JBC Transcription and Nuclear Factor Monoclonals

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M608611200 on September 18, 2006

J. Biol. Chem., Vol. 281, Issue 46, 34816-34825, November 17, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/46/34816    most recent
M608611200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gui, L.
Right arrow Articles by Hocking, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gui, L.
Right arrow Articles by Hocking, D. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Identification of the Heparin-binding Determinants within Fibronectin Repeat III1

ROLE IN CELL SPREADING AND GROWTH*

Liqiong Gui{ddagger}1, Katherine Wojciechowski§1, Candace D. Gildner{ddagger}, Hristina Nedelkovska§, and Denise C. Hocking{ddagger}§2

From the Departments of {ddagger}Biomedical Engineering and §Pharmacology and Physiology, University of Rochester Medical Center, Rochester, New York 14642

Received for publication, September 6, 2006


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Fibronectins are high molecular mass glycoproteins that circulate as soluble molecules in the blood, and are also found in an insoluble, multimeric form in extracellular matrices throughout the body. Soluble fibronectins are polymerized into insoluble extracellular matrix (ECM) fibrils via a cell-dependent process. Recent studies indicate that the interaction of cells with the ECM form of fibronectin promotes actin organization and cell contractility, increases cell growth and migration, and enhances the tensile strength of artificial tissue constructs; ligation of integrins alone is insufficient to trigger these responses. Evidence suggests that the effect of ECM fibronectin on cell function is mediated in part by a matricryptic heparin-binding site within the first III1 repeat (FNIII1). In this study, we localized the heparin-binding activity of FNIII1 to a cluster of basic amino acids, Arg613, Trp614, Arg615, and Lys617. Site-directed mutagenesis of a recombinant fibronectin construct engineered to mimic the ECM form of fibronectin demonstrates that these residues are also critical for stimulating cell spreading and increasing cell proliferation. Cell proliferation has been tightly correlated with cell area. Using integrin- and heparin-binding fibronectin mutants, we found a positive correlation between cell spreading and growth when cells were submaximally spread on ECM protein-coated surfaces at the time of treatment. However, cells maximally spread on vitronectin or fibronectin still responded to the fibronectin matrix mimetic with an increase in growth, indicating that an absolute change in cell area is not required for the increase in cell proliferation induced by the matricryptic site of FNIII1.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Fibronectin is an abundant adhesive glycoprotein that is evolutionarily conserved and broadly distributed among vertebrates (1). The polymerization of soluble fibronectin into insoluble fibrils within the ECM3 is a dynamic, cell-dependent process that is mediated by coordinate events involving the actin cytoskeleton and integrin receptors (2). Previous studies have shown that active fibronectin matrix polymerization promotes cellular functions critical for tissue repair, including cell growth (3–6), cell migration (7), and collagen matrix contraction (8). Fibronectin matrix polymerization also promotes collagen I deposition (9, 10) and enhances the tensile strength of collagen-based tissue constructs (11); integrin ligation alone is not sufficient to trigger these responses (3, 7–9, 11). The mechanism by which ECM fibronectin exerts its unique effect on cell function is only partially understood.

In the ECM, fibronectin is organized as an extensive network of elongated, branching fibrils. Time lapse microscopy of cells expressing green fluorescent protein-labeled fibronectin demonstrate that cells routinely stretch ECM fibronectin into long fibrillar strands that recoil when released (12). The three-dimensional organization of ECM fibronectin likely arises from the ability of cells to repeatedly exert a mechanical force (13) on discrete regions of the protein (14) to facilitate the formation of fibronectin-fibronectin interactions (15–19). As cells contact fibronectin fibrils, tractional forces induce additional conformational changes (20) that are necessary for both lateral growth and branching of the fibrils (17).

Fibronectin, like many other ECM molecules, is a mosaic protein composed of modular subunits (21). The primary structure of each subunit is organized into three types of repeating homologous units, termed types I, II, and III. Fibronectin type III repeats (FNIII) are found in a number of ECM proteins and consist of seven beta-strands that overlap to form two beta-sheets (22, 23). Molecular modeling and atomic force microscopy studies predict that reversible unfolding of the type III repeats contributes to the elasticity of fibronectin, which may be extended up to six times its initial length (14, 24, 25). Fibronectin modules contain multiple binding sites, including those for glycosaminoglycans, collagen or gelatin, fibrin, and integrin receptors; additional binding sites may become available as fibronectin modules are elongated and internal residues are exposed (18, 25, 26).

The anti-parallel beta-sheets of FNIII repeats are composed of three (A, B, and E) and four (C, D, F, and G) beta-strands. Proteolysis of the first type III repeat of fibronectin (FNIII1) at residue Ile597 removes both the A and B beta-strands and results in a C-terminal fragment that binds to heparin (27). FNIII1 also exhibits cryptic homophilic binding activity (18, 28) that mediates fibronectin fibril formation (16, 29). These sites are not exposed in soluble fibronectin (18, 27), but may be exposed either during fibronectin matrix polymerization or as cells exert tension on the insoluble matrix (30, 31). We previously hypothesized that the cryptic heparin-binding activity of FNIII1 functions as a conformation-dependent site for cell surface heparan sulfate proteoglycans (HSPGs) and thus, serves as a mechanism by which the ECM form of fibronectin exerts its unique effect on cell function. To test this hypothesis, we developed a GST-tagged fusion protein in which the C-terminal, heparin-binding fragment of FNIII1, comprised of residues Ile597-Thr673, was directly linked to the integrin-binding FNIII8–10 modules (GST/III1H,8–10). Treatment of fibronectin-null myofibroblasts (FN-null MFs) with GST/III1H,8–10 stimulated cell growth, contractility, and migration to a similar extent as ECM fibronectin (7, 32). As such, this fibronectin matrix mimetic effectively bypasses some of the requirements for intact fibronectin to undergo conformational changes to initiate ECM fibronectin-specific signals. Here, we used site-directed mutagenesis of the matrix mimetic to map the heparin-binding, cell spreading, and growth-promoting activities of FNIII1. We localized these activities to a cluster of basic amino acids, Arg613-Trp614-Arg615-Lys617, that are contained within the C-strand of FNIII1. Using integrin- and heparin-binding fibronectin mutants, we found a positive correlation between increased cell spreading and increased cell growth when cell area at the time of exposure was submaximal. However, cells maximally spread on vitronectin or fibronectin substrates still responded to the fibronectin matrix mimetic with an increase in growth, indicating that an absolute change in cell area is not required for the increased rate of cell proliferation induced by ECM fibronectin.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents—Human plasma fibronectin was isolated from Cohn's fraction I and II, as described previously (33). Human plasma vitronectin was a gift from Dr. Scott Blystone (SUNY Upstate Medical University, Syracuse, NY). Human fibrinogen was a gift from Dr. Patricia Simpson-Haidaris (University of Rochester, Rochester, NY). Laminin was from BD Biosciences. Type I rat tail collagen was obtained from Upstate (Lake Placid, NY). Fibronectin III1 peptides were from Sigma. Antibodies and their sources are as follows: anti-FNIII1 IgG (9D2 (29)), a gift from Dr. Deane Mosher, University of Wisconsin, Madison, WI; mouse IgG Cappel, Aurora, OH; anti-GST polyclonal IgG, Upstate; horseradish peroxidase-conjugated goat anti-mouse and anti-rabbit antibodies, Bio-Rad. Tissue culture supplies were obtained from Corning/Costar (Cambridge, MA). Unless otherwise indicated, chemical reagents were from Sigma.

Cell Culture—Mouse embryonic FN-null MFs (3) were generously provided by Dr. Jane Sottile (University of Rochester, Rochester, NY). FN-null MFs do not produce endogenous fibronectin but are able to polymerize exogenously added fibronectin into the ECM (3). FN-null MFs were cultured on collagen I-coated dishes under serum-free conditions using a 1:1 mixture of Cellgro® (Mediatech, Herndon, VA) and Aim V (Invitrogen). These media do not require serum supplementation. Thus, no exogenous source of fibronectin is present during routine culture.

Recombinant Fibronectins—Recombinant GST/III1H, GST/III1H,8–10, GST/III1H,2–4, GST/III8–10, and GST/III8–10,13 were produced in bacteria and purified as described previously (32). FNIII1H is comprised of amino acids Ile597–Thr673 (bases 1802–2032). The FNIII1H,8–10 heparin-binding mutant (GST/III1H,8–10{Delta}KRWRK; K609G,R613T,W614T,R615T,K617A) was produced using the following mutant sense primer: 5'-CCCGGTACCATCCAGTGGAATGCACCACAGCCATCTCACATTTCCGGGTACATTCTCACGACGACACCTGCAAATTCTGTAGGC. Mutations are underlined; a Kpn site is shown in bold. The mutant sense primer for GST/III1H,8–10{Delta}RWR (R613T,W614T,R615T) (5'-CCCGGTACCATCCAGTGGAATGCACCACAGCCATCTCACATTTCCAAGTACATTCTCACGACGACACCTAAAAATTCTGTAGGC) also contains a Kpn site. The antisense primer used for both III1H mutants was the same as that used to amplify GST/III8–10 (32). The sense primer for GST/III1H,8–10RGE (D1495E) (5'-CCCGGTACCATCCAGTGGAATGCACCACAG) contains a Kpn site; the antisense mutant primer (5'-CCCCCCGGGCTATGTTCGGTAATTAATGGAAATTGGCTTGCTGCTTGCGGGGCTTTCTCCACGGCCAGTG) contains a SmaI site. GST/III1H,8–10{Delta}Syn (R1374A,R1379A) was produced using the same mutant inner sense and antisense primers as were used previously to generate GST/III9–10R1374A,R1379A (32). The outer primers were the same as those used to amplify GST/III1H,8–10RGE (sense) and GST/III8–10 (antisense) (32). Purified GST/III1H,8–10 DNA (32) was used as the PCR template for all mutant GST/III1H,8–10 constructs except GST/III1H,8–10{Delta}Syn/RGE. The production of GST/III1H,8–10{Delta}Syn/RGE was similar to that of GST/III1H,8–10{Delta}Syn except that GST/III1H,8–10RGE DNA was used for amplification.

The truncated GST/III1 constructs were produced using the III1 sense primer (5'-CCCGGATCCAGTGGTCCTGTCGAAGTATTTAT) containing a BamHI site (bold) and the following antisense primers: GST/III1F666 (bases 1745–2011; Ser578–Phe666): 5'-CCCGAATTCCTAGAAGTCAAAGCGAGTCACTTC; GST/III1F664 (bases 1745–2005; Ser578–Phe664): 5'-CCCGGATCCCTAAAAGCGAGTCACTTCTTGGTG; GST/III1Y656 (bases 1745–1981; Ser578–Tyr656): 5'-CCCGAATTCCTAGTACTGCTGGATGCTGATGAG; GST/III1Y646 (bases 1745–1951; Ser578–Tyr646): 5'-CCCGAATTCCTAGTATACCACACCAGGCTTC. EcoRI sites are shown in bold. GST/III-1K641T was produced using the following mutant primers: 5'-TCAAAGGCCTGACGCCTGGTGTGGT (sense) and 5'-ACCACACCAGGCGTCAGGCCTTTGA (antisense). The outer primers were the same as those used to amplify nonmutant GST/III1 (bases 1745–2905; Ser578–Thr673) (18).

PCR-amplified DNA was cloned into pGEX-2T (Amersham Biosciences) and transfected into DH5{alpha} bacteria (32). DNA was sequenced to confirm the presence of the mutations. Fusion proteins were isolated on glutathione-Sepharose (Amersham Biosciences) and dialyzed extensively against PBS, as described previously (18).

Collagen Gel Contraction Assay—Floating type I collagen gels were prepared as described previously (8). Collagen gels imbedded with FN-null MFs and FNIII1 peptides were incubated for 20 h and then removed from the wells and weighed. Collagen gel contraction was measured as a decrease in gel weight (8). Data are reported as percent of contraction: (1 – weight of the test gels/weight of gels not containing cells) x 100.

Solid-phase Enzyme-linked Immunosorbent Assay and Heparin Binding Assay—Glutathione-coated 96-well plates (Pierce) were incubated with saturating concentrations of GST fusion protein, as previously described (32). Plates were then washed and incubated with either primary antibodies (1 µg/ml) or 5 µg/ml heparin-albumin-biotin followed by horseradish peroxidase-linked secondary antibodies or horseradish peroxidase-NeutrAvidin (Molecular Probes, Eugene, OR). The assays were developed using 2,2-azino-bis(3-ethylbenzthiazolinesulfonic acid) and the absorbance at 405 nm was measured.

Cell Spreading Assay—Tissue culture dishes (24-well) were coated with collagen I (50 µg/ml in 0.02 N acetic acid (3)), fibronectin (10 µg/ml), vitronectin (1 or 10 µg/ml), fibrinogen (10 µg/ml), or laminin (10 µg/ml). Proteins other than collagen were diluted in PBS. FN-null MFs were seeded at 2.7 x 103 cells/cm2 (34) in defined medium and incubated at 37 °C for 4 h. Cells were then treated with 20 nM fibronectin, 250 nM GST fusion proteins, or an equal volume of PBS. At various times, cells were fixed with 2% paraformaldehyde. Cells were visualized with an Olympus inverted microscope (IX70) using a x40 objective. Phase-contrast images of fixed cells from triplicate wells were obtained using a Spot digital camera (Diagnostic Instruments, Sterling Heights, MI). The areas of at least 49 randomly chosen cells per condition were determined using ImagePro-Plus software (Media Cybernetics, Silver Spring, MD) calibrated with a stage micrometer.

Cell Growth Assay—FN-null MFs were seeded on tissue culture plates (48-well) coated with collagen, fibronectin, laminin, fibrinogen, or vitronectin at 3 x 103 cells/cm2 for 4 h (32). Cells were then incubated with 250 nM of the various recombinant fibronectin constructs at 37 °C for 3 or 4 days. Cells were fixed with 1% paraformaldehyde and stained with 0.5% crystal violet. Cells were solubilized with 1% SDS and the absorbance at 590 nm was determined.

Immunoblotting—PAGE and immunoblotting were performed as described previously (18). Gel samples were reduced with 2% beta-mercaptoethanol. Immunoblots were incubated with primary antibody in TBS-T (20 mM Tris, pH 7.6, 137 mM NaCl, 0.1% Tween 20) containing 1% bovine serum albumin followed by goat anti-rabbit or -mouse horseradish peroxidase-linked secondary antibody. Blots were developed using ECL (Pierce). After detection, blots were stripped by incubation with 0.2 M glycine, 0.1% SDS, 1% Tween, pH 4.0 (35). Blots were then washed, reblocked, and reprobed.

Statistical Analysis—Data are expressed as mean ± S.E. and represent one of at least two independent experiments performed in triplicate (cell area) or in quadruplicate (cell growth and collagen gel contraction). Statistical significance was determined using either one-way analysis of variance with Turkey's post-test or Student's t test for unpaired samples using Prism software (GraphPad Software, San Diego, CA). Differences less than 0.05 were considered significant.


Figure 1
View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 1.
Effect of FNIII1 peptides on collagen gel contraction. Collagen gel contraction assays were performed on FN-null MFs, as described under "Experimental Procedures." A, collagen gels were incubated in the absence and presence of 500 nM GST/III1H,8–10 or 100 µM of the various FNIII1 peptides. *, significantly different from +PBS, p < 0.01. B, collagen gels were treated with increasing concentrations of Peptide 1 or the control, scrambled (s) Peptide 1. *, significantly different from corresponding dose of sPeptide 1, p < 0.01. Peptide sequences are shown in Fig. 3.

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Identification of the Matricryptic Heparin-binding Site in FNIII1—Our previous studies indicate that the effect of ECM fibronectin on cell function is mediated in part by a matricryptic, heparin-binding site within FNIII1 (7, 32). To further define the role of FNIII1 in promoting cell growth and contractility, studies were conducted to localize the functionally active site in FNIII1. In cell growth and migration assays, the cellular response to the fibronectin matrix mimetic, GST/III1H,8–10, requires both FNIII1H as well as {alpha}5beta1 integrin ligation via the FNIII8–10 modules. In contrast, cell-mediated collagen gel contraction is stimulated by a FNIII1H construct that does not contain an integrin-binding site (32). Thus, overlapping 18-mer peptides encompassing a cluster of basic residues in FNIII1 were used in collagen gel contraction assays to initially map the active site in FNIII1H. As shown in Fig. 1A, Peptides 1, 2, and 3, containing the common sequence, 613RWRPKNSVGR, stimulated collagen gel contraction; Peptide 4 had no effect. Concentrations of Peptide 1 ranging from 250 nM to 25 µM produced a significant increase in collagen gel contraction compared with the control scrambled Peptide 1 (sPeptide 1; Fig. 1B). The effects of Peptide 1 on contraction were saturable, reaching a maximum between 0.5 and 1 µM (Fig. 1B). These values are in agreement with previous studies demonstrating that dimeric FN, which contains two III1 modules, stimulates maximum collagen gel contraction between 0.2 and 0.4 µM (32).


Figure 2
View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 2.
Localization of the heparin-binding and growth-promoting activities of FNIII1. A, glutathione-coated plates were incubated with saturating concentrations of the various fusion proteins. Binding of biotin-heparin was assayed by enzyme-linked immunosorbent assay. Data represent the mean absorbance of triplicate wells ± S.E. *, significantly different from +GST, p < 0.01. B, FN-null MFs were seeded on collagen-coated wells. Four hours after seeding, cells were treated with 400 nM of the various fusion proteins and cell number was determined at various times as described under "Experimental Procedures." Data are presented as the absorbance obtained at 590 nm and represent the mean ± S.E. Maximal growth in response to GST/III1H,8–10 occurs with 100 nM protein (32). +GST/III1H,8–10, +GST/III1H,8–10{Delta}RWR, and +GST/III1H,8–10RGE are significantly different from +PBS on days 2, 3, and 4, p < 0.01.

 
Mutating Arg613, Trp614, and Arg615 in GST/III1H,8–10 to the corresponding, non-charged amino acid sequence in FNIII7 (Thr1178-Thr1179-Thr1180) resulted in a partial decrease in the heparin-binding activity of the construct (GST/III1H,8–10{Delta}RWR; Fig. 2A). Mutating two additional residues in GST/III1H,8–10{Delta}RWR (K609G and K617A; GST/III1H,8–10{Delta}KRWRK) abolished the heparin-binding activity (Fig. 2A), as well as the growth response to GST/III1H,8–10 (Fig. 2B). Mutating the integrin-binding RGD sequence in FNIII10 to RGE only partially inhibited the growth response (Fig. 2B), underscoring the importance of FNIII1H in the cellular response to the matrix mimetic.

Studies utilizing overlapping peptides extending from Lys609 to Thr627 were conducted next to confirm the importance of this region in fibronectin and GST/III1H,8–10-induced growth. Addition of FNIII1 Peptides 5 or 6 to cells blocked the increase in growth induced by either GST/III1H,8–10 (Fig. 3A) or fibronectin (Fig. 3B). In contrast, Peptide 7 had no effect on fibronectin- or GST/III1H,8–10-induced growth (Fig. 3, A and B). Peptides 5 and 6 did not affect cell growth in the absence of fibronectin (not shown). A schematic of the FNIII1 peptides used in this study is shown in Fig. 3C. Taken together, these data identify Arg613, Trp614, Arg615, and Lys617 as the novel heparin-binding and growth-promoting site in FNIII1.


Figure 3
View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 3.
Effect of FNIII1 peptides on fibronectin-induced cell growth. FN-null MFs were seeded on collagen-coated wells. Four hours after seeding, cells were treated with (A) GST/III1H,8–10 (100 nM), (B) fibronectin (FN; 40 nM), or an equal volume of PBS (Cntl), in the absence ("no addition") and presence of FNIII1 peptides (shown in mM). Following a 3-day incubation, cell number was determined. Data are presented as the absorbance obtained at 590 nm and represent the mean ± S.E. A, *, significantly different from +GST/III-1H,8–10, p < 0.01. B, *, significantly different from +FN, p < 0.001. Peptide sequences are shown in C.

 
Localization of the Epitopes for the Function-blocking Anti-FNIII1 Antibody, 9D2—The 9D2 mAb binds to FNIII1 and blocks fibronectin matrix assembly (29). As such, 9D2 has been used in several studies to distinguish the effects of soluble fibronectin from those of ECM fibronectin. 9D2 inhibits fibronectin-stimulated cell growth (3), contractility (8), and migration (7). 9D2 mAb does not block the initial association of fibronectin with cell surfaces (29), nor does it block cell adhesion to fibronectin (7). These studies suggest that the 9D2 epitope may be located at or near the matricryptic heparin-binding site. To localize the 9D2 epitope, a series of truncated FNIII1 constructs were produced and analyzed by immunoblotting. As shown in Fig. 4A, sequential removal of C-terminal residues comprising either the connecting sequence to FNIII2 (GST/III1F666), or the G beta-strand of FNIII1 (GST/III1F664 (36) and GST/III1Y656 (25)) had no effect on 9D2 recognition. Similarly, removal of both A and B beta-strands from the N terminus of FNIII1 (GST/III1I597) did not alter 9D2 recognition (Fig. 4A). In contrast, removal of both F and G beta-strands (GST/III1Y646) resulted in loss of 9D2 recognition (Fig. 4A), indicating that the 9D2 epitope is contained within the C-F beta strands.


Figure 4
View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 4.
Localization of the 9D2 epitope in FNIII1. In A–C, aliquots (0.2 µg) of GST/III1 fusion proteins were electrophoresed on 10 or 12% polyacrylamide gels and analyzed by immunoblotting (IB) with the anti-FNIII1 antibody, 9D2. Blots were then stripped and reprobed for GST. Molecular mass markers are indicated to the left. In D, glutathione-coated plates were incubated with saturating concentrations of the various fusion proteins. Binding of 9D2, mouse IgG, and anti-GST antibodies was assayed by enzyme-linked immunosorbent assay. Data represent the mean absorbance of quadruplicate wells ± S.E.

 


Figure 5
View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 5.
9D2 blocks cell growth in response to GST/III1H,8–10. FN-null MFs were seeded on collagen-coated wells. Four hours after seeding, cells were treated with either 100 nM GST or GST/III1H,8–10 in the presence of 9D2 (500 nM) or non-immune IgG (500 nM), or an equal volume of PBS. Following a 3-day incubation, cell number was determined. Data are presented as the -fold increase in cell number over control (+GST) and represent the mean ± S.E. of 1 of 2 experiments performed in quadruplicate. *, significantly different from "GST/III1H,8–10+IgG," p < 0.05.

 
It was proposed previously that Lys641 of human fibronectin is part of the 9D2 epitope, as rat fibronectin, which contains Thr at this site, is not recognized by 9D2 (29). Lys641 is located within the loop connecting beta strands E and F (25). Indeed, mutating Lys641 to Thr in GST/III1 resulted in loss of 9D2 recognition (GST/III1K641T; Fig. 4B), demonstrating a role for Lys641 in 9D2 binding to human fibronectin.

We next used the mutated GST/III1H,8–10 constructs to ask whether the cryptic heparin-binding site, located within the C beta-strand of FNIII1, is also part of the 9D2 epitope. As shown in Fig. 4C, GST/III1H,8–10 was recognized by 9D2 in immunoblots. In contrast, 9D2 did not immunoblot either GST/III1H,8–10{Delta}RWR or GST/III1H,8–10{Delta}KRWRK (Fig. 4C). Identical results were obtained when the constructs were analyzed by enzyme-linked immunosorbent assay (Fig. 4D). These results indicate that residues Arg613, Trp614, and Arg615 are important components of the 9D2 epitope. Consistent with these findings, cell growth in response to GST/III1H,8–10 was inhibited by 9D2 IgG, but not non-immune IgG (Fig. 5).

ECM Fibronectin Increases Cell Area—Cell growth has been positively correlated with total cell area (37). Thus, one mechanism by which GST/III1H,8–10 may promote cell growth, as well as cell migration, is by increasing cell area. To analyze the effects of the matrix mimetic on cell area, FN-null MFs were seeded onto collagen I-coated dishes and incubated for 4 h to allow basal cell spreading to occur. FN-null MFs are grown under serum-free conditions, providing an ideal system for determining cell area in the complete absence of fibronectin, and for distinguishing the effects of soluble versus matrix fibronectin (3, 8, 9, 32, 38). In the absence of GST/III1H,8–10, the average area of collagen-adherent cells 4 h after seeding was ~900 µm2, indicating that cells were well spread on the collagen substrate (39–41). Cells were then treated with GST/III1H,8–10, fibronectin, or control fusion proteins for an additional 2 h. As shown in Fig. 6A, addition of either GST/III1H,8–10 or intact fibronectin to collagen-adherent cells increased cell area. Cell spreading was not increased in response to a construct in which the heparin-binding III13 module was substituted for III1H (GST/III8–10,13; Fig. 6A), demonstrating the specificity of the III1H fragment. Similarly, treatment of cells with a construct in which the III2–4 modules were substituted for III8–10 did not increase cell area (GST/III1H,2–4; Fig. 6A), suggesting that integrin ligation is necessary for the cell spreading response. However, treatment of cells with an integrin-binding fragment in which the III1H fragment was absent (GST/III8–10; Fig. 6A) also failed to increase cell area, further demonstrating a role for III1H in regulating cell area.


Figure 6
View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 6.
The ECM form of fibronectin increases cell area. FN-null MFs were allowed to adhere and spread on collagen I-coated wells for 4 h. A, cells were then treated for 2 h with 250 nM of the various fusion proteins. In B, cells were treated for 2 or 24 h with 20 nM FN in the presence of either 50 µg/ml non-immune mouse IgG or 50 µg/ml anti-FNIII1, 9D2. Control cells were treated with PBS only. Cells were then fixed and phase-contrast images were obtained. Cell areas were determined as described under "Experimental Procedures." Data are presented as mean cell area (µm2) ± S.E. of at least 70 cells per condition and represent 1 of 2 experiments performed. A, *, significantly different from "+PBS," p < 0.05. B,*,"+FN+9D2" is significantly different from "+FN+IgG," p < 0.05.

 
Our studies indicate that FNIII1H contributes to cell spreading and that a portion of the 9D2 epitope lies within the functional heparin-binding domain of FNIII1. Furthermore, 9D2 mAb blocks both cell growth (3) and migration (7) in response to fibronectin. Thus, to determine whether 9D2 inhibits cell spreading in response to fibronectin, FN-null MFs were allowed to spread on a collagen substrate and then treated with fibronectin in the presence of either 9D2 or non-immune IgG. As shown in Fig. 6B, fibronectin triggered a significant increase in projected cell area 2 and 24 h after its addition. Furthermore, the increase in cell area in response to fibronectin was blocked by addition of 9D2 mAb, providing evidence that fibronectin matrix assembly and exposure of the matricryptic site in FNIII1 are required for the increase in cell area.

Fibronectin Increases Cell Area by Transiently Increasing the Rate of Cell Spreading—To analyze the kinetics of fibronectin-induced cell spreading, collagen-adherent FN-null cells were treated with either fibronectin or an equal volume of PBS for various times and projected cell areas were determined. As shown in Fig. 7, fibronectin triggered a rapid increase in cell area that was evident within 10 min of its addition. This increase in cell spreading was followed by a plateau phase that began ~1 h after fibronectin addition and continued for ~4h (Fig. 7A). Following the plateau phase, cell spreading resumed at a rate similar to that observed with control (PBS-treated) cells (Fig. 7, A and C). Linear regression analysis (r2 ≥ 0.8) was used to determine the rate of cell spreading immediately after fibronectin addition (<1 h; Fig. 7B) and following the plateau phase (4–24 h after fibronectin treatment; Fig. 7C). As shown in Fig. 7D, fibronectin transiently increased the rate of cell spreading from 103.7 (1.7 µm2/min) to 632.4 µm2/h (10.5 µm2/min). Following the plateau phase, the rate of cell spreading of fibronectin-treated cells returned to a rate similar to that observed in PBS-treated cells (66.8 versus 54.0 µm2/h, respectively; Fig. 7D). In contrast, the early and late phases of cell spreading of PBS-treated control cells were not significantly different (Fig. 7D). These data indicate that addition of fibronectin to collagen-adherent cells triggers a rapid yet transient increase in the rate of cell spreading.

Relationship between Cell Area and Growth—We next analyzed the effects of mutant heparin- and integrin-binding GST/III1H,8–10 constructs on cell spreading to (i) identify the amino acid residues responsible for increasing cell area and (ii) determine whether changes in cell area paralleled changes in cell growth. Addition of the FNIII1 heparin-binding mutant, GST/III1H,8–10{Delta}KRWRK, to collagen-adherent FN-null MFs did not increase cell area (Fig. 8A) and likewise, did not enhance cell growth (Fig. 8B). Similarly, both the cell spreading response (Fig. 8A) as well as the cell growth response (Fig. 8B) to GST/III1H,8–10 was abolished by mutating the integrin-binding sequences in FNIII8–10 (GST/III-1H,8–10{Delta}Syn/RGE). Together, these data indicate that cell area and growth are co-regulated by the heparin-binding activity of FNIII1 and the integrin-binding activity of FNIII8–10. Treatment of cells with a construct in which only the integrin-binding synergy site in FNIII9 was mutated (GST/III1H,8–10{Delta}Syn) stimulated cell spreading (Fig. 8A) and cell growth (Fig. 8B) to a similar extent as GST/III1H,8–10. These data suggest that for cells adherent to collagen I, increased cell spreading in response to the fibronectin matrix mimetic is correlated with enhanced cell growth.

To determine whether GST/III1H,8–10 can increase the area and growth of cells adherent to other ECM substrates, FN-null cells were seeded on various adhesive proteins and allowed to adhere and spread for 4 h. Vitronectin was used at a non-saturating concentration to avoid inducing maximal cell area prior to GST/III1H,8–10-treatment. In all experiments, wells were blocked with bovine serum albumin to eliminate adhesion of GST/III1H,8–10 to the tissue culture plastic. Cells seeded in bovine serum albumin-coated wells in the presence of soluble GST/III1H,8–10 are non-adherent (not shown). As shown in Fig. 9A, GST/III1H,8–10 stimulated an increase in cell area when cells were adherent to several different ECM proteins, including fibrinogen, vitronectin, and laminin. Furthermore, this increase in cell area was accompanied by a similar increase in cell growth (Fig. 9B).


Figure 7
View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 7.
Fibronectin increases cell area by transiently increasing the rate of cell spreading. Fibronectin (20 nM) or an equal volume of PBS was added to collagen-adherent FN-null cells as described in the legend to Fig. 6. At various times, cells areas were determined. A, representative time course of cell area in response to fibronectin or PBS. Data are presented as mean cell area (µm2) ± S.E. of at least 49 cells per condition. The rate of cell spreading was determined from the slope (B, µm2/min; C, mm2/h) of the linear fit of the data. D, average cell spreading rates (µm2/h) from four independent experiments. Data are presented as mean ± S.E. *, p < 0.05 versus other groups.

 
Cell Area Expansion Is Not Required for GST/III1H,8–10-induced Growth—Cell spreading may physically trigger local changes in cytoskeletal conformation that in turn, allow for the recruitment and activation of signaling complexes involved in cell proliferation (42–44). As such, the relative change in cell area induced by ECM fibronectin may serve to mechanically stimulate the local activation of intracellular signals involved in cell growth control. To determine whether a change in cell area is required for enhanced cell growth in response to GST/III1H,8–10, cell area expansion in response to GST/III1H,8–10 was limited by seeding FN-null MFs on wells coated with saturating amounts of fibronectin or vitronectin. These conditions were used to promote maximal cell spreading within the first 4 h of seeding. As shown in Fig. 10A, areas of cells adherent to either fibronectin or vitronectin were significantly greater than those of cells adherent to collagen I and as anticipated, the areas of fibronectin- and vitronectin-adherent cells did not increase in response to GST/III1H,8–10 (Fig. 10A). In contrast, the increase in cell growth was still observed in response to GST/III1H,8–10, even in the absence of an increase in cell area (Fig. 10B). These data indicate that an absolute increase in cell area is not required for enhanced cell growth in response to GST/III1H,8–10 and suggest that ECM FN-induced growth is not due to mechanical signals triggered in response to changes in cell shape.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Fibronectin matrix polymerization promotes cellular functions critical for tissue repair, including cell growth (3–6), cell migration (7), and collagen matrix contraction (8). Fibronectin matrix polymerization also promotes collagen I deposition (9, 10) and enhances the tensile strength of collagen-based tissue constructs (11). The mechanism by which ECM fibronectin exerts its unique effect on cell function is only partially understood. We previously hypothesized that conformational changes during fibronectin matrix remodeling expose a "matricryptic," heparin-binding activity in III1 that serves to trigger cellular responses that are unique to ECM fibronectin. To test this hypothesis, we produced a recombinant fibronectin construct in which the heparin-binding fragment of FNIII1 was directly linked to the integrin-binding FNIII8–10 modules (GST/III1H,8–10). We found that treatment of cells with GST/III1H,8–10 stimulates cell growth, contractility, and migration to a similar extent as ECM fibronectin (7, 32). The interaction of GST/III1H,8–10 with cell surfaces appears to be mediated by HSPGs (32).


Figure 8
View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 8.
Cell area expansion and growth require both integrin- and heparin-binding activities. FN-null MFs were allowed to adhere and spread on collagen I-coated wells for 4 h. Cells were then treated with 250 nM of the various GST/III1H,8–10 constructs. A, 2 h after treatment, cells were fixed and areas were determined as described in the legend to Fig. 6. Data are presented as mean cell area (µm2) ± S.E. of at least 50 cells per condition. B, 4 days after addition of recombinant proteins, cells were fixed and cell number was determined. Data are presented as -fold increase in cell number over control (growth in the presence of GST). *, p < 0.05 versus GST.

 
In the present study, we extended this work by localizing the functional heparin-binding site of FNIII1H to the basic amino acids Arg613, Trp614, Arg615, and Lys617. The 609KYILRWRPK sequence in FNIII1 is unique among the type III repeats of fibronectin and is highly conserved among species (45). Human, rat, and mouse fibronectin sequences are identical in this region; Arg613 is substituted with a lysine in Xenopus and bovine fibronectin. Cell spreading and growth in response to the fibronectin matrix mimetic required the Lys609-Arg613-Trp614-Arg615-Lys617 residues of FNIII1 as well as integrin ligation. Constructs containing single integrin-binding domain mutations (GST/III1H,8–10RGE and GST/III1H,8–10{Delta}Syn) retained the ability to promote cell growth, whereas the double integrin-binding mutant, GST/III1H,8–10{Delta}Syn/RGE, did not. These findings suggest that ligation of {alpha}5beta1 integrins by either the RGD site in FNIII10 or the synergy site in FNIII9 is sufficient to promote cell growth when coupled with FNIII1 binding to its receptor. These results indicate that an {alpha}5beta1-dependent, but RGD-independent, response can by stimulated by ECM fibronectin. These results are consistent with previous observations that ECM fibronectin can stimulate cell growth by an RGD-independent, heparin-dependent mechanism (38). Interestingly, cell growth in response to GST/III1H,8–10 requires that the III1H module be co-expressed with III8–10 (32), suggesting that a physical interaction between the FNIII1 HSPG receptor and {alpha}5beta1 integrins may be necessary for the integrin-mediated response.


Figure 9
View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 9.
Effect of GST/III1H,8–10 on the area and growth of cells adherent to various ECM substrates. FN-null MFs were seeded on wells coated with collagen (COL), fibrinogen (FBG), vitronectin (VN; 1 µg/ml), or laminin (LN) and incubated for 4 h. Cells were then treated for an additional 2 h(A) or 4 days (B) with 250 nM GST/III1H,8–10 or GST. Cell area and growth were determined as described in the legend to Fig. 6. Data are presented as mean ± S.E. of two independent experiments. *, p < 0.05 versus GST control.

 
Our data suggest that the heparin-binding site of FNIII1 can enhance {alpha}1beta1/{alpha}2beta1 responses, as seen in collagen gel contraction assays presented in Fig. 1A, as well as {alpha}5beta1-mediated responses, as observed in the cell spreading and growth response to GST/III1H,8–10 (Fig. 8). The mechanism by which FNIII1 modulates beta1 integrin function is currently unknown. HSPGs are known to function as co-receptors to modify integrin-mediated responses (46). A recombinant fibronectin construct containing both the C-terminal heparin-binding III13 module and the integrin-binding III7–11 domain (GST/III7–11,13) supports cell spreading and stress fiber formation when applied as an adhesive substrate (47). In the present study, we utilized a similar construct (GST/III8–10,13) to assess the specificity of the FNIII1H module in enhancing cell area. When added in solution, GST/III8–10,13 did not increase the area of cells previously spread on a collagen substrate, consistent with the observation that GST/III8–10,13 is also unable to promote collagen gel contraction or enhance cell growth (32). The increase in cell area in response to fibronectin was associated with morphological changes indicative of a switch from isotropic to anisotropic cell spreading (results not shown). As such, distinct intracellular mechanisms may control cell area immediately following cell attachment to substrate-bound fibronectin monomers, where isotropic spreading and FNIII13 signaling predominate (47), versus during fibronectin matrix formation or remodeling, when anisotropic spreading and FNIII1 signaling occur. The downstream effects of both FNIII13 and FNIII1H are mediated by HSPGs (32, 47, 48). As such, additional interactions, possibly involving the core protein of proteoglycans (46), may contribute to the subsequent generation of distinct intracellular signals that modulate cell spreading. The dissimilar effects of GST/III1H,8–10 and GST/III8–10,13 on cytoskeletal reorganization and cell spreading may also result from their different subcellular localization, as GST/III1H,8–10 co-localizes with HSPGs in lipid rafts, whereas GST/III8–10,13 localizes to focal contacts (32). A similar partitioning of the syndecan and glypican families of HSPGs has been observed (46, 49).


Figure 10
View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 10.
Cell area expansion is not required for GST/III1H,8–10-induced growth. FN-null MFs were seeded on wells coated with collagen (COL), fibronectin (FN), or vitronectin (VN; 10 µg/ml) and incubated for 4 h. Cells were then treated for an additional 2 h (A) or 4 days (B) with 250 nM GST/III1H,8–10 or GST. Cell area and growth were determined as described in the legend to Fig. 6. Data are presented as mean ± S.E. of four independent experiments. *, p < 0.05 versus GST control.

 
Fibronectin increased cell area by transiently increasing the rate of cell spreading from 103.7 to 632.4 µm2/h. These results are consistent with previous data obtained from laminin-adherent hepatocytes that demonstrated an initial spreading rate of 740 µm2/h (34). The rapid increase in cell area in response to fibronectin, combined with our data indicating a role for the ECM form of fibronectin in cell spreading, suggests that FNIII1-mediated responses arise from early changes in fibronectin conformation that are initiated upon binding of fibronectin to the cell surface (20), and not from the formation of extensive fibronectin fibrils per se. The increase in cell area in response to fibronectin and GST/III1H,8–10 is accompanied by the formation of lamellopodia (not shown). Hence, it is likely that enhanced cell spreading and lamellopodia formation are key steps that mediate the increased rates of cell migration observed in response to ECM fibronectin and GST/III1H,8–10 (7).

Actin polymerization provides the driving force for cell spreading (50), whereas membrane tension generated by membrane-cytoskeletal adhesions (51) restricts spreading (42). Therefore, the appearance of a plateau following the rapid increase in cell area of fibronectin-treated cells may indicate that cells have reached a maximal area. Similarly, for cells spread on fibronectin or vitronectin, the absence of an increase in cell area in response to GST/III1H,8–10 may be due to the limitation of cell area. Approximately 4 h after the initiation of the plateau phase, spreading of fibronectin-treated cells resumed at a rate similar to control (PBS-treated) cells. The stimulus that reinitiated cell spreading is not known, but may be related to increased cell mass and/or renewed availability of adhesion receptors (41).

Several studies have provided evidence that changes in cell growth are tightly coupled to changes in cell area (37, 52). Others suggest that cell spreading may serve a permissive role for integrin-mediated proliferation (53). During cell spreading, changes in the conformation of the actin cytoskeleton may physically recruit and/or cluster signaling molecules that regulate cell growth (44). Our data indicate that whereas ECM FN can promote cell spreading, increased cell area is not the mechanism by which ECM fibronectin increases the rate of cell growth. Moreover, our data provide evidence that under certain circumstances, increased cell growth can be uncoupled from changes in cell area. These findings are important for understanding mechanisms that control ECM fibronectin-induced cell growth in vivo, as the inability to increase cell area and hence, cytoskeletal tension (42), in intact tissue may normally serve to limit the cellular response to growth signals.

The amino acid residues involved in GST/III1H,8–10-induced cell spreading and growth, Arg613-Trp14-Arg615, contribute to the 9D2 epitope. Furthermore, 9D2 blocks GST/III1H,8–10-stimulated cell growth as well as fibronectin-induced cell spreading. The 9D2 antibody has been shown to inhibit several other fibronectin-stimulated cell functions, including cell growth (3), cell migration (7), and collagen gel contraction (8). 9D2 mAb inhibits fibronectin matrix polymerization in a variety of cell types including dermal fibroblasts (29), aortic smooth muscle cells (9), microvascular endothelial cells (9), as well as the FN-null myofibroblasts (3). 9D2 mAb does not block fibronectin matrix polymerization in small airway epithelial cells, but does inhibit migration (7), suggesting that 9D2 affects migration in these cells by directly blocking the Arg613-Trp614-Arg15 site in ECM fibronectin. Taken together, these data support the hypothesis that ECM fibronectin regulates cell behavior, in part, through the cell-dependent exposure of a neoepitope within the conformationally labile FNIII1 module. Decreasing intracellular cytoskeletal tension preferentially reduces the appearance of an FNIII1 epitope (30), suggesting that exposure of the matricryptic site in FNIII1 may be dynamically regulated. If so, reduced cellular tension on ECM fibrils may impair tissue remodeling by "closing" matricryptic FNIII1 sites that would normally stimulate cell growth, collagen fibril contraction, and re-epithelialization of injured tissues. Novel therapeutic approaches that provide injured cells with synthetic fibronectin matrix mimetics may circumvent either diminished fibronectin matrix assembly or decreased expression of matricryptic FNIII1 sites and hence, accelerate wound repair by providing tissues with ECM fibronectin-specific signals.


   FOOTNOTES
 
* This work was supported by Grants EB00986 and HL64074 from the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Both authors contributed equally to this work. Back

2 To whom correspondence should be addressed: Box 711, 601 Elmwood Ave., Rochester, NY 14642. Tel.: 585-273-1770; Fax: 585-273-2652; E-mail: denise_hocking{at}urmc.rochester.edu.

3 The abbreviations used are: ECM, extracellular matrix; GST, glutathione S-transferase; FNIII, fibronectin type III repeat; FN-null MF, fibronectin-null myofibroblast; HSPGs, heparan sulfate proteoglycans; PBS, phosphate-buffered saline; mAb, monoclonal antibody. Back


   ACKNOWLEDGMENTS
 
We thank Susan Wilke-Mounts for excellent technical assistance, Jane Sottile for the FN-null cells, and Deane Mosher for the 9D2 antibody.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hynes, R. O., and Yamada, K. M. (1982) J. Cell Biol. 95, 369–377[Free Full Text]
  2. Wierzbicka-Patynowski, I., and Schwarzbauer, J. E. (2003) J. Cell Sci. 116, 3269–3276[Abstract/Free Full Text]
  3. Sottile, J., Hocking, D. C., and Swiatek, P. J. (1998) J. Cell Sci. 111, 2933–2943[Abstract]
  4. Sechler, J. L., and Schwarzbauer, J. E. (1998) J. Biol. Chem. 273, 25533–25536[Abstract/Free Full Text]
  5. Bourdoulous, S., Orend, G., MacKenna, D. A., Pasqualini, R., and Ruoslahti, E. (1998) J. Cell Biol. 143, 267–276[Abstract/Free Full Text]
  6. Mercurius, K. O., and Morla, A. O. (1998) Circ. Res. 82, 548–556[Abstract/Free Full Text]
  7. Hocking, D. C., and Chang, C. H. (2003) Am. J. Physiol. 285, L169–L179
  8. Hocking, D. C., Sottile, J., and Langenbach, K. J. (2000) J. Biol. Chem. 275, 10673–10682[Abstract/Free Full Text]
  9. Sottile, J., and Hocking, D. C. (2002) Mol. Biol. Cell 13, 3546–3559[Abstract/Free Full Text]
  10. Velling, T., Risteli, J., Wennerberg, K., Mosher, D. F., and Johansson, S. (2002) J. Biol. Chem. 277, 37377–37381[Abstract/Free Full Text]
  11. Gildner, C. D., Lerner, A. L., and Hocking, D. C. (2004) Am. J. Physiol. 287, H46–H53
  12. Ohashi, T., Kiehart, D. P., and Erickson, H. P. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 2153–2158[Abstract/Free Full Text]
  13. Balaban, N. Q., Schwarz, U. S., Riveline, D., Goichberg, P., Tzur, G., Sabanay, I., Mahalu, D., Safran, S., Bershadsky, A., Addadi, L., and Geiger, B. (2001) Nat. Cell Biol. 3, 466–472[CrossRef][Medline] [Order article via Infotrieve]
  14. Erickson, H. P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10114–10118[Abstract/Free Full Text]
  15. Morla, A., Zhang, Z., and Ruoslahti, E. (1994) Nature 367, 193–196[CrossRef][Medline] [Order article via Infotrieve]
  16. Morla, A., and Ruoslahti, E. (1992) J. Cell Biol. 118, 421–429[Abstract/Free Full Text]
  17. Bultmann, H., Santas, A. J., and Peters, D. M. P. (1998) J. Biol. Chem. 273, 2601–2609[Abstract/Free Full Text]
  18. Hocking, D. C., Sottile, J., and McKeown-Longo, P. J. (1994) J. Biol. Chem. 269, 19183–19191[Abstract/Free Full Text]
  19. Hocking, D. C., Smith, R. K., and McKeown-Longo, P. J. (1996) J. Cell Biol. 133, 431–444[Abstract/Free Full Text]
  20. Baneyx, G., Baugh, L., and Vogel, V. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 14464–14468[Abstract/Free Full Text]
  21. Petersen, T. E., Thogersen, H. C., Skorstengaard, K., Vibe-Pedersen, K., Sahl, P., Sottrup-Jensen, L., and Magnusson, S. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 137–141[Abstract/Free Full Text]
  22. Bork, P., and Doolittle, R. F. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 8990–8994[Abstract/Free Full Text]
  23. Leahy, D. J., Hendrickson, W. A., Ankhil, I., and Erickson, H. P. (1992) Science 258, 987–991[Abstract/Free Full Text]
  24. Oberhauser, A. F., Badilla-Fernandez, C., Carrion-Vazquez, M., and Fernandez, J. M. (2002) J. Mol. Biol. 319, 433–447[CrossRef][Medline] [Order article via Infotrieve]
  25. Gao, M., Craig, D., Lequin, O., Campbell, I. D., Vogel, V., and Schulten, K. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 14784–14789[Abstract/Free Full Text]
  26. Hynes, R. O. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 2588–2590[Free Full Text]
  27. Litvinovich, S. V., Novokhatny, V. V., Brew, S. A., and Ingham, K. C. (1992) Biochim. Biophys. Acta 1119, 57–62[CrossRef][Medline] [Order article via Infotrieve]
  28. Aguirre, K. M., McCormick, R. J., and Schwarzbauer, J. E. (1994) J. Biol. Chem. 269, 27863–27868[Abstract/Free Full Text]
  29. Chernousov, M. A., Fogerty, F. J., Koteliansky, V. E., and Mosher, D. F. (1991) J. Biol. Chem. 266, 10851–10858[Abstract/Free Full Text]
  30. Zhong, C., Chrzanowska-Wodnicka, M., Brown, J., Shaub, A., Belkin, A. M., and Burridge, K. (1998) J. Cell Biol. 141, 539–551[Abstract/Free Full Text]
  31. Baneyx, G., Baugh, L., and Vogel, V. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 5139–5143[Abstract/Free Full Text]
  32. Hocking, D. C., and Kowalski, K. (2002) J. Cell Biol. 158, 175–184[Abstract/Free Full Text]
  33. Miekka, S. I., Ingham, K. C., and Menache, D. (1982) Thromb. Res. 27, 1–14[CrossRef][Medline] [Order article via Infotrieve]
  34. Mooney, D. J., Langer, R., and Ingber, D. E. (1995) J. Cell Sci. 108, 2311–2320[Abstract]
  35. Miller, T. M., Tansey, M. G., Johnson, E. M., Jr., and Creedon, D. J. (1997) J. Biol. Chem. 272, 9847–9853[Abstract/Free Full Text]
  36. Briknarova, K., Akerman, M. E., Hoyt, D. W., Ruoslahti, E., and Ely, K. R. (2003) J. Mol. Biol. 332, 205–215[CrossRef][Medline] [Order article via Infotrieve]
  37. Chen, C. S., Mrksich, M., Huang, S., Whitesides, G. M., and Ingber, D. E. (1997) Science 276, 1425–1428[Abstract/Free Full Text]
  38. Sottile, J., Hocking, D. C., and Langenbach, K. J. (2000) J. Cell Sci. 113, 4287–4299[Abstract]
  39. Berrier, A. L., Mastrangelo, A. M., Downward, J., Ginsberg, M., and LaFlamme, S. E. (2000) J. Cell Biol. 151, 1549–1560[Abstract/Free Full Text]
  40. Dubin-Thaler, B. J., Giannone, G., Dobereiner, H. G., and Sheetz, M. P. (2004) Biophys. J. 86, 1794–1806[Abstract/Free Full Text]
  41. Dunn, G. A., and Zicha, D. (1995) J. Cell Sci. 108, 1239–1249[Abstract]
  42. Raucher, D., and Sheetz, M. P. (2000) J. Cell Biol. 148, 127–136[Abstract/Free Full Text]
  43. Choquet, D., Felsenfeld, D. P., and Sheetz, M. P. (1997) Cell 88, 39–48[CrossRef][Medline] [Order article via Infotrieve]
  44. Sawada, Y., and Sheetz, M. P. (2002) J. Cell Biol. 156, 609–615[Abstract/Free Full Text]
  45. Petersen, T. E., Skorstengaard, K., and Vibe-Pedersen, K. (1989) in Fibronectin (Mosher, D. F., ed) pp. 1–24, Academic Press, New York
  46. Woods, A. (2001) J. Clin. Investig. 107, 935–941[Medline] [Order article via Infotrieve]
  47. Bloom, L., Ingham, K. C., and Hynes, R. O. (1999) Mol. Biol. Cell 10, 1521–1536[Abstract/Free Full Text]
  48. Tumova, S., Woods, A., and Couchman, J. R. (2000) J. Biol. Chem. 275, 9410–9417[Abstract/Free Full Text]
  49. Fransson, L. A. (2003) Int. J. Biochem. Cell Biol. 35, 125–129[CrossRef][Medline] [Order article via Infotrieve]
  50. Pollard, T. D., and Borisy, G. G. (2003) Cell 112, 453–465[CrossRef][Medline] [Order article via Infotrieve]
  51. Sheetz, M. P., and Dai, J. (1996) Trends Cell Biol. 6, 85–89[CrossRef][Medline] [Order article via Infotrieve]
  52. Folkman, J., and Moscona, A. (1978) Nature 273, 345–349[CrossRef][Medline] [Order article via Infotrieve]
  53. Davey, G., Buzzai, M., and Assoian, R. K. (1999) J. Cell Sci. 112, 4663–4672[Abstract]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg