 gene. The endogenous eba-175 hybridizing fragment of ~10 kb disappears upon integration of the plasmid. The 2.2, 8.1, and ~13 kb in the transgenic parasites are indicative for the replacement of the 3'-end of the eba-175 gene.

 

    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Parasite Strains and TransfectionP. falciparum asexual stages were cultured in human 0+ erythrocytes according to standard procedures (35). W2mef is derived from the Indochina III/CDC strain. Parasites were transfected as described previously (36-38) with 100 µg of purified plasmid DNA (Qiagen) using ring stage cultures with 10% parasitemia. Positive selection for transfectants was achieved using 10 nM WR99210, an antifolate that selects for the presence of the human dhfr gene (39).

Nucleic Acids and Vector Constructions—cDNA coding for EBA-175, EBA-140, and EBA-181 was generated using total RNA of parasites in a reverse transcription reaction (Invitrogen) with specific oligonucleotides. Subsequently, the genes were PCR-amplified with Vent Polymerase (Stratagene) and sequenced to detect unwanted mutations. The following primers were used to amplify ~1 kb of the3'-ends of the eba-140, eba-175, and eba-181 genes with a 5' BamH1 and a 3' XhoI restriction site: EBA-140-S2447, GCGCAGATCTGTGGTGATGAAAGTTCAAG; EBA-140-AS3605, GCGCCTCGAGTTACATTCTAGATGCTGAACTC; EBA-181-S3713, GCGCAGATCTGTAGAACCTGTTGTA; EB-A-181-AS4629, GCGCCTCGAGTTACCTATAGCTGGCTGAACC; EBA-175-S3419, GCGCAGATCTAGGAAATGATACATCTGAAATGTCGC; EBA-175-AS4181, GCGCCTCGAGTCATGAAAAAGCCTCCTTTCTG.

PCR products were digested with BamHI and XhoI. Using the compatibility of the 5' overhangs of BglII and BamHI, the fragments were subsequently cloned into a BglII/XhoI pre-cut pHH1 transfection vector (29). Preparation of genomic DNA was performed as described previously (40). DNA sequencing was performed using BigDye Terminator Cycle Sequencing (PerkinElmer Life Sciences). Southern blotting was carried out using the Amersham Biosciences ECL Random-Prime Labeling and Detection System (GE Healthcare). In transgenic parasites mutation of the endogenous eba-140/175/181 gene was also analyzed by PCR amplification using a gene-specific primer binding upstream of the integration site and a primer that binds in the 3'-flanking region of the integrated transfection vector. These PCR products were cloned into TOPO-Vector (Invitrogen) and sequenced. For PCR amplification following primers were used: EBA-175-S3259, GAGAGGGAAGATGAGAGAACG; EBA-140-S1751, ATGGTGGGATGAAAACAAGG; EBA-181-S3275, GGGAGGTGAAAGTGCAACTG; pHH1-Pbdt-AS, CATGCATGTGCATGCAC.

To further analyze sequence requirements for microneme trafficking of EBA-175, "mini-genes" were constructed comprising different domain deletions and cloned into the pARL transfection vector (41). A multistep primer-directed mutagenesis strategy was used (42) to generate the different EBA-175 GFP fusions constructs (Fig. 3A, E1-E4). The final PCR products were digested with KpnI and AvrII (underlined) and cloned into pARL. GFP was previously inserted into the XhoI site of pARL1a- with an additional 5'-AvrII site (7). To establish stage-specific expression of the EBA-175 GFP fusion proteins, the crt (chloroquine resistance transporter) promoter in the pARL1a-transfection vector was exchanged with the stage specific ama-1 (apical membrane antigen-1) promoter (43). All eba-175 mini-genes were sequenced to confirm the desired composition and the absence of unwanted mutations.

Further, to analyze the effect of timing of expression on trafficking, the E2 fusion construct was also cloned into pARL1a-, using the original crt promoter. To generate the eba-175 minigenes, following primers were used: EBA-175-SP-S1, GCGCGGTACCATGAAATGTAATATTAGTATATATTTTTTTGCTTCC; EBA-175-SPCy-AS1, CTATCATTTCTGTTTTCATAAAGCACGTCTAAAAATTTTTC; EBA-175-SPTm-AS, CCTGCTCCTGCATAATATGGCATCACGTCTAAAAATTTTTC; EBA-175-Cy-S2, CTTTATGAAAACAGAAATGATAG; EBA-175-Cy-GFP-AS2, GCGCCCTAGGTGAAAAAGCCTCCTTTCTGAAACATGTATAAGATGG; EBA-175-TM-S3, ATGCCATATTATGCAGGAGCAGG; EBA-175-TM-GFPAS3, GCGCCCTAGGTGAAGCACCTAAAATAAC; EBA-175-CT-GFPAS4, GCGCCCTAGGTATCTTAAATTTAATATC.

Immunoblots and Immunofluorescence—For immunoblots, parasite proteins from a synchronized culture were separated on 10% SDS-PAGE gels and transferred onto nitrocellulose membranes (Schleicher & Schuell). Monoclonal anti-GFP (Roche Applied Science) was diluted 1:1000. The secondary antibodies were either sheep anti-rabbit or rabbit anti-mouse IgG horseradish peroxidase (Sigma) and used in a 1:5000 dilution. Immunoblots were developed by chemiluminescence using ECL (Amersham Biosciences International). For stage-specific immunoblots, synchronized parasites were harvested every 8 h throughout the erythrocytic life cycle. To ensure appropriate loading of parasite proteins rabbit anti-GRASP antibodies were used (7).

Immunofluorescence assays (IFAs) were performed with synchronized parasites as previously described (44, 45). Slides were incubated for 1 h with different antibody combinations: mouse anti-GFP (1:1000, Roche Applied Science), rabbit anti-EBA181 (1:1250, Ref. 31), rabbit anti-EBA175 (1:1250, Ref. 29), mouse anti-EBA140 (1:500, Ref. 30), rabbit anti-GRASP (1:1000, Ref. 7) mouse anti-MSP1 (1:1000, Ref. 46). Slides were washed three times for 10 min with 0.05% Tween 20/PBS and incubated for 1 h with Alexa 488 anti-mouse IgG antibodies (1:2000, Molecular Probes), Alexa-Fluor 594 goat anti-rabbit IgG antibodies (1:2000, Molecular Probes) and DAPI (1:2000, Roche Applied Science). Dual-color fluorescence images were captured using a Leica Axioskop 2 microscope and OpenLab software (Improvision Inc.). Green fluorescence of GFP expressing transgenic cell lines (late schizonts and free merozoites) was observed and captured in live cells using a Leica Axioskop 2 and OpenLab software (Improvision Inc.).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The C-terminal Domains of EBL Proteins Are Not Required for Micronemal Transport—The cytoplasmic domain of EBA-175 is not required for correct protein targeting, but it is essential for function (45). However, it has been shown that the cytoplasmic tail of type 1 transmembrane proteins in Apicomplexa contains sorting signals that are essential for subcellular trafficking (18-21, 47). Therefore, to determine the role of the cytoplasmic domain in protein sorting in P. falciparum, we constructed transgenic parasites that expressed truncated forms of the EBA-175 paralogues EBA-140 and EBA-181 without the cytoplasmic domain (Fig. 1, A and C). To exclude a putative role of the transmembrane domain in the sorting events we also generated parasites that expressed a truncated version of EBA-175 that lacked the transmembrane and cytoplasmic domain (Fig. 1E). This was achieved using constructs based on the transfection vector pHH1 (29) and allelic replacement (Fig. 1). Integration of the plasmids into the endogenous loci by single crossover recombination would allow expression of the mutated genes under the control of the endogenous promoter.

W2mef parasites were transfected with pHH1-175{Delta}82, pHH1-140{Delta}tail, and pHH1-181{Delta}tail and selected to obtain parasites that had integrated the plasmid via single crossover recombination to derive: EBA-140{Delta}tail, EBA-181{Delta}tail, and EBA-175{Delta}82 (Fig. 1, A, C, E). These cell lines expressed either mutant EBA-140 (lacking the C-terminal 55 amino acids comprising the cytoplasmic domain), mutant EBA-181 (lacking the cytoplasmic 57 amino acids) or EBA-175 (lacking the C-terminal 82 amino acids comprising the cytoplasmic and the transmembrane domain). To confirm that the plasmids had integrated, genomic DNA from parental W2mef and the transfected parasite lines was analyzed by PCR (data not shown) and probed with gene-specific fragments in Southern hybridization experiments. This confirmed that the plasmids had integrated into the expected locus by single crossover recombination (Fig. 1, B, D, and F).


Figure 2
View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 2.
Immunofluorescence localization of truncated EBA-140/181/175 protein in fixed transgenic parasites (schizonts and free merozoites). A, EBA-140{Delta}tail (EBA-140 without the cytoplasmic domain) can be localized within the micronemes by using anti-EBA140 antibodies (green) and anti-EBA175 antibodies (red). To visualize the precise localization of the mutated protein the two fluorescence photomicrographs were merged. The nucleus (blue) is stained with DAPI. B, EBA-181{Delta}tail (EBA-181 without the cytoplasmic domain) can be localized within the micronemes by using anti-EBA181 antibodies (green) and anti-EBA175 antibodies (red). C, EBA-175{Delta}82 (EBA-175 without the transmembrane and cytoplasmic domain) can be localized within the micronemes by using anti-EBA175 antibodies (red) and anti-EBA181 antibodies (green). s, schizont; m, merozoites.

 
To verify expression of the truncated proteins and analyze the effects on localization of EBL-proteins we used immunofluorescence microscopy in co-localization studies. Truncation of the cytoplasmic domain of both EBA-181 and EBA-140 does not interfere with microneme localization of either protein (Fig. 2, A and B). Both truncated proteins co-localize with the endogenous EBA-175 confirming that micronemal transport of EBL proteins is not reliant on sequence information within the cytoplasmic domain.

The transgenic parasite line EBA-175{Delta}82 expresses a mutant EBA-175 protein without cytoplasmic and transmembrane domain. Although this protein lacks any membrane attachment, it is still trafficked to the micronemes and co-localizes with the endogenous EBA-140 protein (Fig. 2C). Therefore, we conclude that neither the cytoplasmic tail nor the transmembrane region of the EBL proteins is required for correct trafficking to the miconemes. This is highly indicative that the information for the sorting of this protein family to its destination is located within the ectodomain.


Figure 3
View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 3.
Structural features and expression of EBA-175 GFP chimeric proteins in transgenic parasites. A, schematic domain structure of EBA-175 in comparison with the synthetic EBA-175 GFP fusion constructs. Signal peptide (SP): blue, 5'-cysteine-rich region (F1/F2): red, 3'-cysteine-rich region (3'cys): purple, transmembrane domain (TMD): gray, cytoplasmic domain (CPD): black, GFP: green. B, immunoblot using GFP specific antibodies on wild type (WT) and E1, E2, E3, and E4 GFP-expressing parasites. The antibody recognizes GFP fusion proteins according to their predicted size in the transgenic but not in the WT parasite line. E1, 48.5 kDa; E2, 40 kDa; E3, 37.5 kDa; E4, 31 kDa.

 
The 3'-Cysteine-rich Region of EBA-175 Directs Transport of GFP Fusion Proteins to the Micronemes—To determine the required elements for protein targeting to the micronemes, we generated parasites expressing a number of EBA-175 GFP chimeras (listed as E1-4, Fig. 3A). E1 includes the coding region for the EBA-175 signal peptide, the 3'-cysteine-rich region, the transmembrane and the cytoplasmic domain. E2 comprises the signal peptide and 3'cysteine-rich region of EBA-175. The E3 chimera consists of the signal peptide, the transmembrane and cytoplasmic domain. E4 encompasses only the signal peptide and transmembrane domain. These synthetic coding regions were N-terminally fused to GFP and transfected into parasites. To allow stage-specific expression, the ama1 promoter (48) was cloned into the pARL vector replacing the crt promoter (41). To confirm expression of EBA-175 GFP fusion proteins, Western blot analysis of synchronized late stage parasites (schizonts; 40-h postinvasion) was performed using anti-GFP antibodies. The antibodies recognized GFP fusion proteins corresponding to their expected sizes (Fig. 3B). The apparent molecular masses of the different GFP fusions are E1: 48.5, E2: 40, E3: 37.5, E4: 31. We determined localization of the EBA-175 GFP chimeric proteins either by fluorescence microscopy of live cells or indirect immunofluorescence of fixed parasites with appropriate antibodies in schizonts and free merozoites.

E1 and E2 display a very similar fluorescence distribution with the GFP fusion protein concentrated at the apical pole of the parasite (in late schizonts and free merozoites, Fig. 4, A and B). E1 and E2 co-localize with the microneme marker EBA-181 (Fig. 5, A and B, free merozoites). Therefore EBA-175 GFP can be expressed and trafficked to the micronemes independent of its membrane attachment. This is consistent with the deletion of the transmembrane domain in the endogenous gene by homologous recombination (Fig. 2C). Expression of these transgenes (E1 and E2) reveals some mistargeting of the GFP fusion proteins (Fig. 5E). This may be caused by either overexpression of the EBA-175 GFP fusion in an episomal context and/or slight differences in timing of expression given by the use of the ama-1 promoter versus the endogenous eba-175 promoter.

In contrast, the distribution of the GFP fusion protein in E3 and E4 parasites is drastically changed (Fig. 4, C and D). The fluorescence pattern in these cell lines is almost identical. It is confined to a perinuclear compartment with a small protrusion. This staining is reminiscent of the ER-Golgi compartment as previously reported for other GFP fusion proteins (7, 49, 50). E3 and E4 do not co-localize with the microneme marker EBA-181 (Fig. 5B and data not shown). By using antibodies against the parasite surface marker MSP-1 (46) surface localization of the GFP fusions was excluded (Fig. 5C). The partial co-localization with the Golgi marker PfGRASP (Golgi reassembly protein, Ref. 7) suggests retention of the protein within the ER/Golgi compartments (Fig. 5D). These data imply that targeting of EBL proteins to the micronemes requires a minimum of two features: a N-terminal hydrophobic signal peptide and the 3'-cysteine-rich region.

Stage-specific Expression Is Required for Microneme Trafficking—Micronemes are formed in schizont stages and proteins targeted to these organelles are expressed late in the parasites life cycle presumably to ensure correct localization as these structures develop (4, 8, 51, 52). Correct timing of expression as a prerequisite for protein sorting has been previously reported (43, 53). To visualize the effects of inappropriate expression of microneme-targeted proteins, we generated a transgenic cell line (E2crt) expressing EBA-175 GFP fusion using the crt 5'-region, a promoter that drives transcription also in ring and trophozoite stages. On a stage-specific Western-Blot anti-GFP antibodies recognized the expected 40 kDa fusion protein throughout the asexual life cycle (Fig. 6A). An additional smaller molecular weight band is detected presumably corresponding to GFP breakdown products described previously (54, 55). Using fluorescence microscopy of live cells it is evident that inappropriate expression of the micronemal-targeted GFP chimera (E2crt) leads to aggregation and mistargeting of the fusion protein to the parasitophorous vacuole (Fig. 6B and supplementary data). This is in contrast to expression of E2 in late schizonts under the control of the ama-1 promoter (Fig. 6C) where the GFP chimera is correctly targeted to the micronemes (Fig. 4B). Therefore correct subcellular localization of EBA-175 to the micronemes not only requires the appropriate transport signals but also accurate timing of expression. This is presumably caused by the absence of the appropriate sorting machinery (e.g. escorters) and predestinated organelles.


Figure 4
View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 4.
Localization of EBA-175 GFP by fluorescence microscopy in unfixed parasites. A and B, using fluorescence of the GFP reporter protein E1 and E2 distribution (green) is restricted to the apical pole within the parasite. The nucleus is stained with DAPI (blue). C and D, E3 and E4 (both proteins are lacking the 3'-cysteine-rich region) distribution (green) is confined to a perinuclear compartment and are not trafficked to the micronemes.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Rhoptries and micronemes of the malaria parasite mediate the exocytic release of proteins during invasion into the host cell. The delivery of these proteins via the secretory pathway to these specialized compartments and their controlled release during invasion is a fundamental prerequisite for successful entry into the host cell. Presumably the Golgi and the TGN of the parasite (4, 7, 10, 56, 57) are able to recognize and distribute these proteins to the different trafficking routes. We showed that the cytoplasmic domains of EBA-140 and EBA-181 do not mediate correct micronemal targeting (Fig. 2, A and B). This is in agreement with previous data for EBA-175 (45).

The transmembrane domain of type I membrane proteins is implicated in trafficking. For example, the transmembrane domain of the plant vacuolar receptor BP80 (proaleurain-binding protein of 80 kDa) is sufficient for targeting a chimeric protein to a lytic compartment in plants (58). GRA4, a dense granule (a secretory compartment) protein of T. gondii also requires a transmembrane domain for correct localization (59). In contrast, the directional transport of EBA-175 to the micronemes is independent of its membrane association. The conversion of the type I transmembrane protein EBA-175 to a luminal form does not interfere with micronemal protein sorting (Fig. 2C).

We have also shown that the N terminus of EBA-175 in combination with the luminal 3'-cysteine-rich region is sufficient to direct the GFP fusion protein to the micronemes (Figs. 4B and 5A). This is reminiscent of the soluble MIC3 protein (microneme protein 3) transport in T. gondii, where a cysteine-rich central region is essential for trafficking the protein from the secretory pathway to the micronemes (60). The expression of EBA-175 GFP without the 3'-cysteine-rich region (E3 and E4) abrogates micronemal targeting.

Although the precise function of the 3'-cysteine-rich region remains unclear, the observations provide insight into the molecular interaction of regulated secretory proteins during sorting. It implies that this conserved luminal region enables the protein to interact with the sorting machinery. This might be because of heterophilic and/or homophilic protein-protein interactions facilitating either specific interaction with an escorter and/or mediating protein aggregation. Heterophilic interactions such as association of the secretory protein with organelle-specific escorters are well established in mammals, plants, yeast, and protozoa (20, 61-66). Homophilic interaction like self-association in the luminal milieu of the secretory pathway is described as a means of segregating regulated from constitutive secretory proteins (67, 68). The deletion of the 3'-cysteine-rich region might disrupt the inherent aggregative properties of the fusion protein. Although the 3'-cysteine-rich region is conserved within the EBL-superfamily, other micronemal proteins such as AMA-1, MTRAP (merozoite-specific TRAP homologue, Ref. 69) or the SUB2 (subtilisin like protease, Ref. 70) do not possess distinct luminal cysteine-rich regions. This suggests that there may be multiple mechanisms and/or receptors for microneme targeting in the malaria parasite.

Expression of truncated, membrane bound EBA-175 chimeric proteins (E3, E4) results in the accumulation of the fusion protein within the ER/Golgi compartment (Fig. 4, C and D and Fig. 5, B-D). In the absence of any retrieval (e.g. C-terminal KDEL, (71)) or retention signals (72), it is likely that the accumulation of these transmembrane proteins is caused by the absence of any positive signals (the 3'-cysteine-rich region) for efficient recruitment into specific cargo vesicles. Additionally, E3 and E4 might represent misfolded fusion proteins exposing hydrophobic regions, and therefore are retained in the ER by quality control mechanisms (73-76).


Figure 5
View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 5.
Co-localization studies of the EBA-175 GFP fusion proteins. A,in E1 and E2 GFP fluorescence (green) and anti-EBA181 antibodies (red) show a similar staining pattern, restricted to the apical end of the parasite. The merged image shows co-localization of the two proteins. B, this is in contrast to E3 (and E4, data not shown). The GFP fusion protein (green) is not trafficked to the micronemes (anti-EBA181, red) and accumulates in a perinuclear compartment of the cell. C, using MSP-1-specific antibodies (red) distribution of E3 (green) is shown to be distinct from surface localization and (D) partially co-localizes with the Golgi marker GRASP (red). E, quantitative analysis of the GFP-expressing cell lines (E1-E4). For each transgenic parasite line 100 parasites were analyzed and the fluorescence pattern of the GFP-tagged proteins categorized in (I) parasitophorous vacuole (pv, light blue), (II) intermediate (yellow), (III) apical (red), and (IV) perinuclear localization (purple).

 


Figure 6
View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 6.
Comparison of EBA-175 GFP under the control of two different promoters and its effect on localization. A, E2crt is expressed under the control of the crt promoter. The crt promoter ensures expression of the transgene throughout the asexual life cycle (A1). Anti-GRASP antibodies were used as a loading control (A2). B, using the fluorescence of the GFP E2crt the protein can be visualized in all asexual parasite stages. The fusion protein appears to be localized in the parasitophorous vacuole. C, E2 expression controlled by the ama-1 promoter is restricted to late stages (C1, ≥40 h postinfection). Anti-GRASP antibodies were used as a loading control (C2). All samples were taken at 8-h intervals from synchronous parasite cultures (10% parasitemia).

 
In conclusion, the directional transport of microneme proteins is independent of the cytoplasmic and transmembrane domains. The conserved 3'-cysteine-rich region of EBA-175 can direct GFP fusion proteins into the micronemes given that stage-specific expression by an appropriate promoter occurs.


    FOOTNOTES
 
This article is based in part on doctoral studies by M. T., N. S. S., and S. H. in the Faculty of Biology, University of Hamburg.

* This study was supported in part by Grants from the Deutsche Forschungs-gemeinschaft (DFG, GI312), Fritz Prosiegel Stiftung and Australian Education International (AEI). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Formula The on-line version of this article (available at http://www.jbc.org) contains supplemental Fig. S1. Back

1 Supported by HHMI International Research Scholar Grants. Back

2 To whom correspondence should be addressed: Research Group Malaria II, Bernhard-Nocht-Institute for Tropical Medicine, Bernhard-Nocht-Strasse 74, 20359 Hamburg, Germany. Tel.: 49-0-40-42818-486; Fax: 49-0-40-42818-418; E-mail: gilberger{at}bni-hamburg.de.

3 The abbreviations used are: EBA, erythrocyte binding antigen; AMA-1, apical membrane antigen 1; BP80, 80-kDa proaleurain-binding protein; CRT, chloroquine resistance transporter; DBL, Duffy binding-like; ER, endoplasmic reticulum; GFP, green fluorescence protein; GRA4, 40-kDa granule protein; GRASP, Golgi reassembly protein; MSP-1, merozoite surface protein 1; MTRAP, merozoite TRAP homologue; PV, parasitophorous vacuole; SUB2, subtilisin-like protease 2, TGN, trans-Golgi network. Back


    ACKNOWLEDGMENTS
 
We thank Jake Baum, Otto Berninghausen, Andreas Krüger, Mathias Marti, Sushma Rathaur, Dave Richard, Tobias Spielmann, and Carsten Wrenger for critically reading the manuscript. Special thanks to Mike Blackman for providing antibodies directed against MSP-1.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Snow, R. W., Guerra, C. A., Noor, A. M., Myint, H. Y., and Hay, S. I. (2005) Nature 434, 214-217[CrossRef][Medline] [Order article via Infotrieve]
  2. Langreth, S. G., Jensen, J. B., Reese, R. T., and Trager, W. (1978) J. Protozool. 25, 443-452[Medline] [Order article via Infotrieve]
  3. Bannister, L. H., and Mitchell, G. H. (1995) Ann. Trop. Med. Parasitol. 89, 105-111[Medline] [Order article via Infotrieve]
  4. Bannister, L. H., Hopkins, J. M., Fowler, R. E., Krishna, S., and Mitchell, G. H. (2000) Parasitol. Today 16, 427-433[CrossRef][Medline] [Order article via Infotrieve]
  5. Cowman, A. F., and Crabb, B. S. (2006) Cell 124, 755-766[CrossRef][Medline] [Order article via Infotrieve]
  6. Przyborski, J. M., and Lanzer, M. (2005) Parasitology 130, 373-388[Medline] [Order article via Infotrieve]
  7. Struck, N. S., de Souza Diasqq, S., Langer, C., Marti, M., Pearce, J. A., Cowman, A. F., and Gilberger, T. W. (2005) J. Cell Sci. 118, 5603-5613[Abstract/Free Full Text]
  8. Margos, G., Bannister, L. H., Dluzewski, A. R., Hopkins, J., Williams, I. T., and Mitchell, G. H. (2004) Parasitology 129, 273-287[Medline] [Order article via Infotrieve]
  9. Marti, M., Baum, J., Rug, M., Tilley, L., and Cowman, A. F. (2005) J. Cell Biol. 171, 587-592[Abstract/Free Full Text]
  10. Haldar, K., and Holder, A. A. (1993) Semin. Cell Biol. 4, 345-353[CrossRef][Medline] [Order article via Infotrieve]
  11. Banting, G., Benting, J., and Lingelbach, K. (1995) Trends Cell Biol. 5, 340-343[CrossRef][Medline] [Order article via Infotrieve]
  12. von Heijne, G. (1988) Biochim. Biophys. Acta 947, 307-333[Medline] [Order article via Infotrieve]
  13. Burgess, T. L., and Kelly, R. B. (1987) Annu. Rev. Cell Biol. 3, 243-293[CrossRef][Medline] [Order article via Infotrieve]
  14. Bonifacino, J. S., and Traub, L. M. (2003) Ann. Rev. Biochem. 72, 395-447[CrossRef][Medline] [Order article via Infotrieve]
  15. Thiele, C., Gerdes, H. H., and Huttner, W. B. (1997) Curr. Biol. 7, R496-500[CrossRef][Medline] [Order article via Infotrieve]
  16. Williams, M. A., and Fukuda, M. (1990) J. Cell Biol. 111, 955-966[Abstract/Free Full Text]
  17. Keller, P., and Simons, K. (1997) J. Cell Sci. 110, 3001-3009[Abstract]
  18. Hoppe, H. C., Ngo, H. M., Yang, M., and Joiner, K. A. (2000) Nat Cell Biol. 2, 449-456[CrossRef][Medline] [Order article via Infotrieve]
  19. Karsten, V., Qi, H., Beckers, C. J., Reddy, A., Dubremetz, J. F., Webster, P., and Joiner, K. A. (1998) J. Cell Biol. 141, 1323-1333[Abstract/Free Full Text]
  20. Reiss, M., Viebig, N., Brecht, S., Fourmaux, M. N., Soete, M., Di Cristina, M., Dubremetz, J. F., and Soldati, D. (2001) J. Cell Biol. 152, 563-578[Abstract/Free Full Text]
  21. Di Cristina, M., Spaccapelo, R., Soldati, D., Bistoni, F., and Crisanti, A. (2000) Mol. Cell. Biol. 20, 7332-7341[Abstract/Free Full Text]
  22. Adams, J. H., Blair, P. L., Kaneko, O., and Peterson, D. S. (2001) Trends Parasitol 17, 297-299[CrossRef][Medline] [Order article via Infotrieve]
  23. Foth, B. J., Ralph, S. A., Tonkin, C. J., Struck, N. S., Fraunholz, M., Roos, D. S., Cowman, A. F., and McFadden, G. I. (2003) Science 299, 705-708[Abstract/Free Full Text]
  24. Hiller, N. L., Bhattacharjee, S., van Ooij, C., Liolios, K., Harrison, T., Lopez-Estrano, C., and Haldar, K. (2004) Science 306, 1934-1937[Abstract/Free Full Text]
  25. Marti, M., Good, R. T., Rug, M., Knuepfer, E., and Cowman, A. F. (2004) Science 306, 1930-1933[Abstract/Free Full Text]
  26. Sim, B. K., Chitnis, C. E., Wasniowska, K., Hadley, T. J., and Miller, L. H. (1994) Science 264, 1941-1944[Abstract/Free Full Text]
  27. Dolan, S. A., Proctor, J. L., Alling, D. W., Okubo, Y., Wellems, T. E., and Miller, L. H. (1994) Mol. Biochem. Parasitol 64, 55-63[CrossRef][Medline] [Order article via Infotrieve]
  28. Tolia, N. H., Enemark, E. J., Sim, B. K., and Joshua-Tor, L. (2005) Cell 122, 183-193[CrossRef][Medline] [Order article via Infotrieve]
  29. Reed, M. B., Caruana, S. R., Batchelor, A. H., Thompson, J. K., Crabb, B. S., and Cowman, A. F. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 7509-7514[Abstract/Free Full Text]
  30. Thompson, J. K., Triglia, T., Reed, M. B., and Cowman, A. F. (2001) Mol. Microbiol. 41, 47-58[CrossRef][Medline] [Order article via Infotrieve]
  31. Mayer, D. C., Kaneko, O., Hudson-Taylor, D. E., Reid, M. E., and Miller, L. M. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 5222-5227[Abstract/Free Full Text]
  32. Gilberger, T. W., Thompson, J. K., Triglia, T., Good, R. T., Duraisingh, M. T., and Cowman, A. F. (2003) J. Biol. Chem. 278, 14480-14486[Abstract/Free Full Text]
  33. Mayer, D. C., Mu, J. B., Kaneko, O., Duan, J., Su, X. Z., and Miller, L. H. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 2518-2523[Abstract/Free Full Text]
  34. Peterson, D. S., Miller, L. H., and Wellems, T. E. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7100-7104[Abstract/Free Full Text]
  35. Trager, W., and Jensen, J. B. (1976) Science 193, 673-675[Abstract/Free Full Text]
  36. Crabb, B. S., and Cowman, A. F. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7289-7294[Abstract/Free Full Text]
  37. Wu, Y., Kirkman, L. A., and Wellems, T. E. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 1130-1134[Abstract/Free Full Text]
  38. Fidock, D. A., and Wellems, T. E. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 10931-10936[Abstract/Free Full Text]
  39. Reed, M. B., Saliba, K. J., Caruana, S. R., Kirk, K., and Cowman, A. F. (2000) Nature 403, 906-909[CrossRef][Medline] [Order article via Infotrieve]
  40. Triglia, T., Wang, P., Sims, P. F., Hyde, J. E., and Cowman, A. F. (1998) EMBO J. 17, 3807-3815[CrossRef][Medline] [Order article via Infotrieve]
  41. Crabb, B. S., Rug, M., Gilberger, T. W., Thompson, J. K., Triglia, T., Maier, A. G., and Cowman, A. F. (2004) Methods Mol. Biol. 270, 263-276[Medline] [Order article via Infotrieve]
  42. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene (Amst.) 77, 51-59[CrossRef][Medline] [Order article via Infotrieve]
  43. Triglia, T., Healer, J., Caruana, S. R., Hodder, A. N., Anders, R. F., Crabb, B. S., and Cowman, A. F. (2000) Mol. Microbiol. 38, 706-718[CrossRef][Medline] [Order article via Infotrieve]
  44. Tonkin, C. J., van Dooren, G. G., Spurck, T. P., Struck, N. S., Good, R. T., Handman, E., Cowman, A. F., and McFadden, G. I. (2004) Mol. Biochem. Parasitol. 137, 13-21[CrossRef][Medline] [Order article via Infotrieve]
  45. Gilberger, T. W., Thompson, J. K., Reed, M. B., Good, R. T., and Cowman, A. F. (2003) J. Cell Biol. 162, 317-327[Abstract/Free Full Text]
  46. Howell, S. A., Well, I., Fleck, S. L., Kettleborough, C., Collins, C. R., and Blackman, M. J. (2003) J. Biol. Chem. 278, 23890-23898[Abstract/Free Full Text]
  47. Joiner, K. A., and Roos, D. S. (2002) J. Cell Biol. 157, 557-563[Abstract/Free Full Text]
  48. Healer, J., Murphy, V., Hodder, A. N., Masciantonio, R., Gemmill, A. W., Anders, R. F., Cowman, A. F., and Batchelor, A. (2004) Mol. Microbiol. 52, 159-168[CrossRef][Medline] [Order article via Infotrieve]
  49. Przyborski, J. M., Miller, S. K., Pfahler, J. M., Henrich, P. P., Rohrbach, P., Crabb, B. S., and Lanzer, M. (2005) EMBO J. 24, 2306-2317[CrossRef][Medline] [Order article via Infotrieve]
  50. van Dooren, G. G., Marti, M., Tonkin, C. J., Stimmler, L. M., Cowman, A. F., and McFadden, G. I. (2005) Mol. Microbiol. 57, 405-419[CrossRef][Medline] [Order article via Infotrieve]
  51. Bannister, L. H., Hopkins, J. M., Dluzewski, A. R., Margos, G., Williams, I. T., Blackman, M. J., Kocken, C. H., Thomas, A. W., and Mitchell, G. H. (2003) J. Cell Sci. 116, 3825-3834[Abstract/Free Full Text]
  52. Bozdech, Z., Zhu, J., Joachimiak, M. P., Cohen, F. E., Pulliam, B., and DeRisi, J. L. (2003) Genome Biol. 4, R9[CrossRef][Medline] [Order article via Infotrieve]
  53. Kocken, C. H., van der Wel, A. M., Dubbeld, M. A., Narum, D. L., van de Rijke, F. M., van Gemert, G. J., van der Linde, X., Bannister, L. H., Janse, C., Waters, A. P., and Thomas, A. W. (1998) J. Biol. Chem. 273, 15119-15124[Abstract/Free Full Text]
  54. Wickham, M. E., Rug, M., Ralph, S. A., Klonis, N., McFadden, G. I., Tilley, L., and Cowman, A. F. (2001) EMBO J. 20, 5636-5649[CrossRef][Medline] [Order article via Infotrieve]
  55. Waller, R. F., Reed, M. B., Cowman, A. F., and McFadden, G. I. (2000) EMBO J. 19, 1794-1802[CrossRef][Medline] [Order article via Infotrieve]
  56. Taraschi, T. F., Trelka, D., Schneider, T., and Matthews, I. (1998) Exp. Parasitol. 88, 184-193[CrossRef][Medline] [Order article via Infotrieve]
  57. Noe, A. R., Fishkind, D. J., and Adams, J. H. (2000) Mol. Biochem. Parasitol. 108, 169-185[CrossRef][Medline] [Order article via Infotrieve]
  58. Jiang, L., and Rogers, J. C. (1998) J. Cell Biol. 143, 1183-1199[Abstract/Free Full Text]
  59. Karsten, V., Hegde, R. S., Sinai, A. P., Yang, M., and Joiner, K. A. (2004) J. Biol. Chem. 279, 26052-26057[Abstract/Free Full Text]
  60. Striepen, B., Soldati, D., Garcia-Reguet, N., Dubremetz, J. F., and Roos, D. S. (2001) Mol. Biochem. Parasitol. 113, 45-53[CrossRef][Medline] [Order article via Infotrieve]
  61. Sato, K., and Nakano, A. (2003) Mol. Biol. Cell 14, 3055-3063[Abstract/Free Full Text]
  62. Lefrancois, S., Zeng, J., Hassan, A. J., Canuel, M., and Morales, C. R. (2003) EMBO J. 22, 6430-6437[CrossRef][Medline] [Order article via Infotrieve]
  63. Humair, D., Hernandez Felipe, D., Neuhaus, J. M., and Paris, N. (2001) Plant Cell 13, 781-792[Abstract/Free Full Text]
  64. Deloche, O., Yeung, B. G., Payne, G. S., and Schekman, R. (2001) Mol. Biol. Cell 12, 475-485[Abstract/Free Full Text]
  65. Meissner, M., Reiss, M., Viebig, N., Carruthers, V. B., Toursel, C., Tomavo, S., Ajioka, J. W., and Soldati, D. (2002) J. Cell Sci. 115, 563-574[Abstract/Free Full Text]
  66. Topolska, A. E., Lidgett, A., Truman, D., Fujioka, H., and Coppel, R. L. (2004) J. Biol. Chem. 279, 4648-4656[Abstract/Free Full Text]
  67. Chanat, E., and Huttner, W. B. (1991) J. Cell Biol. 115, 1505-1519[Abstract/Free Full Text]
  68. Robinson, D. G., Oliviusson, P., and Hinz, G. (2005) Traffic 6, 615-625[CrossRef][Medline] [Order article via Infotrieve]
  69. Baum, J., Richard, D., Healer, J., Rug, M., Krnajski, Z., Gilberger, T. W., Green, J. L., Holder, A. A., and Cowman, A. F. (2006) J. Biol. Chem. 281, 5197-5208[Abstract/Free Full Text]
  70. Harris, P. K., Yeoh, S., Dluzewski, A. R., O'Donnell, R. A., Withers-Martinez, C., Hackett, F., Bannister, L. H., Mitchell, G. H., and Blackman, M. J. (2005) PLoS Pathog. 1, 241-251[Medline] [Order article via Infotrieve]
  71. Teasdale, R. D., and Jackson, M. R. (1996) Annu. Rev. Cell Dev. Biol. 12, 27-54[CrossRef][Medline] [Order article via Infotrieve]
  72. Sonnichsen, B., Fullekrug, J., Nguyen Van, P., Diekmann, W., Robinson, D. G., and Mieskes, G. (1994) J. Cell Sci. 107, 2705-2717[Abstract]
  73. Arvan, P., Zhao, X., Ramos-Castaneda, J., and Chang, A. (2002) Traffic 3, 771-780[CrossRef][Medline] [Order article via Infotrieve]
  74. Ellgaard, L., Molinari, M., and Helenius, A. (1999) Science 286, 1882-1888[Abstract/Free Full Text]
  75. Nehls, S., Snapp, E. L., Cole, N. B., Zaal, K. J., Kenworthy, A. K., Roberts, T. H., Ellenberg, J., Presley, J. F., Siggia, E., and Lippincott-Schwartz, J. (2000) Nat. Cell Biol. 2, 288-295[CrossRef][Medline] [Order article via Infotrieve]
  76. Vashist, S., Kim, W., Belden, W. J., Spear, E. D., Barlowe, C., and Ng, D. T. (2001) J. Cell Biol. 155, 355-368[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Otsuki, O. Kaneko, A. Thongkukiatkul, M. Tachibana, H. Iriko, S. Takeo, T. Tsuboi, and M. Torii
Single amino acid substitution in Plasmodium yoelii erythrocyte ligand determines its localization and controls parasite virulence
PNAS, April 28, 2009; 106(17): 7167 - 7172.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. Haase, A. Cabrera, C. Langer, M. Treeck, N. Struck, S. Herrmann, P. W. Jansen, I. Bruchhaus, A. Bachmann, S. Dias, et al.
Characterization of a Conserved Rhoptry-Associated Leucine Zipper-Like Protein in the Malaria Parasite Plasmodium falciparum
Infect. Immun., March 1, 2008; 76(3): 879 - 887.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Singh, M. Plassmeyer, D. Gaur, and L. H. Miller
Mononeme: A new secretory organelle in Plasmodium falciparum merozoites identified by localization of rhomboid-1 protease
PNAS, December 11, 2007; 104(50): 20043 - 20048.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
281/42/31995    most recent
M606717200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Treeck, M.
Right arrow Articles by Gilberger, T. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Treeck, M.
Right arrow Articles by Gilberger, T. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement