Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M601320200 on September 17, 2006

J. Biol. Chem., Vol. 281, Issue 46, 35137-35146, November 17, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/46/35137    most recent
M601320200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wei, Y.
Right arrow Articles by Stump, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wei, Y.
Right arrow Articles by Stump, C. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Angiotensin II-induced NADPH Oxidase Activation Impairs Insulin Signaling in Skeletal Muscle Cells*

Yongzhong Wei{ddagger}§, James R. Sowers{ddagger}§1, Ravi Nistala{ddagger}§, Heping Gong{ddagger}§, Grace M.-E. Uptergrove{ddagger}§, Suzanne E. Clark{ddagger}§, E. Matthew Morris{ddagger}§, Nicholas Szary{ddagger}§, Camila Manrique{ddagger}§, and Craig S. Stump{ddagger}§2

From the {ddagger}Department of Internal Medicine and the Department of Pharmacology and Physiology, University of Missouri-Columbia 65212 and the §Harry S. Truman Memorial Veterans Medical Center, Columbia, Missouri 65201

Received for publication, February 10, 2006 , and in revised form, September 12, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The renin-angiotensin system (RAS) and reactive oxygen species (ROS) have been implicated in the development of insulin resistance and its related complications. There is also evidence that angiotensin II (Ang II)-induced generation of ROS contributes to the development of insulin resistance in skeletal muscle, although the precise mechanisms remain unknown. In the present study, we found that Ang II markedly enhanced NADPH oxidase activity and consequent ROS generation in L6 myotubes. These effects were blocked by the angiotensin II type 1 receptor blocker losartan, and by the NADPH oxidase inhibitor apocynin. Ang II also promoted the translocation of NADPH oxidase cytosolic subunits p47phox and p67phox to the plasma membrane within 15 min. Furthermore, Ang II abolished insulin-induced tyrosine phosphorylation of insulin receptor substrate 1 (IRS1), activation of protein kinase B (Akt), and glucose transporter-4 (GLUT4) translocation to the plasma membrane, which was reversed by pretreating myotubes with losartan or apocynin. Finally, small interfering RNA (siRNA)-specific gene silencing targeted specifically against p47phox (p47siRNA), in both L6 and primary myotubes, reduced the cognate protein expression, decreased NADPH oxidase activity, restored Ang II-impaired IRS1 and Akt activation as well as GLUT4 translocation by insulin. These results suggest a pivotal role for NADPH oxidase activation and ROS generation in Ang II-induced inhibition of insulin signaling in skeletal muscle cells.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Insulin resistance and hypertension often coexist and frequently progress to diabetes and cardiovascular disease (1, 2). A reduced response by target tissues to insulin (3) is the hallmark of the metabolic syndrome (1-5), which is defined by a cluster of abnormalities including impaired glucose tolerance, hypertension, abdominal obesity, and dyslipidemia (6). Insulin signaling is a complex process involving multiple pathways and phosphorylation events. Phosphorylation of protein kinase B (Akt) is a key step leading to the translocation of glucose transporter 4 (GLUT4)2 from intracellular compartments to the plasma membrane. GLUT4 helps mediate the increase in glucose uptake in skeletal muscle and adipose tissues in the presence of insulin (7, 8). Skeletal muscle insulin receptor signaling is defective in metabolic syndrome and type 2 diabetes mellitus (T2DM) both in experimental models and humans (1-6;9). Many factors have been reported to induce insulin resistance in vitro and in vivo, including angiotensin II (Ang II), tumor necrosis factor (TNF)-{alpha}, interleukin 6 (IL-6), and free fatty acids (10-13).

Ang II is an important physiological regulator of blood pressure, cardiac function, and salt and fluid homeostasis. Its hypertensive, growth, and remodeling effects are mediated through the Ang II receptor 1 (AT1R) (1, 5, 11). In addition, Ang II appears to be antagonistic to insulin action and contributes to insulin resistance. Several prospective clinical studies have shown that treating hypertensive patients with angiotensin converting enzyme (ACE) inhibitors or AT1R blockers results in a lesser incidence of newly diagnosed T2DM when compared with other anti-hypertensive agents (14-16). Furthermore, Ang II acting through the AT1R is known to stimulate NADPH oxidase, which generates reactive oxygen species (ROS) in a variety of cells (5). Indeed, ROS production by NADPH oxidase activation has been strongly associated with hypertension and insulin resistance in vascular tissue (17).

NADPH oxidase is a highly regulated membrane-bound enzyme complex that catalyzes the one-electron reduction of oxygen to superoxide anion with the simultaneous oxidation of cytosolic NADPH (17-19). Components of NADPH oxidase complex of phagocytes include the membrane-bound cytochrome b558, composed of 2 subunits, p22phox and gp91phox, and 4 cytosolic subunits, p47phox, p67phox, p40phox, and the small GTP-binding protein, Rac1/Rac2 (18, 19). Moreover, expression of gp91phox, p22phox, p47phox, and p67phox have been documented in skeletal muscle (20). Activation of NADPH oxidase in phagocytes, which have been studied most extensively, involves the translocation of cytosolic subunit proteins p47phox and p67phox to the plasma membrane (18, 19). This is regulated in part by the interaction between p47phox and p67phox each harboring two SH3 domains for which deletion or substitution of residues disrupt interaction and diminish enzyme activation (21). Key to activating NADPH oxidase is p47phox, which forms a stable complex with the cytoplasmic region of the membranebound cytochrome b558 (22) and promotes p67phox recruitment to the membrane via SH3-mediated tail-tail interaction (21, 23, 24). It has also been shown that p47phox may regulate gp91phox, Nox1, and other Nox family members (25). Although effects of Ang II via ROS on vascular smooth muscle cells, endothelial cells, and adipocytes have been intensively studied, Ang II effects on skeletal muscle remain largely unknown. Increased superoxide content has been noted in skeletal muscle with local elevated Ang II levels (10). However, whether Ang II-induced ROS production in skeletal muscle is mainly through NADPH oxidase and consequently contributes to insulin resistance in skeletal muscle remains unclear.

In the present investigation, we demonstrated that Ang II increased NADPH oxidase activity, thereby increasing ROS generation and impairing insulin-induced insulin receptor substrate (IRS1) tyrosine phosphorylation, Akt activation, and GLUT4 translocation to plasma membranes. In addition, blocking AT1R by losartan or inhibiting NADPH oxidase by apocynin suppressed ROS production and restored insulin stimulated IRS1 and Akt activation and GLUT4 translocation. Furthermore, knockdown of p47phox utilizing p47 siRNA-reduced NADPH oxidase activity and improved insulin-mediated Akt phosphorylation and GLUT4 translocation in the presence of Ang II.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—siRNA targeted against p47phox, scrambled control siRNA, fluorescein conjugate siRNA, and siRNA transfection reagent were from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies against p67phox and p47phox were purchased from Santa Cruz Biotechnology. Antibodies for Akt and phospho-Akt (Ser473), IRS1, phospho-IRS1 were purchased from Upstate Signaling Technology (Beverly, MA) and Abcam Inc (Cambridge, MA). Angiotensin II, insulin, and NADPH, diphenyleneiodonium (DPI), apocynin, NG-nitro-L-arginine methyl ester (L-NAME), oxypurinol, and rotenone were purchased from Sigma. Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), and antibiotic-antimycotic solution (10,000 units/ml penicillin G, 10 mg/ml streptomycin, and 25 mg/ml amphotericin B) were purchased from Invitrogen.

Cell Culture—L6 rat skeletal muscle cells (American Type Culture Collection) were grown in DMEM with 10% (v/v) FBS and 1% v/v antibiotic-antimycotic solution (10,000 units/ml penicillin G, 10 mg/ml streptomycin, and 25 mg/ml amphotericin B) at 5% CO2 and 37 °C until ~80% confluency. To induce differentiation, cells were further cultured in DMEM containing 2% FBS for 6-8 days. Cells were fed fresh medium every 48 h and used at the stage of myotubes (60-70%) when GLUT4 expression is highest (26). Myogenic differentiation to myotubes was confirmed by light microscopy with morphological alignment, elongation, and fusion.

Primary skeletal muscle cells were prepared from Sprague-Dawley rats according to the methods as previously described (27), with some modifications. Animals were anesthetized with a single intraperitoneal injection of pentobarbital. The gastrocnemius and EDL muscles were removed and washed in sterile PBS, pH 7.4 to remove blood cells, trimmed of excess connective tissue and fat, and homogenized with scissors in sterile PBS, and subjected to enzymatic digestion by incubation at 37 °C in DMEM with 0.2% collagenase for 1 h and centrifuged at 1,500 x g. Pellets were then resuspended in sterile PBS, mixed with a vortex mixer for 20 s, and centrifuged for 10 min at 500 x g. The supernatant containing the cell fraction was removed, followed by centrifugation at 1,500 x g for 5 min. Cell pellets were pooled and resuspended in DMEM with 10% horse serum and 1% penicillin/streptomycin antibiotic solution and passed through sterile 40 µm cell strainer (BD Biosciences). The filtered suspension was centrifuged again at 1,500 x g, and the pellet was then resuspended in 10 volumes of DMEM containing 10% horse serum and 1% penicillin/streptomycin and plated onto uncoated 100-mm dishes for 3 h in a 37°C incubator humidified with 5% CO2. The unattached cells floating in the medium after the 3 h of incubation were then transferred onto a fresh dish, and this procedure was repeated twice. The cells were further purified using magnetic beads coated with anti-desmin antibody (Hybridoma, ATCC). The isolated satellite cells were cultured on rat-tail collagen-coated plates in high serum medium (Ham's F-10 nutrient mixture containing 20% fetal bovine serum, 1% chicken embryo extract, 1% penicillin/streptomycin, and 1% glutamine). The cells were counted using a hemacytometer and seeded at 1 x 105 cells per well on a 6-well plate in 2 ml of F-10 with 10% FBS until ~80% confluency. To induce differentiation, cells were further cultured in DMEM containing 2% FBS for 6-8 days.

Transfection of siRNA—L6 and primary myotubes were transfected with p47siRNA (sc-45918), control siRNA (sc-37007), control siRNA fluorescein conjugate (sc-36869, sc-44239) as per the manufacturer's instruction with minor modifications (28). The differentiation medium was changed to antibiotic-free medium on day 4, and 0.6 µg of siRNA was transfected using transfection reagent in transfection medium. 6 h after transfection, DMEM containing 4% FBS was added to each well to a final concentration of 2% FBS (v/v). Cells were transfected again on day 6 with 1 µg of siRNA. 6 h after transfection, the cells were further incubated with Ang II for additional 24 h. In some experiments, the cells were further stimulated with insulin for 30 min, as detailed in figure legends.

Cellular Uptake of Fluorescent-labeled siRNA—Transfection efficiency was determined by incubating myotubes with a control fluorescent-labeled siRNA, using the above transfection methods. Fluorescence was visualized using confocal microscopy. Nuclei were stained with 4,6-diamidino-2-phenylindole dihydrochloride (DAPI, blue) and fluorescent siRNA accumulated in the perinuclear region (green, Fig. 3B). By comparing perinuclear fluorescence and blue-stained nuclei in ~50 cells in five representative fields from different plates, the percentage of fluorescent-positive relative to total nuclei was 72 ± 2% in L6 myotubes.


Figure 1
View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 1.
A, effect of Ang II on generation of ROS in L6 myotubes. L6 myotubes were incubated in low glucose DMEM in the absence or presence of Ang II (10-7 M), losartan (10-6 M), and/or apocynin (200 µM) 24 h. Emission of relative light units was measured, corrected for nonspecific luminescence in the absence of cells, and compared with untreated myotubes. The results represent the mean ± S.E. of three independent experiments conducted in triplicate. #, p < 0.05 compared with untreated L6 myotubes; **, p < 0.05 versus Ang II treatment. B, effect of Ang II treatment on L6 myotubes ROS generation was detected by dihydroethidium. Fluorescent photomicrographs of confocal microscopic slides of L6 myotubes: panel a, without treatment; panel b, Ang II (10-7 M); panel c, Ang II plus AT1R blocker losartan (10-6 M); panel d, NADPH oxidase inhibitor apocynin (200 µM).

 
NADPH Oxidase Activity—After 6 h of incubation in serum-free DMEM supplemented with 0.1% bovine serum albumin, L6 myotubes were treated with various concentrations (10-9 to 10-6 M) of Ang II for 24 h. In other experiments, L6 myotubes were stimulated with Ang II for 24 h in the absence or presence of apocynin (200 µM), which blocks association of p47phox with membrane-associated subunits, p22phox and gp91phox (29), or with losartan (10-6 M), a blocker of AT1R. Subcellular fractionation of myotubes was performed as previously described (20), with minor modifications. Myotubes were washed with ice-cold PBS, scraped gently from 10-cm plates, centrifuged at 1000 x g for 10 min, resuspended in 300 µl of homogenization buffer (50 mM phosphate buffer, 0.01 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 2 µM leupeptin, 2 µM pepstatin A, pH 7.4) and placed on ice. The myotubes were then homogenized using a Duall homogenizer and sonication. An aliquot of the total homogenate was saved, and the remaining homogenate was then centrifuged at 13,000 x g for 20 min, 4 °C, the supernatant was collected and was further centrifuged at 100,000 x g for 90 min at 4 °C with the resulting supernatant yielding the plasma membrane-enriched fractions (PM). Homogenate (50 µg of protein) was incubated with NADPH (100 µM) at 37 °C, and the rate of NADPH consumption monitored by measuring the decline in absorbance (340 nm) every 10 min, using a plate reader spectrophotometer (Bio-Tek EL808). To verify NADPH oxidase contribution and exclusion of other molecular sources of NADPH consumption, the procedure was repeated in the presence of DPI (2 µM), L-NAME (1 mM), apocynin (200 µM), oxypurinol (100 µM), or rotenone (250 µM) (10, 11, 29) (Table 1).


View this table:
[in this window]
[in a new window]
  		TABLE 1
Effect of various inhibitors on NADPH oxidase activity in L6 myotubes L6 myotubes were stimulated with Ang II (10–7 M) for 24 h. Plasma membrane fractions were isolated, and NADPH oxidase activity was measured as described above. Plasma membrane proteins (50 µg) were incubated with NADPH (100 µM) in reaction buffer with or without various inhibitors at 37°C, and the rate of NADPH consumption monitored by measuring the decline in absorbance (340 nm) every 10 min, using a plate reader spectrophotometer (Bio-Tek EL808).

 
Lucigenin-enhanced Chemiluminescence Detection of ROS in Myotubes—ROS production was measured using a lucigenin method (30) with minor modifications, as previously described (31). Briefly, 1 x 105 of L6 myoblasts/well was plated in 6-well plates and cultured with DMEM with low glucose and 2% FBS for 6-8 days. The resulting L6 myotubes were treated with Ang II (10-7 M) for 24 h in the absence or presence of losartan (10-6 M), or apocynin (200 µM) (11, 29). The cells were then trypsinized, collected by centrifugation, and the pellet washed in modified Krebs buffer containing NaCl (130 mM), KCl (5 mM), MgCl2 (1 mM), CaCl2 (1.5 mM), K2HPO4 (1 mM), and Hepes (20 mM), pH 7.4. After washing, the cells were resuspended in Krebs buffer with 1 mg/ml bovine serum albumin. To measure ROS production, the cell suspension was transferred into plastic tubes with lucigenin (5 µM final concentration). Photon emission was counted for 20 min. Modified Krebs buffer was used as control (blank).

Oxidative Fluorescence Microphotography—Superoxide generation in L6 myotubes was evaluated by use of the oxidative fluorescent dye dihydroethidium (DHE). L6 myotubes were cultured in chamber slides and treated as above. After washing with icecold PBS, L6 myotubes were incubated with DHE 1 µM/l in a light-protected humidified chamber at 37 °C for 10 min. DHE specifically reacts with intracellular superoxide and is converted to the red fluorescent compound ethidium, which then binds irreversibly to double-stranded DNA and appears as punctuate nuclear staining (32). The specificity of DHE signals for Formula detection was confirmed by preincubation with polyethylene glycol-superoxide dismutase (PEG-SOD, 500 units/ml, Sigma).

mRNA Transcripts by Real Time PCR—L6 cells were grown under the conditions specified above. They were treated in the same way as for protein extraction. The cells were scraped off in ice-cold PBS and separated (1000 x g). The supernatant was removed and RNA Later was added for preservation. Total mRNA was extracted using RNeasy midi-kits from Qiagen (Germany). The RNA was then subjected to an additional round of DNase1 digestion (Invitrogen). 1 µg of RNA was reverse-transcribed using RT kit from ABI Systems (Roche Applied Science). 100 ng of starting cDNA was used to run the real time reactions in 50 µl of reaction mixture under universal cycling parameters for Rac1 and p67 (20, 33, 34). The reactions were run on an ABI Prizm 7000 machine, and the results were analyzed using guidelines from ABI Prizm. PCR primers for Rac1, Forward: GTAAAACCTGCCTGCTCATC, Reverse: GCTTCGTCAAACACTGTCTTG; p67phox, Forward: CGAGGGAACCAGCTGATAGA, Reverse: CATAGGCACGCTGAGCTTCA (34).

Immunofluorescence—L6 myotubes grown on chamber slides were treated as indicated above, washed with PBS and fixed in methanol/acetone (50:50, v/v) for 10 min, and blocked with 5% goat serum containing 1% bovine serum albumin, and 0.1% saponin. Thereafter, myotubes were incubated overnight at 4 °C with goat anti-p67phox antibody at 1:200 dilutions. After three washes in PBS, rabbit anti-goat IgG antibody conjugated with Alex 568 (Molecular Probes) was added for 1 h at room temperature. Cells were extensively washed in PBS, mounted on glass slides with mounting media (Vector), and images were acquired with the fluorescence microscope (Nikon, Eclipse 50i) using Meta Imaging Software (Molecular Devices Corporation).

p47phox and p67phox Translocation—L6 myotubes were treated with Ang II for 5 min, 15 min, 30 min, 60 min, and 24 h and the plasma membrane-enriched fractions isolated by differential centrifugation see above and further centrifuged at 100,000 x g. Pellets containing the plasma membrane fractions were resuspended in homogenization buffer and analyzed by Western blot analysis using antibodies to p47phox or p67phox (1:1000). The intensities of the immunoblot bands were quantified Quantity One software (Bio-Rad). We have verified PM enriched fractions by noting robust Na+K+ ATPase {alpha}-subunit expression by Western blot and by confirming negligible citrate synthase (mitochondria activities) (data not shown). beta-Actin was used as a loading control.

Immunoprecipitation of IRS1—L6 myotubes or primary myotubes were treated with Ang II (10-7 M) for 24 h in the absence or presence of losartan (10-6 M) or apocynin (200 µM) or transfected with p47siRNA and then were incubated with Ang II (10-7 M) for 24 h. The cells were then stimulated with insulin for 30 min. IRS1 was immunoprecipitated from L6 myotubes or primary myotubes as described previously (35). Briefly, 1 mg of protein of whole cell lysates in lysis buffer (protease inhibitor mixture, Pierce) were incubated with IRS1-specific antibodies at 4 °C overnight under constant rotation, the antibody-antigen complex was pulled-down by protein A/G-Sepharose beads. The pelleted protein was resolved by 7.5% SDS-PAGE, and tyrosine phosphorylation of IRS1 was detected by immunoblotting with monoclonal anti-phosphotyrosine antibody.

Immunoblotting of Akt and Phospho-Akt—L6 myotubes or primary myotubes were treated with Ang II (10-7 M) for 24 h in the absence or presence of losartan (10-6 M) or apocynin (200 µM). In some experiments, the cells were transfected with p47 siRNA or control siRNA as described above and treated with Ang II (10-7 M). Thereafter, myotubes were stimulated with insulin (100 nM) for 30 min, scraped in ice-cold PBS, and homogenized with lysis buffer. Samples were centrifuged at 1000 x g for 30 min and the subsequent supernatant (S1) centrifuged at 12,000 x g for 20 min. 40 µg of proteins from this supernatant (S2) was loaded in SDS-PAGE gel and probed with rabbit anti-Akt and phospho-Akt Ser473 (1:1000) antibodies. The remaining S2 was further centrifuged at 100,000 x g for 90 min at 4 °C to pellet the plasma membrane fraction, which was resuspended in lysis buffer.

GLUT4 Membrane Translocation—L6 myotubes or primary myotubes were treated as described above (for detection phospho-Akt and total Akt). Plasma membrane proteins (40 µg) or total cell lysate were resolved by SDS-PAGE and probed with rabbit anti-GLUT4 (1:2000) antibody. The intensities of the immunoblot bands were quantified by using Quantity One software (Bio-Rad).


Figure 2
View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 2.
Effect of the Ang II treatment on the NADPH oxidase activity in L6 myotubes. A, dose-dependent activation of NADPH oxidase by Ang II. L6 myotubes were shifted to serum-free, low glucose medium for 6 h and stimulated with Ang II (10-9 M to 10-6 M) for 24 h or incubated without Ang II (Control). Membrane protein (50 µg) was used for measurement of NADPH consumption (340 nm). The results are mean ± S.E. from three experiments produced in triplicate. *, p < 0.05 versus control. B, Ang II (10-7 M)-mediated NADPH oxidase activity in L6 myotubes. L6 myotubes were treated with Ang II, Ang II plus AT1R blocker losartan (10-6 M), or NADPH oxidase inhibitor apocynin (200 µM). Results are mean ± S.E. of three experiments produced in triplicate. *, p < 0.05 versus control; **, p < 0.05 versus Ang II-treated myotubes.

 
Statistical Analysis—Values are reported as the means ± S.E. from at least three different experiments. ANOVA and Student's t test was used to determine the significance among groups. A value of p < 0.05 was considered to be statistically significant.


Figure 3
View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 3.
A, plasma membrane p47phox protein levels after Ang II (10-7 M) stimulation for 5 min, 15 min, 30 min, 60 min, and 24 h. 50 µg of plasma membrane proteins were applied per immunoblot lane. The results are mean ± S.E. of three experiments produced in triplicate. *, p < 0.05 versus control. B, uptake of fluorescent-labeled siRNA in L6 myotubes. Cells were transfected with control fluorescent-labeled siRNA (green) and bluestained nuclei. Shown here are representative areas of acetone-fixed cells. C, L6 myotubes were treated with control (scrambled) siRNA (CsiRNA) or siRNA-targeting NADPH oxidase subunit p47phox, and then the cells were stimulated with Ang II for 24 h. Total p47phox levels were shown by representative immunoblots. The results are mean ± S.E. of three experiments performed in duplicate. *, p < 0.05 Ang II versus control; #, p < 0.05 p47siRNA plus Ang II versus Ang II. D (L6 myotubes) and E (primary myotubes), myotubes were transfected with siRNA as described in C, and 50 µg of proteins were used for NADPH consumption assay as described under "Experimental Procedures." The results are mean ± S.E. of three experiments conducted in duplicate. *, p < 0.05 Ang II versus control; #, p < 0.05 p47siRNA plus Ang II versus Ang II.

 

   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Ang II-induced Activation of NADPH Oxidase and ROS Production in L6 Myotubes—ROS production was significantly increased in Ang II-treated myotubes (192%) compared with untreated L6 myotubes, which was prevented by pretreatment with losartan and apocynin (Fig. 1, A and B). To further determine whether NADPH oxidase contributed to Ang II-induced ROS production, NADPH oxidase activity was measured in plasma membrane fractions. Addition of Ang II (10-9 to 10-6 M) to L6 myotubes induced a dose-dependent activation of NADPH oxidase (Fig. 2A) with maximal activity at 10-7 M of Ang II (17.5 nmol/mg protein/min compared with 8.2 nmol/mg protein/min untreated cells). NADPH oxidase activity was markedly suppressed by losartan (10-6 M) and apocynin (200 µM) (Fig. 2B). To assess the molecular sources of NADPH consumption, the procedure was repeated in the presence of DPI (2 µM, NADPH oxidase inhibitor), L-NAME (1 mM, NOS inhibitor), apocynin (500 µM, a NADPH oxidase inhibitor), allopurinol (100 µM, xanthine oxidase inhibitor), and rotenone (250 µM, mitochondria inhibitor). NADPH consumption was inhibited by DPI and apocynin, but not by L-NAME, allopurinol, or rotenone (Table 1), suggesting that NADPH oxidase contribute to Ang II-induced ROS generation in skeletal muscle cells.

NADPH Oxidase Subunit mRNA Expression—We confirmed mRNA transcripts for p47phox, p67phox, gp91phox, and p22phox, as well as gp91phox homologs Nox-1 and Nox-4, in rat gastrocnemius muscles, using RT-PCR (data not shown) which is consistent with previous reports (20). In untreated L6 myotubes p47phox and p67phox subunits were expressed. However, gp91phox and p22phox mRNA were not detected in untreated L6 myotubes and up-regulated in Ang II-stimulated L6 myotubes (data not shown). In addition, there were strong bands for gp91phox homologs Nox-1 and Nox-4 (data not shown).

AngII-induced p47phox Expression and Translocation—NADPH oxidase activation requires participation of cytosolic factors including, p47phox, p67phox, and Rac1 which associate with gp91phox (or Nox-1, Nox-4) and p22phox at the plasma membrane (36, 37). The L6 myotubes were incubated with Ang II (10-7 M) for 5, 15, 30, 60 min, and 24 h or without Ang II. The cells were collected, plasma membrane fractions separated using differential centrifugation, and protein extracts analyzed by Western blotting with anti-p47 antibody. Ang II (10-7 M) increased p47phox subunit detected in the plasma membrane by 5 min, reached statistical significance by 15 min and remained elevated at 24-h poststimulation (Fig. 3A). Increased total cellular p47phox levels were also noted at 24 h (Fig. 3C).


Figure 4
View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 4.
Effect of Ang II on p67phox expression and translocation to plasma membranes in L6 myotubes. A, effect of Ang II (10-7 M) treatment (24 h) on total p67phox protein in L6 myotubes. Results are expressed as fold change of control for three independent experiments conducted in duplicate. *, p < 0.05 versus control; #, p < 0.05 versus Ang II treatment. B, L6 myotube immunostaining for p67phox. L6 myotubes were incubated with or without Ang II (10-7 M) and losartan (10-6 M) for 24 h. Panel a, negative control omitting primary Ab; panel b, without Ang II treatment; panel c, Ang II treatment; panel d, Ang II plus losartan. C, effect of Ang II (10-7 M) treatment on plasma membrane translocation of p67phox protein in L6 myotubes. D, p47siRNA transfection into L6 myotubes blocked Ang II-induced p67phox translocation to plasma membrane, but did not affect p67phox total protein (left panel). Right panel shows a bar graph of quantitation of p67phox in plasma membrane fractions. All data are means ± S.E. for three independent experiments conducted in duplicate. Results are expressed as arbitrary densitometry units. *, p < 0.05 versus control (untreated myotubes).

 
p67phox Expression and Translocation—To evaluate Ang II affects on the p67phox subunit, we analyzed p67phox mRNA and protein levels in myotubes with and without Ang II for 24 h. Real-time PCR results indicated that p67phox mRNA was not significantly changed with Ang II treatment (data not shown). However, Ang II increased total cellular expression of p67phox protein at 24 h (2.3-fold compared with untreated cells), which was blocked by losartan (Fig. 4A). Consistent with Western blot results, immunostaining indicated that Ang II dramatically increased fluorescence intensity of p67phox which was reduced by losartan (Fig. 4B). To examine p67phox translocation, L6 myotubes were treated with Ang II for 5 min, 15 min, 30 min, 1 h, and 24 h or without Ang II. Plasma membrane fractions were separated using differential centrifugation. Plasma membrane p67phox increase was noted by 5min of Ang II treatment, becoming significant by 15 min and remaining elevated at 24 h (Fig. 4C).

Insulin Receptor Substrate 1 (IRS1)—To examine whether Ang II affects insulin-mediated IRS1 activation through NADPH oxidase-derived ROS production, L6 myotubes were preincubated with losartan (10-6 M) or apocynin (200 µM) for 1 h and then co-treated with Ang II for 24 h. The cells were then stimulated with insulin for 30 min. As shown in Fig. 5, Ang II significantly inhibited insulin-stimulated IRS1 tyrosine phosphorylation. Blockage of AT1R with losartan or inhibiting NADPH oxidase with apocynin prevented Ang II inhibition of insulin-stimulated IRS1 tyrosine phosphorylation (Fig. 5). A similar reduction in IRS1 tyrosine phosphorylation by Ang II treatment was also observed using primary skeletal muscle cells (data not shown).

Insulin-mediated Akt Serine 473 Phosphorylation—Akt phosphorylation at serine 473 was markedly increased in L6 myotubes in the presence of insulin (2.8-fold; Fig. 6A). However, insulin-stimulated Akt phosphorylation was impaired by Ang II pretreatment (10-7 M). This Ang II-induced inhibition of insulin signaling was restored by co-incubation of either AT1R blocker losartan or NADPH oxidase inhibitor apocynin (Fig. 6A). A similar reduction of Akt phosphorylation by Ang II treatment was also noted in primary muscle cell (data not shown).

Insulin-induced Translocation of GLUT4—To determine whether impaired insulin-mediated IRS1 and Akt activation by Ang II would suppress GLUT4 translocation to the plasma membrane, L6 myotubes were pre-incubated with or without AT1R blocker losartan (10-6 M) or NADPH oxidase inhibitor apocynin (200 µM) for 1 h and then cotreated with Ang II for 24 h. Pretreated myotubes were then stimulated with insulin for 30 min. As shown in Fig. 7A, Ang II inhibited insulin-stimulated GLUT4 translocation by 59%. Both losartan and apocynin prevented Ang II inhibition of insulin-stimulated GLUT4 translocation to the plasma membrane (Fig. 7A).


Figure 5
View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 5.
Insulin-stimulated tyrosine phosphorylation of IRS1 was impaired with Ang II treatment. Myotubes were treated as described under "Experimental Procedures." Cells were lysed and IRS1 was immunoprecipitated (IP) from 1 mg of protein. Tyrosine phosphorylation of IRS1 was determined by immunoblotting (WB), results are expressed as a fold changes of control. The data are mean ± S.E. of three independent experiments produced in triplicate. *, p < 0.05 versus control; #, p < 0.05 versus insulin (Ins); **, p < 0.05 versus Ang II + Ins.

 
p47siRNA Knockdown of p47phox Protein Expression Blocked p67phox Membrane Translocation and Prevented Ang II Inhibition to Insulin Signaling—To further test the effects of NADPH oxdiase in Ang II-induced insulin resistance, we employed siRNA targeting NADPH oxidase subunit p47phox using L6 and primary myotubes. As shown in Fig. 3, p47 siRNA dramatically diminished Ang II-stimulated increase of p47phox protein levels in both L6 (Fig. 3C) and primary skeletal cells (data not shown) and NADPH oxidase activity in L6 (Fig. 3D) and primary cell culture (Fig. 3E). p47siRNA transfection of L6 myotubes also inhibited Ang II-induced p67phox translocation to plasma membrane, but did not affect total expression of p67phox (Fig. 4D). Knockdown p47phox by p47siRNA also restored insulin-stimulated IRS1 tyrosine phosphorylation in L6 cells (Fig. 5) and primary skeletal muscle cells (data not shown) and Akt activation in L6 cells (Fig. 6B) and primary skeletal muscle (data not shown). Inhibition of Ang II to insulin-mediated GLUT4 translocation to membrane was completely prevented by p47siRNA in both L6 (Fig. 7B) and primary myotubes (Fig. 7C).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
There is emerging evidence that Ang II contributes to insulin resistance in experimental animals and humans (1;3-5;10;11). It has also been shown that Ang II impairs the insulin signaling pathway in vascular smooth muscle cells (11, 38). However, the precise nature of insulin and Ang II signaling cross-talk remains unclear. Folli et al. (38) have shown in vascular smooth muscle cells that Ang II inhibits IRS-1 tyrosine phosporylation and its association to phosphoinositol 3-kinase (PI3-K). This effect was inhibited by the Ang II receptor antagonist saralasin, but not the AT1R specific inhibitor losartan. The primary finding in this investigation was that Ang II up-regulates NADPH oxidase activity and thereby increases ROS in skeletal muscle myotubes. This was coincident with diminished insulin signaling through the IRS1 and Akt pathway, which was restored by blocking the AT1R (losartan), inhibiting NADPH oxidase (apocynin), or knock-down p47phox by p47siRNA. To our knowledge, this is the first study to document NADPH oxidase involvement in Ang II-induced insulin resistance in skeletal muscle cells. Relative differences in response to the AT1R losartan between vascular smooth muscle reported previously (38) and skeletal muscle cells in the present study might be caused by the duration of Ang II and losartan administration (<10 min versus 24 h) or other cell specific signaling mechanisms.


Figure 6
View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 6.
A, total and phosphorylated (Ser473) Akt. L6 myotubes were preincubated with AT1R blocker losartan (10-6 M) or NADPH oxidase inhibitor apocynin (200 µM) for 1 h and then co-incubated with Ang II (10-7 M) 24 h. Insulin-(100 nM) stimulated (30 min) Akt phosphorylation in lysates was analyzed by Western blotting. Data are expressed in densitometry units, mean ± S.E. for three experiments performed in duplicate. *, p < 0.05 versus control; #, p < 0.05 versus Ins only; **, p < 0.05 versus Ang II + Ins. B, myotubes were transfected with siRNA targeted specifically against p47phox (p47siRNA) or control siRNA (CsiRNA) as described under "Experimental Procedures" and then incubated with Ang II (10-7 M) for 24 h and following insulin stimulation for 30 min. Total cell lysates were prepared, and 50 µg of protein was immunoblotted for total Akt or phosphor-Ser473-Akt. Insulin-stimulated Akt phosphorylation is expressed as fold changes of control, and the results represent the mean ± S.E. of three independent experiments performed in triplicate. *, p < 0.05 versus control; #, p < 0.05 versus insulin (Ins); **, p < 0.05 versus Ang II + Ins; ***, p < 0.05 versus Ang II + p47siRNA + Ins.

 


Figure 7
View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 7.
GLUT4 plasma membrane and total GLUT4 expression were determined by Western blot. A,L6 myotubes were treated with Ang II for 24 h or preincubated with losartan or apocynin for 1 h and co-treated with Ang II for 24 h. Results are expressed as fold change of untreated control and represent three independent experiments produced in duplicate. *, p < 0.01 versus control; #, p < 0.01 versus Ins; **, p < 0.05 versus Ang II + Ins. B (L6 myotubes); and C (primary myotubes), myotubes were transfected with siRNA-targeted specifically against p47phox (p47siRNA) or control siRNA (CsiRNA) as described under "Experimental Procedures" and then incubated with Ang II (10-7 M) for 24 h and following insulin stimulation for 30 min. Total cell lysates were prepared, and plasma membrane fraction were separated using differential centrifugation. 50 µg of protein was immunoblotted for total GLUT4 or plasma membrane (PM) GLUT4. Insulin-stimulated GLUT4 translocation to PM is expressed as fold changes of control, and the results represent the mean ± S.E. of three independent experiments performed in triplicate. *, p < 0.01 versus control; #, p < 0.05 versus insulin (Ins); **, p < 0.05 versus Ang II + Ins; ***, p < 0.01 versus Ang II + p47siRNA + Ins. D, plasma membrane fraction enrichment was verified by measuring Na+K+ ATPase protein under various treatment conditions (cyt, cytosolic fraction; pm, plasma membrane fraction).

 
Recently, the role of RAS in the development of insulin resistance and glucose intolerance, in addition to hypertension and vascular dysfunction, has gained attention (39). For example, angiotensin-converting enzyme (ACE) inhibition or AT1R blockade in patients with hypertension and/or cardiovascular disease resulted in a lesser incidence of newly diagnosed T2DM (14-16). Further, AT1R blockers (10) or antisense gene therapy (40) have been shown to ameliorate glucose intolerance in insulin-resistant rats.

Although improvements in peripheral blood flow may partially mediate increases in glucose disposal during ACE inhibition or AT1R blockade, there is evidence for direct Ang II effects upon skeletal muscle. For example, AT1Rs are present in skeletal muscle (41), and Ang II, directly infused into the interstitial space of canine skeletal muscle caused insulin resistance for glucose uptake that could not be attributed to hemodynamic changes (42). Furthermore, data from our laboratory (10) and others (43) have revealed diminished responses to insulin for glucose transport in isolated muscle preparations from a transgenic hypertensive rat model (Ren-2) that overexpresses tissue Ang II (9, 10). This effect was blunted when Ren-2 rats were treated for 3 weeks in vivo with AT1R blocking agent valsartan or the superoxide scavenger tempol (10). Similarly, AT1R blockade with irbesartan has been shown to improve insulin sensitivity in skeletal muscle from insulin-resistant Zucker obese rats (44).

Oxidative stress resulting from increased ROS and/or reactive nitrogen species (RNS) appears to be important in the progression of insulin resistance (5). The effects of oxidative stress on insulin signaling have been demonstrated in cultured insulin-sensitive cell lines such as 3T3-L1 adipocytes and L6 myocytes with the impairment of PI3K and Akt insulin signaling steps evident (45-48). Furthermore, the addition of anti-oxidants such as {alpha}-lipoic acid to the cultures abrogates this effect. In insulin-resistant Zucker obese rats, chronic oxidative stress is evidenced by an increased carbonyl protein levels in skeletal muscle and liver when compared with insulin-sensitive lean rats (49). Likewise, increased superoxide content has been noted in insulin-resistant Ren-2 skeletal muscle (10). Again, treatment of insulin-resistant rats with the anti-oxidants {alpha}-lipoic acid or tempol improved whole body glucose tolerance and insulin-stimulated glucose transport in isolated skeletal muscle, respectively. In T2DM patients plasma hydroperoxides, another marker of oxidative stress, are increased especially during poor metabolic control (50).

Ang II, acting through the AT1R, increases the generation of ROS in vascular cells primarily through the activation of membrane-bound NADPH oxidase (30, 51). Like phagocytic cells, vascular smooth muscle cell NADPH oxidase consists of two membrane components p22phox and gp91phox, cytosolic components p47phox and p67phox, and the small molecular weight G protein Rac1/2 (52, 53). Vascular smooth muscle and endothelial cells also express gp91phox, Nox-1 and Nox-4 (non-phagocytic oxidase) (52). The NADPH oxidase enzyme in skeletal muscle also contains multiple subunits (p22phox, gp91phox, p47phox, p67phox) (20). Importantly, this study has also confirmed previous studies (20, 54) showing robust NADPH oxidase activity in skeletal muscle, and suggests that this enzyme complex may be a significant contributor to cellular superoxide production (20, 55).

Activation of NADPH oxidase requires the translocation of the cytosolic factors, p47phox and p67phox, to the plasma membrane where these components interact with cytochrome b558 (18, 19, 23). Evidence that p47phox plays a central role in NADPH oxidase activation comes in part from p47phox(-/-) knock-out mice, which exhibit significantly lower Ang II-induced superoxide production in endothelial cells (56). It appears that p47phox is required for stable complex of cytosolic subunits with membrane-bound cytochrome b558 (22) and the recruitment of p67phox (21, 23, 24). The deletion or substitution for residues in the SH3 domains of p47phox disrupt the p47phox to p67phox interaction and leads to defective activation of the enzyme both in vivo and in vitro (21). Interestingly, in the present study using skeletal muscle cells, not only did siRNA targeting of p47phox decrease p47phox protein levels (Fig. 3C), and Ang II-induced activation of NADPH oxidase (Fig. 3, D and E), but it also inhibited p67phox translocation to the plasma membrane (Fig. 4D) whereas total p67phox protein expression in whole cell lysates did not change. These results further confirm that p47phox is a critical component for NADPH oxidase activation. However, the exact role and importance of concomitant p67phox translocation remains to be determined.

Recently, skeletal muscle superoxide production as assessed by ethidium fluorescence has been shown to be significantly enhanced in rats infused with Ang II for 2 weeks (57) and in KK-Ay diabetic mice compared with non-diabetic mice (57). Moreover, AT1R blockade with valsartan greatly attenuated the superoxide increase observed in the KK-Ay mice while no effect of AT2R blockade was observed. Heretofore, it has not been known whether the Ang II-associated increase in superoxide observed in skeletal muscle was mediated by NADPH oxidase or other ROS-producing pathways. This study indicates that NADPH oxidase is a significant contributor to Ang II-mediated ROS in skeletal muscle myotubes in culture.

Our previous results demonstrated a significant increase in superoxide anion production in soleus muscles from Ren-2 transgenic rats exhibiting increased tissue RAS (10). These results strongly support the notion that NADPH oxidase is present and active in skeletal muscle per se. Further, the present study demonstrates that NADPH oxidase mediates Ang II-induced ROS generation in rat skeletal muscle cells. Indeed, Ang II causes a dose-dependent rise of NADPH oxidase activity, and this activity is also inhibited by AT1R blocker losartan or NADPH oxidase inhibitor apocynin or p47siRNA. Furthermore, we have shown that there is an increase in p67phox and p47phox protein in the plasma membrane after Ang II stimulation, suggesting that translocation of these proteins increases NADPH oxidase activity. Thus, future targets for alleviating skeletal muscle insulin resistance might be through inhibition of RAS and/or NADPH oxidase activity.

The present study suggests that Ang II stimulated ROS generation through NADPH oxidase is associated with reduced IRS1 tyrosine phosphorylation and Akt activation. IRS1 and Akt activation steps are important to the predominant pathway by which insulin promotes GLUT4 translocation to membrane (11). Interestingly, Ang II treatment of aortic smooth muscle cells has also been shown to diminish insulin signaling through the IRS-1/PI3K pathway (38). However, several other mechanisms by which Ang II might inhibit insulin signaling have also been proposed, including protein kinase C (PKC) (58, 59), and MAP kinases (ERK1/2) (58). It has been shown that Ang II inhibited Akt activation through the AT1R in VSMCs by blocking IRS-1 function, and that the inhibition required PKC activation by Ang II (59). ERK1/2 activation by Ang II also inhibits insulin-induced glucose uptake in VSMCs (58). Studies have also shown that p38 MAPK is involved in H2O2-induced inhibition of insulin-stimulated glucose transport in skeletal muscle cells (45).

In summary, we have shown that Ang II impairs insulin-induced activation of IRS1 and Akt, and GLUT4 membrane translocation in skeletal muscle cells. This inhibition may be mediated by NADPH oxidase generation of ROS. Inhibition of NADPH oxidase may provide a new target of therapy for insulin resistance in skeletal muscles.


   FOOTNOTES
 
* This work was supported in part by VA VISN 15 and ARCD awards (to C. S. S.) and National Institutes of Health 5R01 HL073101-02 and VA Merit 0018 (to J. R. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 Present address: Dept. of Medicine, University of Arizona, Diabetes Research Center, 1656 E. Mabel St., P.O. 245218, Tucson, AZ 85724-5218. E-mail: sowers{at}email.arizona.edu. Back

2 To whom correspondence should be addressed: Dept. of Medicine, University of Arizona, Diabetes Research Center, 1656 E. Mabel St., P.O. 245218, Tucson, AZ 85724-5218. E-mail: stumpc{at}email.arizona.edu.

2 The abbreviations used are: GLUT4, glucose transporter 4; ACE, angiotensin-converting enzyme; Akt, protein kinase B; Ang II, angiotensin II; AT1R, angiotensin II-type 1 receptor; IL-6, interleukin-6; INS, insulin; NOS, nitric-oxide synthase; Nox, NADPH oxidase; PI3-K, phosphoinositol 3-kinase; RAS, renin-angiotensin system; REN-2, TG(mRen2)27 transgenic rat overexpressing the mouse renin gene; ROS, reactive oxygen species; T2DM, type 2 diabetes mellitus; TNF-{alpha}, tumor necrosis factor-{alpha}; PBS, phosphate-buffered saline; FBS, fetal bovine serum; DMEM, Dulbecco's modified Eagle's medium. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sowers, J. R. (2002) N. Engl. J. Med. 346, 1999-2001[Free Full Text]
  2. McFarlane, S. I., Banerji, M., and Sowers, J. R. (2001) J. Clin. Endocrinol. Metab. 86, 713-718[Free Full Text]
  3. Stump, C. S., Short, K. R., Bigelow, M. L., Schimke, J. M., and Nair, K. S. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 7996-8001[Abstract/Free Full Text]
  4. Sechi, L. A., Melis, A., and Tedde, R. (1992) Metabolism 41, 1261-1266[CrossRef][Medline] [Order article via Infotrieve]
  5. Sowers, J. R. (2004) Am. J. Physiol. Heart Circ. Physiol. 286, H1597-H1602[Abstract/Free Full Text]
  6. Ford, E. S., Giles, W. H., and Dietz, W. H. (2002) J. Am. Med. Assoc. 287, 356-359[Abstract/Free Full Text]
  7. Stephens, L., Anderson, K., Stokoe, D., Erdjument-Bromage, H., Painter, G. F., Holmes, A. B., Gaffney, P. R., Reese, C. B., McCormick, F., Tempst, P., Coadwell, J., and Hawkins, P. T. (1998) Science 279, 710-714[Abstract/Free Full Text]
  8. Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R., Reese, C. B., Painter, G. F., Holmes, A. B., McCormick, F., and Hawkins, P. T. (1997) Science 277, 567-570[Abstract/Free Full Text]
  9. Sloniger, J. A., Saengsirisuwan, V., Diehl, C. J., Dokken, B. B., Lailerd, N., Lemieux, A. M., Kim, J. S., and Henriksen, E. J. (2005) Am. J. Physiol. Endocrinol. Metab 288, E1074-E1081[Abstract/Free Full Text]
  10. Blendea, M. C., Jacobs, D., Stump, C. S., McFarlane, S. I., Ogrin, C., Bahtyiar, G., Stas, S., Kumar, P., Sha, Q., Ferrario, C. M., and Sowers, J. R. (2005) Am. J. Physiol. Endocrinol. Metab. 288, E353-E359[Abstract/Free Full Text]
  11. Taniyama, Y., Hitomi, H., Shah, A., Alexander, R. W., and Griendling, K. K. (2005) Arterioscler. Thromb. Vasc. Biol. 25, 1142-1147[Abstract/Free Full Text]
  12. Peraldi, P., and Spiegelman, B. (1998) Mol. Cell Biochem. 182, 169-175[CrossRef][Medline] [Order article via Infotrieve]
  13. Bays, H., Mandarino, L., and DeFronzo, R. A. (2004) J. Clin. Endocrinol. Metab. 89, 463-478[Free Full Text]
  14. Hansson, L., Lindholm, L. H., Niskanen, L., Lanke, J., Hedner, T., Niklason, A., Luomanmaki, K., Dahlof, B., de, F. U., Morlin, C., Karlberg, B. E., Wester, P. O., and Bjorck, J. E. (1999) Lancet 353, 611-616[CrossRef][Medline] [Order article via Infotrieve]
  15. Kjeldsen, S. E., Dahlof, B., Devereux, R. B., Julius, S., Aurup, P., Edelman, J., Beevers, G., de, F. U., Fyhrquist, F., Ibsen, H., Kristianson, K., Lederballe-Pedersen, O., Lindholm, L. H., Nieminen, M. S., Omvik, P., Oparil, S., Snapinn, S., and Wedel, H. (2002) J. Am. Med. Assoc. 288, 1491-1498[Abstract/Free Full Text]
  16. Yusuf, S., Sleight, P., Pogue, J., Bosch, J., Davies, R., and Dagenais, G. (2000) N. Engl. J. Med. 342, 145-153[Abstract/Free Full Text]
  17. Lassegue, B., and Clempus, R. E. (2003) Am. J. Physiol. Regul. Integr. Comp Physiol. 285, R277-R297[Abstract/Free Full Text]
  18. Abo, A., Pick, E., Hall, A., Totty, N., Teahan, C. G., and Segal, A. W. (1991) Nature 353, 668-670[CrossRef][Medline] [Order article via Infotrieve]
  19. Rotrosen, D., Yeung, C. L., Leto, T. L., Malech, H. L., and Kwong, C. H. (1992) Science 256, 1459-1462[Abstract/Free Full Text]
  20. Javesghani, D., Magder, S. A., Barreiro, E., Quinn, M. T., and Hussain, S. N. (2002) Am. J. Respir. Crit. Care Med. 165, 412-418[Abstract/Free Full Text]
  21. Mizuki, K., Takeya, R., Kuribayashi, F., Nobuhisa, I., Kohda, D., Nunoi, H., Takeshige, K., and Sumimoto, H. (2005) Arch. Biochem. Biophys. 444, 185-194[CrossRef][Medline] [Order article via Infotrieve]
  22. Watanabe, Y., Tsuboi, H., Koyama, M., Kubo, M., Del Carpio, C. A., Broclawik, E., Ichiishi, E., Kohno, M., and Miyamoto, A. (2006) Comput. Biol. Chem. 30, 303-312[CrossRef][Medline] [Order article via Infotrieve]
  23. Heyworth, P. G., Curnutte, J. T., Nauseef, W. M., Volpp, B. D., Pearson, D. W., Rosen, H., and Clark, R. A. (1991) J. Clin. Investig. 87, 352-356[Medline] [Order article via Infotrieve]
  24. de, M. I., Adams, A. G., Sokolic, R. A., Malech, H. L., and Leto, T. L. (1996) EMBO J. 15, 1211-1220[Medline] [Order article via Infotrieve]
  25. Dikalova, A., Clempus, R., Lassegue, B., Cheng, G., McCoy, J., Dikalov, S., San, M. A., Lyle, A., Weber, D. S., Weiss, D., Taylor, W. R., Schmidt, H. H., Owens, G. K., Lambeth, J. D., and Griendling, K. K. (2005) Circulation 112, 2668-2676[Abstract/Free Full Text]
  26. Mitsumoto, Y., Burdett, E., Grant, A., and Klip, A. (1991) Biochem. Biophys. Res. Commun. 175, 652-659[CrossRef][Medline] [Order article via Infotrieve]
  27. Chakravarthy, M. V., Davis, B. S., and Booth, F. W. (2000) J. Appl. Physiol. 89, 1365-1379[Abstract/Free Full Text]
  28. Huang, C., Thirone, A. C., Huang, X., and Klip, A. (2005) J. Biol. Chem. 280, 19426-19435[Abstract/Free Full Text]
  29. Touyz, R. M., Yao, G., Quinn, M. T., Pagano, P. J., and Schiffrin, E. L. (2005) Arterioscler. Thromb. Vasc. Biol. 25, 512-518[Abstract/Free Full Text]
  30. Griendling, K. K., Minieri, C. A., Ollerenshaw, J. D., and Alexander, R. W. (1994) Circ. Res. 74, 1141-1148[Abstract/Free Full Text]
  31. Hsieh, T. J., Fustier, P., Wei, C. C., Zhang, S. L., Filep, J. G., Tang, S. S., Ingelfinger, J. R., Fantus, I. G., Hamet, P., and Chan, J. S. (2004) J. Endocrinol. 183, 535-550[Abstract/Free Full Text]
  32. Tojo, T., Ushio-Fukai, M., Yamaoka-Tojo, M., Ikeda, S., Patrushev, N., and Alexander, R. W. (2005) Circulation 111, 2347-2355[Abstract/Free Full Text]
  33. Laufs, U., Adam, O., Strehlow, K., Wassmann, S., Konkol, C., Laufs, K., Schmidt, W., Bohm, M., and Nickenig, G. (2003) J. Biol. Chem. 278, 5956-5962[Abstract/Free Full Text]
  34. Szocs, K., Lassegue, B., Sorescu, D., Hilenski, L. L., Valppu, L., Couse, T. L., Wilcox, J. N., Quinn, M. T., Lambeth, J. D., and Griendling, K. K. (2002) Arterioscler. Thromb. Vasc. Biol. 22, 21-27[Abstract/Free Full Text]
  35. Huang, C., Somwar, R., Patel, N., Niu, W., Torok, D., and Klip, A. (2002) Diabetes 51, 2090-2098[Abstract/Free Full Text]
  36. Touyz, R. M., Chen, X., Tabet, F., Yao, G., He, G., Quinn, M. T., Pagano, P. J., and Schiffrin, E. L. (2002) Circ. Res. 90, 1205-1213[Abstract/Free Full Text]
  37. Touyz, R. M., Yao, G., and Schiffrin, E. L. (2003) Arterioscler. Thromb. Vasc. Biol. 23, 981-987[Abstract/Free Full Text]
  38. Folli, F., Kahn, C. R., Hansen, H., Bouchie, J. L., and Feener, E. P. (1997) J. Clin. Investig. 100, 2158-2169[Medline] [Order article via Infotrieve]
  39. Ogihara, T., Asano, T., Ando, K., Chiba, Y., Sakoda, H., Anai, M., Shojima, N., Ono, H., Onishi, Y., Fujishiro, M., Katagiri, H., Fukushima, Y., Kikuchi, M., Noguchi, N., Aburatani, H., Komuro, I., and Fujita, T. (2002) Hypertension 40, 872-879[Abstract/Free Full Text]
  40. Katovich, M. J., Reaves, P. Y., Francis, S. C., Pachori, A. S., Wang, H. W., and Raizada, M. K. (2001) J. Hypertens. 19, 1553-1558[CrossRef][Medline] [Order article via Infotrieve]
  41. van Kats, J. P., de Lannoy, L. M., Jan Danser, A. H., van, M., Jr., Verdouw, P. D., and Schalekamp, M. A. (1997) Hypertension 30, 42-49[Abstract/Free Full Text]
  42. Richey, J. M., Ader, M., Moore, D., and Bergman, R. N. (1999) Am. J. Physiol. 277, E920-E926[Medline] [Order article via Infotrieve]
  43. Kinnick, T. R., Youngblood, E. B., O'Keefe, M. P., Saengsirisuwan, V., Teachey, M. K., and Henriksen, E. J. (2002) J. Appl. Physiol. 93, 805-812[Abstract/Free Full Text]
  44. Henriksen, E. J., Jacob, S., Kinnick, T. R., Teachey, M. K., and Krekler, M. (2001) Hypertension 38, 884-890[Abstract/Free Full Text]
  45. Blair, A. S., Hajduch, E., Litherland, G. J., and Hundal, H. S. (1999) J. Biol. Chem. 274, 36293-36299[Abstract/Free Full Text]
  46. Maddux, B. A., See, W., Lawrence, J. C., Jr., Goldfine, A. L., Goldfine, I. D., and Evans, J. L. (2001) Diabetes 50, 404-410[Abstract/Free Full Text]
  47. Rudich, A., Tirosh, A., Potashnik, R., Hemi, R., Kanety, H., and Bashan, N. (1998) Diabetes 47, 1562-1569[Abstract]
  48. Tirosh, A., Potashnik, R., Bashan, N., and Rudich, A. (1999) J. Biol. Chem. 274, 10595-10602[Abstract/Free Full Text]
  49. Henriksen, E. J., and Saengsirisuwan, V. (2003) Exerc. Sport Sci. Rev. 31, 79-84[CrossRef][Medline] [Order article via Infotrieve]
  50. Nourooz-Zadeh, J., Rahimi, A., Tajaddini-Sarmadi, J., Tritschler, H., Rosen, P., Halliwell, B., and Betteridge, D. J. (1997) Diabetologia 40, 647-653[CrossRef][Medline] [Order article via Infotrieve]
  51. Vuorinen-Markkola, H., and Yki-Jarvinen, H. (1995) Metabolism 44, 85-89[CrossRef][Medline] [Order article via Infotrieve]
  52. Griendling, K. K., Sorescu, D., and Ushio-Fukai, M. (2000) Circ. Res. 86, 494-501[Abstract/Free Full Text]
  53. Ushio-Fukai, M., Zafari, A. M., Fukui, T., Ishizaka, N., and Griendling, K. K. (1996) J. Biol. Chem. 271, 23317-23321[Abstract/Free Full Text]
  54. Xia, R., Webb, J. A., Gnall, L. L., Cutler, K., and Abramson, J. J. (2003) Am. J. Physiol. Cell Physiol. 285, C215-C221[Abstract/Free Full Text]
  55. Bejma, J., and Ji, L. L. (1999) J. Appl. Physiol. 87, 465-470[Abstract/Free Full Text]
  56. Landmesser, U., Cai, H., Dikalov, S., McCann, L., Hwang, J., Jo, H., Holland, S. M., and Harrison, D. G. (2002) Hypertension 40, 511-515[Abstract/Free Full Text]
  57. Shiuchi, T., Iwai, M., Li, H. S., Wu, L., Min, L. J., Li, J. M., Okumura, M., Cui, T. X., and Horiuchi, M. (2004) Hypertension 43, 1003-1010[Abstract/Free Full Text]
  58. Izawa, Y., Yoshizumi, M., Fujita, Y., Ali, N., Kanematsu, Y., Ishizawa, K., Tsuchiya, K., Obata, T., Ebina, Y., Tomita, S., and Tamaki, T. (2005) Exp. Cell Res. 308, 291-299[CrossRef][Medline] [Order article via Infotrieve]
  59. Motley, E. D., Eguchi, K., Gardner, C., Hicks, A. L., Reynolds, C. M., Frank, G. D., Mifune, M., Ohba, M., and Eguchi, S. (2003) Hypertension 41, 775-780[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 EndocrinologyHome page
G. Lastra, J. Habibi, A. T. Whaley-Connell, C. Manrique, M. R. Hayden, J. Rehmer, K. Patel, C. Ferrario, and J. R. Sowers
Direct Renin Inhibition Improves Systemic Insulin Resistance and Skeletal Muscle Glucose Transport in a Transgenic Rodent Model of Tissue Renin Overexpression
Endocrinology, June 1, 2009; 150(6): 2561 - 2568.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
T. Wada, S. Ohshima, E. Fujisawa, D. Koya, H. Tsuneki, and T. Sasaoka
Aldosterone Inhibits Insulin-Induced Glucose Uptake by Degradation of Insulin Receptor Substrate (IRS) 1 and IRS2 via a Reactive Oxygen Species-Mediated Pathway in 3T3-L1 Adipocytes
Endocrinology, April 1, 2009; 150(4): 1662 - 1669.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
M.-S. Zhou, I. H. Schulman, and L. Raij
Role of angiotensin II and oxidative stress in vascular insulin resistance linked to hypertension
Am J Physiol Heart Circ Physiol, March 1, 2009; 296(3): H833 - H839.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
Y. Wei, A. T. Whaley-Connell, J. Habibi, J. Rehmer, N. Rehmer, K. Patel, M. Hayden, V. DeMarco, C. M. Ferrario, J. A. Ibdah, et al.
Mineralocorticoid Receptor Antagonism Attenuates Vascular Apoptosis and Injury via Rescuing Protein Kinase B Activation
Hypertension, February 1, 2009; 53(2): 158 - 165.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
N. Bashan, J. Kovsan, I. Kachko, H. Ovadia, and A. Rudich
Positive and Negative Regulation of Insulin Signaling by Reactive Oxygen and Nitrogen Species
Physiol Rev, January 1, 2009; 89(1): 27 - 71.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. Habibi, A. Whaley-Connell, M. R. Hayden, V. G. DeMarco, R. Schneider, S. D. Sowers, P. Karuparthi, C. M. Ferrario, and J. R. Sowers
Renin Inhibition Attenuates Insulin Resistance, Oxidative Stress, and Pancreatic Remodeling in the Transgenic Ren2 Rat
Endocrinology, November 1, 2008; 149(11): 5643 - 5653.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Kim, Y.-S. Lee, J. Choe, H. Lee, Y.-M. Kim, and D. Jeoung
CD44-Epidermal Growth Factor Receptor Interaction Mediates Hyaluronic Acid-promoted Cell Motility by Activating Protein Kinase C Signaling Involving Akt, Rac1, Phox, Reactive Oxygen Species, Focal Adhesion Kinase, and MMP-2
J. Biol. Chem., August 15, 2008; 283(33): 22513 - 22528.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
G. Lastra, A. Whaley-Connell, C. Manrique, J. Habibi, A. A. Gutweiler, L. Appesh, M. R. Hayden, Y. Wei, C. Ferrario, and J. R. Sowers
Low-dose spironolactone reduces reactive oxygen species generation and improves insulin-stimulated glucose transport in skeletal muscle in the TG(mRen2)27 rat
Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E110 - E116.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
Y. Wei, K. Chen, A. T. Whaley-Connell, C. S. Stump, J. A. Ibdah, and J. R. Sowers
Skeletal muscle insulin resistance: role of inflammatory cytokines and reactive oxygen species
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R673 - R680.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
J.-a Kim, Y. Wei, and J. R. Sowers
Role of Mitochondrial Dysfunction in Insulin Resistance
Circ. Res., February 29, 2008; 102(4): 401 - 414.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
Y. Wei, J. R. Sowers, S. E. Clark, W. Li, C. M. Ferrario, and C. S. Stump
Angiotensin II-induced skeletal muscle insulin resistance mediated by NF-{kappa}B activation via NADPH oxidase
Am J Physiol Endocrinol Metab, February 1, 2008; 294(2): E345 - E351.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M.-K. Sim, X.-G. Xu, Y.-C. Wong, S.-Z. Sim, and K.-O. Lee
Des-Aspartate-Angiotensin I Exerts Hypoglycemic Action via Glucose Transporter-4 Translocation in Type 2 Diabetic KKAy Mice and GK Rats
Endocrinology, December 1, 2007; 148(12): 5925 - 5932.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
S. A. Cooper, A. Whaley-Connell, J. Habibi, Y. Wei, G. Lastra, C. Manrique, S. Stas, and J. R. Sowers
Renin-angiotensin-aldosterone system and oxidative stress in cardiovascular insulin resistance
Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2009 - H2023.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
H. Hitomi, H. Kiyomoto, A. Nishiyama, T. Hara, K. Moriwaki, K. Kaifu, G. Ihara, Y. Fujita, T. Ugawa, and M. Kohno
Aldosterone Suppresses Insulin Signaling Via the Downregulation of Insulin Receptor Substrate-1 in Vascular Smooth Muscle Cells
Hypertension, October 1, 2007; 50(4): 750 - 755.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. J. Henriksen
Improvement of insulin sensitivity by antagonism of the renin-angiotensin system
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R974 - R980.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
Y. Wei, A. T. Whaley-Connell, K. Chen, J. Habibi, G. M.-E. Uptergrove, S. E. Clark, C. S. Stump, C. M. Ferrario, and J. R. Sowers
NADPH Oxidase Contributes to Vascular Inflammation, Insulin Resistance, and Remodeling in the Transgenic (mRen2) Rat
Hypertension, August 1, 2007; 50(2): 384 - 391.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
K. Kisfalvi, O. Rey, S. H. Young, J. Sinnett-Smith, and E. Rozengurt
Insulin Potentiates Ca2+ Signaling and Phosphatidylinositol 4,5-Bisphosphate Hydrolysis Induced by Gq Protein-Coupled Receptor Agonists through an mTOR-Dependent Pathway
Endocrinology, July 1, 2007; 148(7): 3246 - 3257.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/46/35137    most recent
M601320200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wei, Y.
Right arrow Articles by Stump, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wei, Y.
Right arrow Articles by Stump, C. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement