Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M608052200 on September 12, 2006

J. Biol. Chem., Vol. 281, Issue 45, 34258-34268, November 10, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/45/34258    most recent
M608052200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garza-Sánchez, F.
Right arrow Articles by Hayes, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garza-Sánchez, F.
Right arrow Articles by Hayes, C. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Prolyl-tRNAPro in the A-site of SecM-arrested Ribosomes Inhibits the Recruitment of Transfer-messenger RNA*

Fernando Garza-Sánchez1, Brian D. Janssen1, and Christopher S. Hayes2

From the Department of Molecular, Cellular, and Developmental Biology, University of California, Santa Barbara, California 93106

Received for publication, August 22, 2006 , and in revised form, September 7, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Translational pausing can lead to cleavage of the A-site codon and facilitate recruitment of the transfer-messenger RNA (tmRNA) (SsrA) quality control system to distressed ribosomes. We asked whether aminoacyl-tRNA binding site (A-site) mRNA cleavage occurs during regulatory translational pausing using the Escherichia coli SecM-mediated ribosome arrest as a model. We find that SecM ribosome arrest does not elicit efficient A-site cleavage, but instead allows degradation of downstream mRNA to the 3'-edge of the arrested ribosome. Characterization of SecM-arrested ribosomes shows the nascent peptide is covalently linked via glycine 165 to Formula in the peptidyl-tRNA binding site, and Formula is bound to the A-site. Although A-site-cleaved mRNAs were not detected, tmRNA-mediated ssrA tagging after SecM glycine 165 was observed. This tmRNA activity results from sequestration of Formula on overexpressed SecM-arrested ribosomes, which produces a second population of stalled ribosomes with unoccupied A-sites. Indeed, compensatory overexpression of Formula readily inhibits ssrA tagging after glycine 165, but has no effect on the duration of SecM ribosome arrest. We conclude that, under physiological conditions, the architecture of SecM-arrested ribosomes allows regulated translational pausing without interference from A-site cleavage or tmRNA activities. Moreover, it seems likely that A-site mRNA cleavage is generally avoided or inhibited during regulated ribosome pauses.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
A-site3 mRNA cleavage is a novel RNase activity that acts on A-site codons within paused ribosomes. Ehrenberg, Gerdes and their colleagues (1) first demonstrated that Escherichia coli RelE protein causes cleavage of A-site mRNA in vitro. Subsequently, A-site cleavage was also shown to occur at stop codons during inefficient translation termination in cells that lack RelE and related proteins (2, 3). The latter finding indicates that another unknown A-site nuclease also exists in E. coli. Indeed, it is possible the ribosome itself catalyzes A-site cleavage. The molecular requirements for A-site cleavage are incompletely understood, but an unoccupied ribosome A site appears to be important for both RelE-dependent and RelE-independent nuclease activity (1, 2).

A-site nuclease activity truncates mRNAs and produces stalled ribosomes that are unable to continue standard translation. In bacteria, ribosomes stalled at the 3' termini of such truncated messages are "rescued" by the tmRNA quality control system. tmRNA is a specialized RNA that acts first as a tRNA to bind the A-site of stalled ribosomes, and then as an mRNA to direct the addition of the ssrA peptide degradation tag to the C terminus of the nascent polypeptide (4, 5). As a result of tmRNA activity, incompletely synthesized proteins are targeted for proteolysis and stalled ribosomes undergo normal translation termination and recycling (5). In this manner, A-site mRNA cleavage and tmRNA work together as a translational quality control system that responds to paused and stalled ribosomes.

Although a paused ribosome can be a manifestation of translational difficulty, translational pausing is also used to control and regulate protein synthesis. In many instances, the newly synthesized nascent peptide inhibits either translation elongation or termination (6, 7). A recently described example is the SecM-mediated ribosome arrest, which controls expression of SecA protein from the secM-secA mRNA in E. coli (8). The SecM nascent peptide interacts with the ribosome exit channel to elicit a site-specific ribosome arrest (9). The SecM-stalled ribosome is postulated to disrupt a downstream mRNA secondary structure that sequesters the secA ribosome binding site (9, 10). Thus, efficient initiation of secA translation depends upon ribosome pausing at the upstream secM open reading frame (11). SecM-mediated ribosome pausing is regulated in turn by the activity of SecA protein. SecM is secreted co-translationally by the general Sec machinery, which is powered in part by the SecA ATPase (12). It is thought that the mechanical pulling force exerted by SecA on the SecM nascent chain during secretion alleviates the ribosome arrest and allows translation to continue (13, 14). This intriguing regulatory circuit allows the cell to monitor protein secretion activity via ribosome pausing and adjust SecA synthesis accordingly.

One outstanding question is how A-site cleavage and tmRNA activities affect regulatory translational pauses such as the SecM-mediated ribosome arrest. If all paused ribosomes are subject to A-site cleavage, then this nuclease activity would be expected to interfere with SecA regulation. The experiments presented in this paper demonstrate that A-site mRNA cleavage and the tmRNA quality control system do not significantly affect SecM-mediated ribosome arrest. Two recent reports have demonstrated that the A-site of SecM-arrested ribosomes is filled with tRNA (15, 16). The cryo-EM structure from Frank and colleagues (15) shows that ~40% of SecM-arrested ribosomes contain a fully accommodated A-site tRNA. Ito and colleagues (16) have recently analyzed SecM-arrested ribosomes prepared by in vitro translation and concluded that the A-site tRNA is a prolyl-tRNAPro. In our analysis of SecM-arrested ribosomes in vivo, we also find that the P- and A-sites of the SecM-arrested ribosome are occupied with peptidyl- and aminoacyl-tRNAs, respectively. Additionally, we show that the occupied A-site prevents tmRNA recruitment during ribosome arrest and may also inhibit A-site mRNA cleavage. Thus, regulation by SecM ribosome arrest is able to operate efficiently in the presence of quality control systems that alleviate ribosome stalling.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial Strains and Plasmids—Table 1 lists the bacterial strains and plasmids used in this study. All bacterial strains were derivatives of E. coli strain X90 (17). Strain CH12 (X90(DE3)) was generated using the Novagen (DE3) {lambda} lysogen kit according to the manufacturer's instructions. Strain CH2198 (X90 ssrA(his6)(DE3)) was obtained by introducing the ssrA(His6) allele (18) of tmRNA into the ssrA chromosomal locus using the phage {lambda} Red recombination method with minor modifications (17, 19). The same method was used to delete the rna (encoding RNase I), rnb (encoding RNase II), and pnp (encoding PNPase) genes. The rnr::kan disruption and the strain expressing truncated RNase E have been described previously (2, 20). All gene disruptions and deletions were introduced into strain CH113 by phage P1-mediated transduction. The kanamycin resistance cassette was removed from strain CH113 {Delta}rnb::kan using FLP recombinase as described (19), allowing construction of the {Delta}rnb rnr::kan double mutant. Lac- strains of X90 and X90 ssrA::cat were obtained by curing the strain of the F' episome as described (17). The details of all strain constructions are available upon request.


View this table:
[in this window]
[in a new window]
  		TABLE 1
Bacterial strains and plasmids

 
Plasmid pFG21b is a modified version of plasmid pET21d (Novagen), which encodes a FLAG peptide epitope between NcoI and NdeI restriction sites. Plasmid pFG21b allows the production of N-terminal FLAG-tagged proteins, provided the initiation Met codon is engineered into an NdeI restriction site. All expression plasmids were derived from plasmid pFG21b, with the exception of the LacZ translational fusions, which were constructed using a derivative of pTrc99a (GE Healthcare). Fragments containing secMA' were obtained by PCR using oligonucleotide primers containing restriction endonuclease sites (underlined residues). The secMA' fragment was amplified from E. coli genomic DNA with oligonucleotides secM-Nde (5'-GGATGGCAATCATATGAGTGGAATACTGACGCGCTGG), and secA-Bam (5'-CCGGGATCCGATTTTCCAGCACTTCGCC). The ({Delta}ss)secMA' fragment was generated with the secA-Bam primer and secM-A38 (5'-CCTGCGCTCAGCCATATGGCCGAACCAAACGCGCCCGC). The PCR products were digested with NdeI and BamHI and ligated to plasmid pFG21b. The mutation changing SecM residue proline 166 to alanine was made using primer secM-P166A (5'-CCGTGCTGGCGCTCAACGCCTCACC) in combination with primers secA-Bam and secM-A38 by the PCR megaprimer method (21). LacZ translational fusions were made in two steps: (i) ligation of the various secMA' NdeI/BamHI fragments into plasmid pTrc3 followed by, (ii) ligation of a BamHI/HindIII fragment containing the E. coli lacZ gene. The lacZ fragment was produced by PCR using primers, lacZ-Bam (5'-AGGGATCCAAATGATTACGGATTCACTGGCCGTCG) and lacZ-Hind (5'-GGATAAGCTTACGCGAAATACGGGCAGACATGGC).

Plasmid pTrxA-SecM'-TrxA was constructed from pFG21b in three steps. Two distinct trxA-containing PCR products were generated: the first from primers trxA-Nde (5'-GTGGAGTTACATATGAGCGATAAAATTATTCACC) and trxA-Bam (5'-AAATGGATCCCCGCCAGGTTAGCGTCGAGGAACTC); and the second from primers trxA-Eco (5'-ATAGAATTCCGATAAAATTCACCTGACTGACGAC) and trxA-Xho (5'-GAACTCGAGATTCCCTTACGCCAGGTTAGCGTCG). The two trxA PCR fragments were sequentially ligated into pFG21b using NdeI/BamHI and EcoRI/XhoI digestions to generate plasmid pTrx-Trx. The oligonucleotides ts't-top (5'-GATCCAATTCAGCACGCCCGTCTGGATAAGCCAGGCGCAAGGCATCCGTGCTGGCCCTCAG) and ts't-bottom (5'-AATTCTGAGGGCCAGCACGGATGCCTTGCGCCTGGCTTATCCAGACGGGCGTGCTGAATTG) were annealed to one another and ligated to BamHI/EcoRI-digested plasmid pTrx-Trx to generate pTrx-SecM'-Trx. Similarly, pSecM' was generated by annealing secM'-top (5'-TATGCAATTCAGCACGCCGGTCTGGATAAGCCAGGCGCAAGGAATCCGTGCTGGCCCTCAAAAG) and secM'-bottom (5'-AATTCTTTTGAGGGCCAGCACGGATTCCTTGCGCCTGGCTTATCCAGACCGGCGTGCTGAATTGCA) followed by ligation to NdeI/EcoRI-digested pFG21b. The Formula overexpression plasmid was constructed by amplifying the proL gene and its promoter with primers proL-Sac (5'-CTGGAGCTCAACAATAACGGTAAATACC), and proL-Kpn (5'-AGCGGTACCTTGTCAGTCAGCTATGG) followed by ligation of the resulting PCR product into SacI/KpnI-digested plasmid pCH405{Delta} (2, 17).

mRNA Expression and RNA Analysis—E. coli strains were grown overnight at 37 °C in LB medium supplemented with the appropriate antibiotics (150 µg/ml of ampicillin, 25 µg/ml of tetracycline, or 50 µg/ml of kanamycin). The next day, cells were resuspended at an optical density at 600 nm (A600) of 0.05 in 15 ml of fresh medium and grown at 37 °C with aeration. Once cultures reached an A600 of ~0.3, mRNA expression was induced with isopropyl beta-D-thiogalactopyranoside (1.5 mM). After further incubation for 30 min, 15 ml of ice-cold methanol was added to the cultures, the cells collected by centrifugation, and the cell pellets frozen at -80 °C. Total RNA was extracted from cell pellets using 1.0 ml of a solution containing 0.6 M ammonium isothiocyanate, 2 M guanidinium isothiocyanate, 0.1 M sodium acetate (pH 4.0), 5% glycerol, 40% phenol. The disrupted cell suspension was extracted with 0.2 ml of chloroform, the aqueous phase removed and added to an equal volume of isopropyl alcohol to precipitate total RNA. RNA pellets were washed once with ice-cold 75% ethanol and dissolved in either 10 mM Tris-HCl (pH 7.5), 1 mM EDTA or 10 mM sodium acetate (pH 5.2), 1 mM EDTA.

Northern blot and S1 nuclease protection analyses of all mRNAs were performed as described (2). Northern blot analysis to identify the nascent peptidyl-tRNA species was performed using acid urea gels as described (22) with modifications. Total RNA (10 µg) was separated on 50% urea, 100 mM sodium acetate (pH 5.2), 1 mM EDTA, 6% polyacrylamide gels run at 4 °C. Gels were briefly soaked in 0.5 x Tris borate-EDTA (TBE) buffer before electroblotting (250 mA) to positively charged nylon membrane in 0.5 x TBE for 1 h at 4 °C. All subsequent Northern hybridization conditions were as described (2). The following radiolabeled DNA oligonucleotide probes were used in hybridizations: proL for Formula (5'-CACCCCATGACGGTGCG); proK for Formula (5'-CTTCGTCCCGAACGAAGTG); glyV for Formula (5'-CTTGGCAAGGTCGTGCT); argQ for Formula (5'-CCTCCGACCGCTCGGTTCG); and RBS for pET-derived ribosome binding site (5'-GTATATCTCCTTCTTAAAGTTAAAC). The following radiolabeled DNA oligonucleotides were used as probes for S1 nuclease protection experiments: secM S1 probe (5'-TTAATAAAATGAAGTAAAGGTTTATTGTTGTTAGGTGAGGCGTTGAGGGCCAGCACGGATGCCTTGCGCCTGGCTTATCC) and secM'-trxA S1 probe (5'-CTGTCGTCAGTCAGGTGAATTTTATCGGAATTCTGAGGGCCAGCACGGATGCCTTGCGCCTGGCTTATCCAG).

SecM Expression and Protein Analysis—Strains were cultured as described above for RNA analysis. Protein extraction and Western blot analyses were conducted as described (17). Anti-His6 polyclonal antibodies were obtained from Santa Cruz Biochemical. Monoclonal antibodies specific for E. coli beta-galactosidase and the FLAG M2 epitope were obtained from Sigma. SsrA(His6)-tagged SecM proteins were purified by Ni2+-NTA agarose (Qiagen) affinity chromatography as described (17, 18). Ni2+-NTA purified protein was further purified by reverse phase HPLC. N-terminal gas-phase sequencing was performed on a Porton 2020 protein sequencer (Beckman-Coulter) with a dedicated in-line HPLC (model 2090) for separation of phenylthiohydantoin derivatives. Molecular masses were determined by liquid chromatography mass spectrometry. Samples were applied to a Zorbax 300SB-C18 reverse phase column in aqueous 0.1% formic acid and proteins eluted using a linear gradient of acetonitrile using an Agilent 1100 LC nano-system. Eluted proteins were infused into a Waters Q-Tof IITM mass spectrometer for ionization.

beta-Galactosidase assays were conducted essentially as described (23). Strains expressing secA'::lacZ translational fusions were inoculated at A600 of 0.05 in LB medium and grown at 37 °C with aeration to A600 of 0.3-0.6. beta-Galactosidase activity for each construct was measured from 5 to 8 independent cultures and reported as mean ± S.D.

Cell Extract Fractionation—Strains CH12 {Delta}rna::kan and CH113 {Delta}rna::kan containing plasmid pSecM' or pSecM'-(P166A) were grown in 1 liter of LB media at 37 °C with aeration in Fernbach flasks. At A600 ~ 0.6, SecM' expression was induced by the addition of isopropyl beta-D-thiogalactopyranoside to 1.5 mM and cultures incubated for 1 h at 37 °C with aeration. Cultures were harvested over ice, the cells were collected by centrifugation and washed once with cold, high-Mg2+ S30 buffer (60 mM potassium acetate, 30 mM magnesium acetate, 0.2 mM EDTA, 10 mM Tris acetate (pH 7.0)). Washed bacterial pellets were resuspended in 10 ml of cold high-Mg2+ S30 buffer and the cells were broken by one passage through a French press at 12,000 p.s.i. Cell lysates were cleared by centrifugation at 30,000 x g for 15 min at 4 °C, and the supernatants layered onto cushions of cold high-Mg2+ S30 buffer containing 1.1 M sucrose in ultracentrifuge tubes (Beckman number 344057). Samples were centrifuged in a Beckman-Coulter OptimaTM ultracentrifuge at 45,000 x g for 1 h at 4 °C using an MLS-50 rotor. Total RNA was extracted from the high-speed supernatants and pellets for analysis as described above.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
SecM Ribosome Arrest Leads to mRNA Cleavage—To determine whether SecM-mediated ribosome arrest leads to A-site cleavage, we generated plasmids to express mRNA encoding SecM and the first 62 residues of SecA (Fig. 1A). Three SecM variants were used throughout this work: (i) FLAG-SecM, which is the wild-type protein fused to an N-terminal FLAG epitope tag; (ii) FLAG-({Delta}ss)SecM, which lacks the secretion signal sequence ({Delta}ss = deleted signal sequence; residues 1-37); and (iii) FLAG-({Delta}ss-P166A)SecM, which lacks the signal sequence and has alanine in place of proline 166. Deletion of the SecM signal sequence prevents its secretion and leads to a pro-found ribosome arrest, whereas the P166A variant completely abrogates arrest (9, 14). The FLAG sequence was added to facilitate analysis of SecM proteins by Western blot. However, secretion of FLAG-SecM protein resulted in the removal of the FLAG epitope along with the signal sequence (see below).


Figure 1
View larger version (61K):
[in this window]
[in a new window]
  		FIGURE 1.
SecM ribosome arrest leads to mRNA cleavage. A, secMA' mRNA variants are shown with the FLAG epitope, signal sequence, and oligonucleotide probe binding sites indicated. SecM residues glycine 165 to threonine 170 and the encoding mRNA sequence are shown, as is the complementary sequence of the S1 nuclease probe and the 3' terminus of the truncated in vitro transcripts used. The position of the P166A alteration is indicated by (Ala). Arrows indicate the positions of HphI and Sau96I restriction endonuclease cleavages in the S1 probe used to generate gel migration standards. B, Northern blot of secMA' mRNAs purified from tmRNA+ and {Delta}tmRNA cells. The positions of full-length and truncated flag-({Delta}ss)secMA' mRNA are indicated. Both in vitro transcripts were truncated after the second nucleotide of the glutamine 167 codon. C, S1 nuclease protection map of truncated secMA' mRNAs. Cleavages were detected in the secM stop codon and at positions 1-4 nucleotides downstream. No S1 protection was detected with RNA purified from a strain that had not been induced with isopropyl beta-D-thiogalactopyranoside (IPTG). Truncated and full-length transcripts were produced by in vitro transcription and analyzed by S1 nuclease protection. The HphI and Sau96I oligonucleotide standards were generated by annealing the 3'-labeled S1 probe to a complementary DNA oligonucleotide followed by digestion with the appropriate endonucleases.

 
Each SecM protein was expressed in wild-type cells (tmRNA+) and cells that lack tmRNA ({Delta}tmRNA), and the corresponding messages examined by Northern blot analysis using a probe specific for the ribosome binding site upstream of secM. In addition to the full-length mRNAs, truncated flag-secMA' and flag-({Delta}ss)secMA' messages were also detected (Fig. 1B). The truncated mRNAs did not hybridize to a probe specific for the downstream secA sequence (data not shown). No truncated flag-({Delta}ss-P166A)secMA' mRNA was apparent, suggesting that ribosome arrest was required for mRNA cleavage. Interestingly, steady state levels of truncated flag-secMA' and flag-({Delta}ss)secMA' mRNAs were similar in wild-type and {Delta}tmRNA cells (Fig. 1B). This finding was noteworthy because tmRNA activity usually promotes rapid degradation of truncated mRNAs, including those produced by A-site mRNA cleavage (2, 3, 24). Moreover, the truncated mRNAs appeared to be somewhat larger than in vitro transcripts that terminate in the codon for glutamine 167, a position that is adjacent to the A-site of the arrested ribosome (Fig. 1, A and B) (16).

The 3' ends of the truncated messages were mapped more precisely using S1 nuclease protection analysis. The termini were somewhat heterogeneous but strong cleavage was detected inside and adjacent to the secM stop codon (Fig. 1C). No cleavages were detected in the codon for glutamine 167, which would have produced an S1 protection pattern similar to that observed with the truncated control in vitro transcript (Fig. 1C, truncated lane). As suggested by the Northern analysis described above, mRNA cleavage occurred ~13 to 19 nucleotides downstream of the predicted A-site codon during SecM ribosome arrest.


Figure 2
View larger version (59K):
[in this window]
[in a new window]
  		FIGURE 2.
mRNA cleavage is modified in cells lacking 3' -> 5' exoribonucleases. A, RNA sequences of flag-({Delta}ss)secMA' and flag-trxA-secM'-trxA messages near the observed cleavage sites are shown with the encoded protein sequences. Downward arrows indicate the position and relative intensity of mRNA cleavage as determined by S1 nuclease protection analyses shown in panel B and Fig. 1C. Numerical position is reported with respect to the codon corresponding to SecM proline 166, where position +1 is the first nucleotide of the codon corresponding to SecM glutamine 167. Downward arrows labeled DdeI, EcoRI, and Sau96I indicate mRNA cleavage sites corresponding to the migration positions of S1 oligonucleotide probe standards. B, S1 nuclease protection analysis of flag-trxA-secM'-trxA mRNA purified from cells lacking 3' -> 5' exoribonucleases. Gene deletions and disruptions were constructed as described under "Experimental Procedures." Positions +13 and +19 downstream of the codon corresponding to SecM proline 166 are indicated. The DdeI, EcoRI, and Sau96I oligonucleotide standards were generated by annealing the labeled S1 probe to a complementary DNA oligonucleotide followed by digestion with the appropriate endonucleases. IPTG, isopropyl beta-D-thiogalactopyranoside.

 
3' -> 5' Exonucleases Generate Truncated secM mRNA during Ribosome Arrest—Two models account for ribosome arrest-dependent cleavage at the secM stop codon: (i) A-site cleavage due to inefficient translation termination as originally described in Refs. 2 and 3, or (ii) exonucleolytic trimming of downstream mRNA to the 3' margin of the arrested ribosome. To differentiate between these possibilities, we fused secM codons 150-166 in-frame between two thioredoxin genes (trxA). The encoded FLAG-TrxA-SecM'-TrxA fusion protein contained the minimal SecM peptide motif (150FST-PVWISQAQGIRAGP166) sufficient for ribosome arrest (9). However, in contrast to the wild-type secM gene, the flag-trxA-secM'-trxA stop codon is positioned several hundred nucleotides downstream of the predicted ribosome arrest site (21).

Northern analysis of flag-trxA-secM'-trxA mRNA also showed ribosome arrest-dependent truncated messages (data not shown), and S1 nuclease protection analysis detected two prominent cleavage sites at 13 and 19 nucleotides downstream of the proline 166 codon (wild-type SecM numbering) (Fig. 2B, wild-type lane). The cleavages were the same distance from the proline 166 codon as was observed with flag-secMA' and flag-({Delta}ss)secMA' mRNAs (Figs. 1C and 2A). Although the cleavage patterns were not strictly identical between truncated messages, the secM stop codon was clearly not required for mRNA cleavage.

We reasoned that if ribosome arrest-dependent mRNA cleavage was due to exonuclease activity, then cleavage could be modulated by deletion of known 3' -> 5' exoribonucleases. Fig. 2B shows the effects of specific exoribonuclease deletions on mRNA cleavage using the flag-trxA-secM'-trxA message. Deletion of RNase R leads to an increase in the +19 cleavage product and a decrease in the +13 cleavage product compared with wild-type (Fig. 2B). Similarly, removing polynucleotide phosphorylase (PNPase) activity also lead to increased levels of the +19 product (Fig. 2B). In contrast, there was a slight decrease in the +19 product in {Delta}RNase II cells (Fig. 2B). The RNase R/RNase II double deletion strain exhibited less cleavage at both sites, whereas deletion of the C-terminal domain of RNase E had little effect on cleavage (Fig. 2B). Although RNase E is an endoribonuclease, the C-terminal domain is required for the organization of the degradosome, a multienzyme complex that contains PNPase and is important for the degradation of many mRNAs in E. coli (25, 26). In general, the accumulation of specific cleavage products was dependent upon exoribonuclease activities.

The SecM Nascent Peptide Is Linked to tRNAGly during Ribosome Arrest—The accumulation of truncated secM messages in tmRNA+ cells and the involvement of exoribonucleases in mRNA cleavage are inconsistent with what is known about A-site cleavage. Moreover, the SecM-induced ribosome arrest occurs at the codon for proline 166 (9, 16), a position that is 13-15 nucleotides upstream of the stop codon (Fig. 1A). We sought to confirm the position of SecM-stalled ribosomes using a mini-gene that encodes SecM residues glutamine 149 - glutamine 167 directly downstream of the FLAG epitope. Additionally, the flag-secM' mini-gene was synonymously recoded to change the codon for proline 153 from CCC to CCG, and the codon for glycine 161 from GGC to GGA.

Northern analysis using a probe specific for the ribosome binding site of flag-secM' detected truncated mRNA, and this cleavage appeared to depend upon ribosome stalling because truncated mRNA was not observed with the P166A variant (Fig. 3, RBS probe blot). The position of the arrested ribosome was determined by identifying the nascent peptidyl-tRNA by Northern blot analysis. Induction of FLAG-SecM' synthesis led to a shift in the electrophoretic mobility of Formula but not that of Formula (Fig. 3, glyV and proL probe blots). The Formula mobility shift was not observed when the FLAG-(P166A)SecM' variant was expressed (Fig. 3, glyV probe blot). The Formula mobility shift was not seen when RNA samples were incubated atpH8.9 for 1 h at 37 °C to deacylate tRNAs (data not shown) (22). The arrested ribosome could be positioned unambiguously because the recoded mini-gene contained only one codon (GGC of glycine 165) that is decoded by Formula. Therefore, during SecM-mediated ribosome arrest, the nascent peptide is covalently linked to Formula via glycine 165 and the codon for proline 166 is positioned in the A-site.


Figure 3
View larger version (74K):
[in this window]
[in a new window]
  		FIGURE 3.
The SecM nascent peptide is covalently linked to Formula. RNA from strains expressing flag-secM' (pSecM') and flag-(P166A)secM' (pSecM'(P166A)) mini-genes was analyzed by Northern blot to identify ribosome arrest-dependent peptidyl-tRNA. The RBS, glyV, and proL oligonucleotide probes were specific for the ribosome binding site of mRNA, Formula, and Formula, respectively. The migration positions of full-length mRNA, truncated mRNA, Formula, Formula, and Formula are indicated. Samples containing overexpressed Formula are indicated by {uparrow} [Formula]. The slower migrating species detected in the proL probe blot is probably incompletely processed Formula, as it is present in all overexpressed Formula samples, regardless of SecM expression. IPTG, isopropyl beta-D-thiogalactopyranoside.

 


Figure 4
View larger version (52K):
[in this window]
[in a new window]
  		FIGURE 4.
tRNAPro is associated with SecM-arrested ribosomes. Northern blot analysis of RNA purified from supernatant (S) and pellet (P) fractions obtained by ultracentrifugation of cell lysates through sucrose cushions. Cells expressed FLAG-({Delta}ss)SecM in which proline 166 was encoded by CCU, CCG, or changed to alanine (P166A). The proL, proK, and argQ oligonucleotide probes were specific for Formula (cognate for CCU and CCC), Formula (cognate for CCG), and Formula (cognate for CGU, CGC, and CGA), respectively. Samples from tmRNA+ and {Delta}tmRNA strains are indicated.

 
SecM-arrested Ribosomes Contain Prolyl-tRNAPro in the A-site—Elegant studies have shown that SecM ribosome arrest is prevented if proline residues are replaced with the imino acid analog, azetidine-2-carboxylic acid (14). Based on this finding, it has been reasonably assumed that proline 166 is incorporated into the SecM nascent peptide during ribosome arrest (8, 9, 14). However, recent work from Ito and colleagues (16), as well as our analysis, indicates that ribosome arrest occurs prior to proline 166 addition. One model that is consistent with all available data postulates that prolyl-tRNAPro occupies the A-site of the SecM-arrested ribosome. If this model is correct, tRNAPro should be stably associated with arrested ribosomes.

Extracts from cells expressing FLAG-({Delta}ss)SecM were separated into high-speed pellet and supernatant fractions by ultracentrifugation through sucrose cushions. Polyacrylamide gel analysis of RNA extracted from these fractions showed that the rRNA (i.e. ribosomes) was present in the pellet fraction, whereas the majority of tRNA was in the supernatant fraction (data not shown). Partitioning of tRNA to the supernatant fraction was confirmed by Northern analysis for Formula (Fig. 4, argQ probe blot), which was not predicted to associate with SecM-arrested ribosomes. In contrast, a higher proportion of Formula was found in the pellet fractions from cells expressing FLAG-({Delta}ss)SecM, but not FLAG-({Delta}ss-P166A)SecM (Fig. 4, proL probe blot). Enrichment of tRNAPro in pellet fractions was dependent upon cognate tRNA/codon interactions. Formula, the cognate tRNA for CCU and CCC codons, was not enriched in high-speed pellets if SecM proline 166 was encoded by CCG (Fig. 4, proL probe blot), even though the CCG codon fully supports ribosome arrest (9). Moreover, although Formula partitioned to the pellet fractions when the CCU construct was expressed, significantly more Formula was found in the pellet fraction when its cognate CCG codon was used to code for proline 166 (Fig. 4, proK probe blot). The partitioning of Formula to the ribosome fraction with the CCU construct may be due to association with trailing ribosomes within the SecM-stalled polysome, because Formula is not known to decode CCU and is found in the high-speed supernatant in the absence of ribosome arrest (Fig. 4, ({Delta}ss)P166A lanes). Finally, the association of tRNAPro with pellet fractions was not inhibited by the tmRNA quality control system (Fig. 4, {Delta}tmRNA versus tmRNA+).

tmRNA Activity at SecM-arrested Ribosomes—The data presented thus far indicate that tmRNA does not play a significant role in rescuing SecM-arrested ribosomes. However, published reports show SecM and SecM variants are ssrA-tagged by tmRNA as a consequence of ribosome arrest (27, 28). We examined tmRNA-mediated peptide tagging of SecM proteins in cells that express tmRNA(His6), which encodes a hexahistidine-containing ssrA peptide that is resistant to proteolysis (18). Western blot analysis using antibodies specific for His6 detected two ssrA(His6)-tagged species of ({Delta}ss)SecM (Fig. 5A, ({Delta}ss)SecM His6 lane). A similar ssrA(His6)-tagged doublet was observed with signal sequence-containing FLAG-SecM (data not shown), but not with the FLAG-({Delta}ss-P166A)SecM protein, which does not cause ribosome arrest (Fig. 5A, ({Delta}ss)P166A). All ssrA(His6)-tagged species were also detected by Western analysis using antibody specific for the N-terminal FLAG epitope (Fig. 5A, anti-FLAG panel).

To determine the sites of tagging, we purified ssrA(His6)-tagged FLAG-SecM and FLAG-({Delta}ss)SecM by Ni2+-NTA affinity chromatography and subjected the purified proteins to mass spectrometry and N-terminal sequence analysis. Although FLAG-SecM was initially expressed as an N-terminal FLAG fusion, the N-terminal amino acid sequence (AEPNA) of the purified protein indicated that the epitope tag had been removed along with the signal sequence peptide during secretion (data not shown). The masses of tagged SecM species were consistent with the addition of ssrA-(His6) tags after glycine 165 (15,450 Da; calculated mass 15,451 Da) and threonine 170 (16,047 Da; calculated mass 16,047 Da) (Fig. 5B, SecM spectrum). Similarly, FLAG-({Delta}ss)SecM was also tagged after residues corresponding to glycine 165 (16,845 Da; calculated mass 16,846 Da) and threonine 170 (17,439 Da; calculated mass 17,442 Da) (Fig. 5B, ({Delta}ss)SecM spectrum). We suspected that the tagged proteins detected by Western blot analysis corresponded to the two species observed by mass spectrometry. These assignments were confirmed through analysis of the FLAG-({Delta}ss-Q167UAA)SecM protein, which was synthesized from a construct containing a mutation that changes glutamine 167 codon to a stop codon (UAA) (Fig. 1A). The FLAG-({Delta}ss-Q167UAA)SecM protein lacks four C-terminal amino acid residues, but still causes ribosome arrest (9). FLAG-({Delta}ss-Q167UAA)SecM protein was tagged after glycine 165, but not after threonine 170 (Fig. 5A, ({Delta}ss)Q167UAA, and data not shown). Presumably, the premature stop codon prevented ribosomes from translating to the 3' end of truncated mRNA.


Figure 5
View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 5.
tmRNA activity at SecM-arrested ribosomes. A, Western blot analyses of FLAG-({Delta}ss)SecM variants expressed in tmRNA+, {Delta}tmRNA, and tmRNA(His6) cells. Anti-His6 antibodies recognized ssrA(His6) peptide tags added to the C termini of FLAG-({Delta}ss)SecM proteins. Anti-FLAG antibody detected the N-terminal FLAG epitope present on all ({Delta}ss)SecM variants. Cells expressing the following proteins were analyzed: FLAG-({Delta}ss-P166A)SecM (({Delta}ss)P166A), FLAG-({Delta}ss)SecM (({Delta}ss)SecM), and FLAG-({Delta}ss-Q167UAA)SecM (({Delta}ss)Q167UAA). The positions of all untagged and ssrA(His6)-tagged proteins are indicated by labeled arrows. Plasmid Formula overexpresses Formula. B, mass spectrometry of ssrA(His6)-tagged SecM and FLAG-({Delta}ss)SecM proteins. Measured masses were consistent with proteins containing C-terminal ssrA(His6) tags added after SecM residues glycine 165 and threonine 170.

 
The effect of tmRNA activity on total SecM protein production was examined by Western blot analysis using a monoclonal antibody specific for the N-terminal FLAG epitope present on all FLAG-({Delta}ss)SecM variants. Two species of FLAG-({Delta}ss)SecM accumulated in {Delta}tmRNA cells (Fig. 5A, anti-FLAG panel, {Delta}tmRNA lane). The higher molecular weight protein represented full-length polypeptide and this species co-migrated with FLAG-({Delta}ss-P166A)SecM (which does not cause ribosome arrest) on SDS-polyacrylamide gels (Fig. 5A, anti-FLAG panel). The lower molecular weight species seen in {Delta}tmRNA cells corresponded to incompletely synthesized FLAG-({Delta}ss)SecM protein (to residue glycine 165) produced during ribosome arrest (Fig. 5A, and data not shown). However, analyses of cetyl trimethylammonium bromide precipitates and isolated ribosomes indicated that most of the incompletely synthesized FLAG-({Delta}ss)SecM protein was not covalently linked to tRNA and therefore did not represent ribosome-bound nascent chains (data not shown). Therefore, incompletely synthesized FLAG-({Delta}ss)SecM polypeptide chains were released from the arrested ribosome in a tmRNA-independent manner. In contrast to {Delta}tmRNA cells, full-length FLAG-({Delta}ss)SecM protein was not detected in tmRNA+ cells (Fig. 5A, anti-FLAG panel, tmRNA+ lane). Presumably, the full-length FLAG-({Delta}ss)SecM protein was ssrA-tagged and degraded rapidly in wild-type cells. Similarly, full-length FLAG-({Delta}ss)SecM did not accumulate to very high levels in tmRNA(His6)-expressing cells, although the two ssrA(His6)-tagged species were readily detected (Fig. 5A, anti-FLAG panel).


Figure 6
View larger version (40K):
[in this window]
[in a new window]
  		FIGURE 6.
Overexpression of Formula does not affect translational regulation of SecA. SecM-dependent regulation of SecA-LacZ fusion protein expression was analyzed by beta-galactosidase activity assay and Western blot analysis (inset). The SecA-LacZ translational fusion was expressed from constructs in which SecM was secreted (SecMA'), not secreted (({Delta}ss)SecM), or failed to elicit ribosome arrest (({Delta}ss)SecM P166A). Western blot analysis was performed with polyclonal antibodies specific for E. coli beta-galactosidase. Formula was overexpressed from plasmid Formula.

 
Prolyl-tRNAPro in the A-site Inhibits tmRNA Activity—SsrA tagging after glycine 165 appears to contradict the other data indicating that tmRNA plays no significant role in resolving SecM-arrested ribosomes. However, this work and previous studies relied upon SecM overexpression (27, 28), which is predicted to deplete limiting tRNAPro species. Formula, which holds the SecM nascent chain during ribosome arrest, is found at ~4,400 molecules per E. coli cell, whereas Formula and Formula, which occupy the arrested ribosome A-site, are present at only ~1,300 copies per cell (29). Therefore, if the number of SecM-arrested ribosomes exceeds 1,300 per cell, a second population of stalled ribosomes with unoccupied A-sites will accumulate due to prolyl-tRNAPro sequestration, potentially allowing for adventitious ssrA tagging after glycine 165.

To test this model, we overexpressed Formula and examined the effects on ssrA peptide tagging and three other properties of SecM ribosome arrest: (i) nascent peptidyl-tRNA stability, (ii) cleavage of flag-secM' mRNA, and (iii) regulation of secA translation. Overexpression of Formula significantly suppressed ssrA(His6) tagging after glycine 165, but increased tagging after threonine 170 (Fig. 5A, ({Delta}ss) Formula lane). Although tmRNA activity was significantly altered, Formula overexpression had no effect on nascent Formula accumulation (Fig. 3, glyV probe blot), and actually appeared to increase flag-secM' mRNA cleavage (Fig. 3, RBS probe blot). Finally, Formula overexpression had no effect on the regulation of secA translation. We made secA'::lacZ translational fusions and confirmed that deletion of the SecM signal sequence increased SecA'-LacZ expression, whereas further introduction of the P166A mutation reduced fusion protein synthesis (Fig. 6). Overexpression of Formula had no significant effect on the ribosome arrest-dependent increase in beta-galactosidase activity (Fig. 6). Moreover, deletion of tmRNA had no effect on SecA'-LacZ expression, as determined by Western blot and beta-galactosidase activity analyses (Fig. 6). We also attempted to examine the effects Formula overexpression on ribosome arrest from constructs that encoded proline 166 as CCG. Unfortunately, all plasmid clones carrying the proK gene under its own promoter also contained mutations in the Formula-encoding sequence (data not shown). Seven distinct mutations were found mapping to the D-arm, T-arm, anticodon loop, and the promoter (data not shown). These results suggest that high-level overexpression of Formula is deleterious to the cell.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Several lines of evidence indicate that the primary SecM-mediated ribosome arrest is resistant to A-site mRNA cleavage and subsequent tmRNA recruitment. First, although the secM mRNA was truncated in a ribosome arrest-dependent manner, the cleavage sites were 13 to 19 nucleotides downstream of the A-site codon. Second, the steady-state number of SecM-arrested ribosomes (as determined by Northern analysis of nascent peptidyl-tRNA) was not significantly affected by tmRNA. Third, incompletely synthesized SecM protein (to residue glycine 165) accumulated in tmRNA+ and tmRNA(His6)-expressing cells. Fourth, SecM-dependent regulation of secA translation was essentially identical in {Delta}tmRNA and tmRNA+ cells (27). Finally, A-site-bound Formula inhibits ssrA tagging after SecM glycine 165. The surprising discovery of A-site-bound prolyl-tRNAPro has also been recently reported by Ito and colleagues (16). That study used entirely different methods than ours to characterize arrested ribosomes produced in vitro (16), and is completely congruent with our analysis of the in vivo SecM ribosome arrest. Altogether, our data strongly suggest that tmRNA recruitment during the primary ribosome arrest is an artifact of SecM overexpression, and that A-site mRNA cleavage and ssrA tagging at this site do not occur under physiological conditions. We feel this conclusion makes biological sense because A-site cleavage is predicted to interfere with cis-acting SecM regulation of secA translation initiation. Moreover, co-translational secretion of the SecM nascent peptide ensures that SecA is synthesized in close proximity to the inner membrane (30), a phenomenon that presumably requires synthesis of SecM and SecA from the same mRNA molecule.


Figure 7
View larger version (48K):
[in this window]
[in a new window]
  		FIGURE 7.
Fates of SecM-arrested ribosomes. Ribosomes that synthesize SecM have at least four distinct fates. I, ribosome arrest is prevented if prolyl-tRNAPro binds the A-site during co-translational secretion of the SecM nascent chain. Such ribosomes continue to the stop codon and terminate translation normally. II, binding of prolyl-tRNAPro in the absence of co-translational secretion results in ribosome arrest and allows degradation of downstream mRNA to the 3'-edge of the arrested ribosome by exoribonucleases. Resumption of translation on 3'-edge cleaved mRNA leads to secondary ribosome arrest at the 3' end of the message, recruitment of tmRNA, and ssrA tagging of SecM after threonine 170. III, if the A-site is unoccupied, tmRNA may be directly recruited to ribosomes arrested on 3'-edge-cleaved mRNA, resulting in ssrA tagging after glycine 165. IV, ribosomes with unoccupied A-sites may undergo A-site mRNA cleavage at a low rate, also allowing ssrA tagging after glycine 165. Exoribonuclease cleavage to the 3'-edge of the arrested ribosome could also precede A-site mRNA cleavage. Protein release factor is labeled RF, and the peptidyl-tRNA and aminoacyl-tRNA binding sites are labeled P and A, respectively.

 
Deletion of the SecM signal sequence prevents co-translational secretion and thereby precludes the mechanism that normally alleviates ribosome arrest (14). Secreted SecM also elicited ribosome arrest in our study, presumably because the overexpressed protein saturated the secretion machinery. The ({Delta}ss)SecM-mediated ribosome arrest exhibits a t1/2 > 4-5 min in vivo (14), which exceed the half-life of bulk E. coli mRNA turnover (~2.4 min at 37 °C) (31). Thus, prolonged translational pausing allows degradation of the downstream mRNA to the 3' edge of the arrested ribosome (Fig. 7). Presumably, the 5' portion of the message is protected by ribosomes queued behind the primary SecM-arrested ribosome. The influence of SecM ribosome arrest on mRNA degradation appears to differ from other reported ribosome pauses, which tend to stabilize mRNA downstream of the arrest site (32-34). Although specific endonuclease cleavage between cistrons has been observed in E. coli operons (35), we find the same cleavages in mRNAs that lack the secM-secA intergenic region. Moreover, the cleavage appears to require ribosome arrest, arguing against a sequence-specific endonuclease activity. Our observations suggest that 3' -> 5' exoribonucleases generate the 3' termini of truncated secM messages. First, cleavage occurred downstream of the A-site codon, at sites consistent with the 3' border of a stalled E. coli ribosome (36, 37). Second, the proportion of +13 and +19 cleavage products was dependent upon exoribonuclease activities present in the cell. Longer cleavage products accumulated in the absence of either RNase R or PNPase, both of which degrade secondary structure-containing RNAs more efficiently than RNase II (38, 39). Although RNase R and PNPase are not known to work together, our data suggests that these enzymes may cooperate to convert the +19 cleavage product to the +13 product. Finally, RNase II can indirectly inhibit the degradation of structured mRNAs by removing 3' single-stranded regions required by PNPase to bind substrate (39, 40). These biochemical properties are consistent with the accumulation of cleavage products in our exoribonuclease knock-out strains.

The details of mRNA cleavage notwithstanding, it is interesting that the secM stop codon is in position to be cleaved during prolonged ribosome arrest. SecM-arrested ribosomes clearly resumed translation, and upon reaching the 3' end of the truncated mRNA, they stalled for a second time (Fig. 7). However, tmRNA is readily recruited to ribosomes stalled at the extreme 3' termini of mRNAs, and SecM was ssrA-tagged after the C-terminal residue threonine 170 (Fig. 7, ribosome fate II). Because little full-length ({Delta}ss)SecM protein accumulated in tmRNA+ or tmRNA(His6) cells, it appears that degradation of mRNA to the ribosome edge preceded the resumption of translation. It is unclear whether exoribonuclease cleavage also leads to ssrA-dependent degradation of SecM under physiological conditions. Secreted SecM was shown to be rapidly degraded in tmRNA+ cells (14), and we find the non-degradable ssrA(His6) tag stabilizes SecM in the periplasm. However, both of these studies employed SecM overexpression. At lower expression levels, co-translational secretion of SecM is expected to prevent ribosome arrest, and thereby inhibit mRNA cleavage and subsequent tmRNA recruitment/ssrA-tagging (Fig. 7, ribosome fate I). In any event, prolonged ribosome arrest stimulates SecA expression, so significant protein synthesis must occur prior to degradation of the downstream secA cistron.

A-site mRNA cleavage and tmRNA activities were clearly not able to resolve the majority of primary SecM-arrested ribosomes. However, ssrA tagging after glycine 165 indicates limited tmRNA recruitment during primary ribosome arrest, at least when SecM is overexpressed. Ivanova et al. (41) showed tmRNA is recruited to ribosomes stalled on mRNAs where the 3' terminus is 12 nucleotides downstream of the A-site codon, albeit at a ~20-fold lower rate than maximum. Therefore, cleavage of mRNA to the 3'-edge of the arrested ribosome could allow relatively inefficient tmRNA recruitment, provided the A-site is not occupied with prolyl-tRNAPro (Fig. 7, ribosome fate III). Alternatively, limited A-site mRNA cleavage may have occurred under SecM overexpression conditions (Fig. 7, ribosome fate IV). It appears that A-site nuclease activity is restricted to codons within unoccupied A-sites (1, 2), so presumably A-site cleavage in this instance would be an artifact of SecM overexpression. Based on Northern blot analysis, ~60% of cellular Formula is sequestered as SecM nascent peptidyl-tRNA during SecM overexpression. This corresponds to roughly 2,600 SecM-arrested ribosomes per cell, of which only ~1,300 can simultaneously contain A-site prolyl-tRNAPro (29). Therefore, we estimate ~50% of the SecM-arrested ribosomes have unoccupied A-sites in the absence of compensatory Formula overexpression, in accord with recent studies of SecM-arrested ribosomes (15, 16). Given incomplete A-site occupancy, perhaps the lack of A-site mRNA cleavage reflects sequence specificity of the A-site nuclease. The RelE protein shows marked preference for A-site codons, cleaving CAG and UAG at the highest rate (1). However, we have observed RelE-independent A-site mRNA cleavage at several different codons, suggesting that many sequences are potential substrates (2).4

Alternatively, the low rate of A-site mRNA cleavage may be due to the substantial structural rearrangements that occur in the ribosome during SecM-mediated arrest (15). SecM-induced structural rearrangements originate in the 50 S exit channel and are propagated to the 30 S subunit via inter-subunit bridges and ribosome-bound tRNAs (9, 15). Although structural changes are transmitted by tRNA, SecM-arrested ribosomes adopt the same conformation independent of A-site bound prolyl-tRNAPro (15). Several elements of 16 S rRNA are rearranged during ribosome arrest, including helix 44, which forms part of the 30 S A-site and makes contact with A-site mRNA (15). Clearly, alteration of A-site structure could significantly affect A-site nuclease activity, whether catalyzed by the ribosome or a trans-acting factor. Interestingly, Aiba and colleagues (28) showed that expression of a fusion protein containing the SecM-derived residues 161GIRAGP166 resulted in significant mRNA cleavage at sites immediately adjacent to the A-site codon, although the majority of cleavages still occurred at other positions corresponding to the 3'- and 5'-edges of the paused ribosome. We also observed similar cleavages near the A-site codon when expressing a fusion protein containing the longer SecM-derived 149QFSTPVWISQAQGIRAGP166 sequence (Fig. 2B), but failed to detect these mRNA cleavages when expressing full-length SecM sequences. Perhaps the full-length SecM nascent peptide is required for complete structural rearrangement and inhibition of A-site mRNA cleavage.

Gene regulation by translational pausing has long been recognized in prokaryotes, although its importance is still often under-estimated. Indeed, the SecM ribosome arrest is a newly characterized example of translational attenuation, which was shown to control inducible expression of erythromycin and chloramphenicol resistance genes over 20 years ago (42-45). The role of translational pausing in transcriptional attenuation of the E. coli trp operon was recognized even earlier (46, 47). In each case, A-site mRNA cleavage and tmRNA activities have the potential to interfere with regulation by "rescuing" paused ribosomes. However, in our view, it makes little sense to employ regulatory strategies that are undermined by translational quality control systems, and we predict that regulatory ribosome pauses are generally immune to A-site cleavage and tmRNA activities. The mechanisms involved are likely varied, and characterization of other ribosome pauses will hopefully increase our understanding of the molecular requirements for A-site mRNA cleavage.


   FOOTNOTES
 
* This work was supported by start-up funds from the University of California, Santa Barbara, and grants from Santa Barbara Cottage Hospital and the University of California, Santa Barbara. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Both authors contributed equally to the results of this study. Back

2 To whom correspondence should be addressed: Life Sciences Technology Bldg., Rm. 3105, University of California, Santa Barbara, CA 93106-9610. Tel.: 805-893-2028; Fax: 805-893-4724; E-mail: chayes{at}lifesci.ucsb.edu.

3 The abbreviations used are: A-site, aminoacyl-tRNA binding site; tmRNA, transfer-messenger RNA; PNPase, polynucleotide phosphorylase; NTA, nitrilotetraacetic acid; rRNA, ribosomal RNA; HPLC, high performance liquid chromatography. Back

4 F. Garza-Sánchez and C. S. Hayes, unpublished results. Back


   ACKNOWLEDGMENTS
 
We thank Laura Holberger, Kathleen McGinness, Sean Moore, and Bob Sauer for helpful discussions, Christopher Cain and Amy Chen for conducting preliminary experiments, Jason Sagert for N-terminal amino acid sequence analysis, and Les Wilson and David Chapman for use of equipment. Mass spectrometry was performed in the Department of Chemistry & Biochemistry Mass Spectrometry Facility at the University of California, Santa Barbara, with the assistance of Dr. James Pavlovich.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Pedersen, K., Zavialov, A. V., Pavlov, M. Y., Elf, J., Gerdes, K., and Ehrenberg, M. (2003) Cell 112, 131-140[CrossRef][Medline] [Order article via Infotrieve]
  2. Hayes, C. S., and Sauer, R. T. (2003) Mol. Cell 12, 903-911[CrossRef][Medline] [Order article via Infotrieve]
  3. Sunohara, T., Jojima, K., Yamamoto, Y., Inada, T., and Aiba, H. (2004) RNA (Cold Spring Harbor) 10, 378-386
  4. Karzai, A. W., Roche, E. D., and Sauer, R. T. (2000) Nat. Struct. Biol. 7, 449-455[CrossRef][Medline] [Order article via Infotrieve]
  5. Keiler, K. C., Waller, P. R., and Sauer, R. T. (1996) Science 271, 990-993[Abstract]
  6. Lovett, P. S., and Rogers, E. J. (1996) Microbiol. Rev. 60, 366-385[Abstract/Free Full Text]
  7. Tenson, T., and Ehrenberg, M. (2002) Cell 108, 591-594[CrossRef][Medline] [Order article via Infotrieve]
  8. Nakatogawa, H., Murakami, A., and Ito, K. (2004) Curr. Opin. Microbiol. 7, 145-150[CrossRef][Medline] [Order article via Infotrieve]
  9. Nakatogawa, H., and Ito, K. (2002) Cell 108, 629-636[CrossRef][Medline] [Order article via Infotrieve]
  10. McNicholas, P., Salavati, R., and Oliver, D. (1997) J. Mol. Biol. 265, 128-141[CrossRef][Medline] [Order article via Infotrieve]
  11. Murakami, A., Nakatogawa, H., and Ito, K. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 12330-12335[Abstract/Free Full Text]
  12. Mori, H., and Ito, K. (2001) Trends Microbiol. 9, 494-500[CrossRef][Medline] [Order article via Infotrieve]
  13. Butkus, M. E., Prundeanu, L. B., and Oliver, D. (2003) J. Bacteriol. 185, 6719-6722[Abstract/Free Full Text]
  14. Nakatogawa, H., and Ito, K. (2001) Mol. Cell 7, 185-192[CrossRef][Medline] [Order article via Infotrieve]
  15. Mitra, K., Schaffitzel, C., Fabiola, F., Chapman, M. S., Ban, N., and Frank, J. (2006) Mol. Cell 22, 533-543[CrossRef][Medline] [Order article via Infotrieve]
  16. Muto, H., Nakatogawa, H., and Ito, K. (2006) Mol. Cell 22, 545-552[CrossRef][Medline] [Order article via Infotrieve]
  17. Hayes, C. S., Bose, B., and Sauer, R. T. (2002) J. Biol. Chem. 277, 33825-33832[Abstract/Free Full Text]
  18. Hayes, C. S., Bose, B., and Sauer, R. T. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 3440-3445[Abstract/Free Full Text]
  19. Datsenko, K. A., and Wanner, B. L. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 6640-6645[Abstract/Free Full Text]
  20. Cheng, Z. F., Zuo, Y., Li, Z., Rudd, K. E., and Deutscher, M. P. (1998) J. Biol. Chem. 273, 14077-14080[Abstract/Free Full Text]
  21. Aiyar, A., and Leis, J. (1993) BioTechniques 14, 366-369[Medline] [Order article via Infotrieve]
  22. Varshney, U., Lee, C. P., and RajBhandary, U. L. (1991) J. Biol. Chem. 266, 24712-24718[Abstract/Free Full Text]
  23. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  24. Yamamoto, Y., Sunohara, T., Jojima, K., Inada, T., and Aiba, H. (2003) RNA (Cold Spring Harbor) 9, 408-418
  25. Carpousis, A. J. (2002) Biochem. Soc. Trans. 30, 150-155[CrossRef][Medline] [Order article via Infotrieve]
  26. Vanzo, N. F., Li, Y. S., Py, B., Blum, E., Higgins, C. F., Raynal, L. C., Krisch, H. M., and Carpousis, A. J. (1998) Genes Dev. 12, 2770-2781[Abstract/Free Full Text]
  27. Collier, J., Bohn, C., and Bouloc, P. (2004) J. Biol. Chem. 279, 54193-54201[Abstract/Free Full Text]
  28. Sunohara, T., Jojima, K., Tagami, H., Inada, T., and Aiba, H. (2004) J. Biol. Chem. 279, 15368-15375[Abstract/Free Full Text]
  29. Dong, H., Nilsson, L., and Kurland, C. G. (1996) J. Mol. Biol. 260, 649-663[CrossRef][Medline] [Order article via Infotrieve]
  30. Nakatogawa, H., Murakami, A., Mori, H., and Ito, K. (2005) Genes Dev. 19, 436-444[Abstract/Free Full Text]
  31. Regnier, P., and Arraiano, C. M. (2000) Bioessays 22, 235-244[CrossRef][Medline] [Order article via Infotrieve]
  32. Bechhofer, D. H., and Zen, K. H. (1989) J. Bacteriol. 171, 5803-5811[Abstract/Free Full Text]
  33. Dreher, J., and Matzura, H. (1991) Mol. Microbiol. 5, 3025-3034[Medline] [Order article via Infotrieve]
  34. Loomis, W. P., Koo, J. T., Cheung, T. P., and Moseley, S. L. (2001) Mol. Microbiol. 39, 693-707[CrossRef][Medline] [Order article via Infotrieve]
  35. Li, Y., and Altman, S. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 13213-13218[Abstract/Free Full Text]
  36. Fredrick, K., and Noller, H. F. (2002) Mol. Cell 9, 1125-1131[CrossRef][Medline] [Order article via Infotrieve]
  37. Jerinic, O., and Joseph, S. (2000) J. Mol. Biol. 304, 707-713[CrossRef][Medline] [Order article via Infotrieve]
  38. Cheng, Z. F., and Deutscher, M. P. (2002) J. Biol. Chem. 277, 21624-21629[Abstract/Free Full Text]
  39. Coburn, G. A., and Mackie, G. A. (1998) J. Mol. Biol. 279, 1061-1074[CrossRef][Medline] [Order article via Infotrieve]
  40. Hajnsdorf, E., Steier, O., Coscoy, L., Teysset, L., and Regnier, P. (1994) EMBO J. 13, 3368-3377[Medline] [Order article via Infotrieve]
  41. Ivanova, N., Pavlov, M. Y., Felden, B., and Ehrenberg, M. (2004) J. Mol. Biol. 338, 33-41[CrossRef][Medline] [Order article via Infotrieve]
  42. Bruckner, R., Dick, T., and Matzura, H. (1987) Mol. Gen. Genet. 207, 486-491[CrossRef][Medline] [Order article via Infotrieve]
  43. Dubnau, D. (1985) EMBO J. 4, 533-537[Medline] [Order article via Infotrieve]
  44. Hahn, J., Grandi, G., Gryczan, T. J., and Dubnau, D. (1982) Mol. Gen. Genet. 186, 204-216[CrossRef][Medline] [Order article via Infotrieve]
  45. Lovett, P. S. (1990) J. Bacteriol. 172, 1-6[Free Full Text]
  46. Yanofsky, C. (1981) Nature 289, 751-758[CrossRef][Medline] [Order article via Infotrieve]
  47. Zurawski, G., Elseviers, D., Stauffer, G. V., and Yanofsky, C. (1978) Proc. Natl. Acad. Sci. U. S. A. 75, 5988-5992[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
I. Wohlgemuth, S. Brenner, M. Beringer, and M. V. Rodnina
Modulation of the Rate of Peptidyl Transfer on the Ribosome by the Nature of Substrates
J. Biol. Chem., November 21, 2008; 283(47): 32229 - 32235.
[Abstract] [Full Text] [PDF]

Home page
 RNAHome page
M. Beringer
Modulating the activity of the peptidyl transferase center of the ribosome
RNA, May 1, 2008; 14(5): 795 - 801.
[Abstract] [Full Text] [PDF]

Home page
 Plant Cell PhysiolHome page
Y. Haraguchi, Y. Kadokura, M. Nakamoto, H. Onouchi, and S. Naito
Ribosome Stacking Defines CGS1 mRNA Degradation Sites During Nascent Peptide-Mediated Translation Arrest
Plant Cell Physiol., March 1, 2008; 49(3): 314 - 323.
[Abstract] [Full Text] [PDF]

Home page
 RNAHome page
J. F. Atkins, N. M. Wills, G. Loughran, C.-Y. Wu, K. Parsawar, M. D. Ryan, C.-H. Wang, and C. C. Nelson
A case for "StopGo": Reprogramming translation to augment codon meaning of GGN by promoting unconventional termination (Stop) after addition of glycine and then allowing continued translation (Go)
RNA, June 1, 2007; 13(6): 803 - 810.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/45/34258    most recent
M608052200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garza-Sánchez, F.
Right arrow Articles by Hayes, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garza-Sánchez, F.
Right arrow Articles by Hayes, C. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement