|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 281, Issue 46, 35397-35403, November 17, 2006
Skipping of Exon 1 in the KCNQ1 Gene Causes Jervell and Lange-Nielsen Syndrome*![]() 12 1![]() ![]() ![]() 3
From the
Received for publication, April 10, 2006 , and in revised form, September 15, 2006.
The Jervell and Lange-Nielsen syndrome (JLNS) is a rare autosomal recessive form of the long QT syndrome linked with a profound hearing loss caused by mutations affecting both alleles of either the KCNQ1 or the KCNE1 gene. We carried out a mutant screening of the KCNQ1 and KCNE1 genes in a clinical diagnosed German family with JLNS. Family members were examined by single strand conformation polymorphism analysis and PCR and amplified products were characterized by DNA sequence analysis. We identified a splice donor mutation of exon 1 in the KCNQ1 gene (G477 + 1A). Analysis of lymphocyte RNA by RT-PCR revealed that two symptomatic patients, homozygous for the mutant allele, exclusively produce KCNQ1 transcripts lacking exon 1 leading to a frameshift that introduced a premature termination codon at exon 4. Mutant subunits, functionally characterized in Xenpous oocytes, were unable to form homomeric channels but strongly reduced IKs (slowly activating delayed rectifier potassium current) in vitro (mutant isoforms 1 and 2 by 62 and 86%, respectively), a fact supposed to lead to severely affected heterozygous individuals. However, individuals heterozygous for the mutant allele exhibit an asymptomatic cardiac phenotype. Thus, the observed dominant-negative effect of mutant subunits in vitro is absent in vivo leaving heterozygous individuals unaffected. These data suggest mechanisms that prevent production of truncated KCNQ1 channel subunits in cardiomyocytes of individuals heterozygous for the mutant allele.
The progress of human genetics has been crucial in determining the correlation of ion channel genes and ventricular arrhythmias. Mutations in the potassium channel genes KCNQ1 (LQT1), KCNH2 (LQT2), KCNE1 (LQT5), and KCNE2 (LQT6) have been linked with different subtypes of the long QT syndrome (1-4). The KCNQ1 gene encoded pore-forming -subunit, and the KCNE1 gene encoded -subunit coassemble to form the slowly activating delayed rectifier potassium current (IKs) channel involved in repolarization of the cardiac action potential (5, 6). Mutations in both genes cause two congenital forms of the long QT syndrome, the autosomal-dominant Romano-Ward syndrome (RWS)4 characterized by prolonged cardiac repolarization, cardiac arrhythmias, and a high risk of sudden death (7) or the JLNS characterized by a congenital bilateral deafness associated with a QT prolongation on the electrocardiogram (ECG), recurrent syncopes, seizures, and sudden death due to ventricular arrhythmias of the torsades de pointes type (8). Unlike the RWS, the JLNS is caused by mutations affecting both alleles of the KCNQ1 or the KCNE1 gene (8, 9). The majority of JLNS cases, however, are caused by KCNQ1 mutations that affect the structure of the subunits by introduction of translation stop codons yielding premature subunits and by missense mutations discussed to prevent assembly of IKs channels (10-13).
We report a JLNS causing mutation of the KCNQ1 gene and show that at the border from exon 1 to intron 1 the position of the first intronic nucleotide, nearly always a guanine followed by a thymidine (14), is replaced by adenine (G477 + 1A). This altered splice donor site is associated with a splice error. Skipping of exon 1 caused a frameshift that introduces a premature translational termination codon leading to the expression of truncated KCNQ1 potassium channel subunits. Functional analysis in Xenopus oocytes revealed that mutant subunits exert strong dominant-negative effects on IKs currents supposed to induce JLNS symptoms in heterozygous individuals. These results are really exciting, because a variety of clinical manifestations has been linked to the heterozygous state of mutations at the splice donor site of exon 1 (G477 + 1A; G477 + 5A; G477 + 5C; this work, Refs. 15-19). Due to the fact that most heterozygous individuals lack cardiac deficits, molecular mechanisms might exist (20, 21) that abolish suppression of IKs currents by mutant KCNQ1 subunits.
SubjectsOur study is based on a three-generation family of German origin comprising two symptomatic individuals affected by profound sensorineural deafness and a prolonged QTc interval (Fig. 1). The subjects of this family underwent detailed clinical and cardiovascular examination, including a 12-lead ECG. The QT intervals were measured on the ECG in lead II or V5 and corrected for heart rate by the use of the Bazett formula. The investigation conforms with the principles outlined in the Declaration of Helsinki.
Mutation AnalysisGenomic DNA was extracted from blood samples of the available family members using the genomic DNA extraction kit (Qiagen) in accordance with manufacturer's protocol. The PCR primers (22) W33 (ATGGGAGAGGCCGTGATGCTGAC) and W34 (ATCCAGCCATGCCCTCAGATGC) were used to amplify exon 1 of the human KCNQ1 gene. The PCR reaction mix contained 50 ng DNA as template, 25 pM concentration of each primer, 200 µM 4-dNTP, 1 units of Thermus aquaticus DNA polymerase (Amersham Biosciences), 10 mM Tris-HCl, pH 8.3, at room temperature, 50 mM KCl, and 1.5 mM MgCl2 in a volume of 50 µl. The DNA was denatured by exposing to 95 °C for 5 min and then amplified for 35 cycles in a Hybaid Omnigene Temperature Cycler. Each cycle consisted of a denaturation step at 95 °C for 15 s, an annealing step at 61 °C for 15 s, and an extension step at 72 °C for 45 s. For single strand conformation polymorphism (SSCP) analysis, PCR products were separated on a 5-15% polyacrylamide gradient gel using a Multiphor II electrophoresis system and visualized by silver staining (23).
4RT-PCR of RNA Isolated from Whole Blood CellsTotal RNA ( Heterologous Gene Expression in Xenopus laevis OocytesAll protocols for animal use were in accordance with the Guide for the Care and Use of Laboratory Animals published by the United States National Institute of Health (NIH Publication number 85-23, revised 1996) and the European Community guidelines for the use of experimental animals. cRNA of KCNE1, KCNQ1-iso1, KCNQ1-iso2, and their mutants, KCNQ1-iso1M and KCNQ1-iso2M, were synthesized using the mMESSAGE mMACHINE kit (Ambion, Austin, TX). Stage V-VI defolliculated Xenopus oocytes were injected with the same total amounts of cRNA coding for the mutant or wild type potassium channel subunits.
Electrophysiology and StatisticsPotassium channel expression was determined 2-3 days after cRNA injection by two-microelectrode voltage clamp recordings from X. laevis oocytes. Whole-cell recordings were performed using a Warner OC-725A amplifier (Warner Instruments, Hamden, CT) and pClamp software (Axon Instruments, Foster City, CA) for data acquisition and analysis. Data were low pass filtered at 0.2 kHz (-3 db, 4-pole Bessel filter) before digitalization at 1 kHz. Microelectrodes had a tip resistance ranging from 1 to 5 M
Subunit Expression and ImmunohistochemistryCOS-1 cells (2 x 104) were grown on fibronectin coated coverslips in DMEM with penicillin/streptomycin, glutamine, sodium pyruvate (Invitrogen) and fetal calf serum (Pan Biotech) at 37 °C in 10% CO2. Cells were transiently transfected using Effectene® transfection reagent (Qiagen) and 0.2 µg of plasmid DNA encoding wild type or mutant KCNQ1 subunits FLAG-tagged at their C terminus. Plasmids were generated by cloning of the appropriate DNA fragments into the pFLAG-CMV-5.1 vector (Sigma). 24 h after transfection, cells were washed in PBS and nitrogen-fixed according to Neuhaus et al. (26). Anti-FLAG antibody staining was performed at 4°C over night using a 1:1000 dilution of the affinity-purified monoclonal anti-FLAG antibody (Sigma) in 2% BSA/PBS. After washing with PBS (2 x 30 min), coverslips were incubated overnight in 2% BSA/PBS at 4 °C with a 1:500 diluted secondary antibody (MFP 488 goat anti-mouse IgG, Molecular Probes) in 2% BSA/PBS. Coverslips were washed in PBS (2 x 30 min) and mounted in Citifluor AF2 (Plano).
Clinical and Genetic CharacterizationThe index patient, a now 17-year-old boy, was diagnosed with congenital deafness at the age of 10 months. Further diagnosis revealed a prolonged QTc of 0.56 s (Fig. 1, patient III.2, closed square). Treatment with propranolol was started. Because of side effects the dosage had been reduced. In the following years recurrent syncopes occurred in association with physical and emotional stress especially during swimming. Consequently, the propranolol dosage was readjusted to 3 mg/kg/day. Since the age of five no more syncopal episodes appeared under treatment with propranolol. The index patient has a 4 years younger sister who also was diagnosed with congenital deafness and prolonged QTc interval of 0.52 s (Fig. 1, patient III.1, closed circle). Treatment with propranolol at a dosage of 3 mg/kg/day was started at the age of 6 months. Recurrent syncopes occurred in the last three years in association with physical stress especially during swimming. Because of recurrent events under an adequate dosage of propranolol, implantation of a cardioverter defibrillator was strongly advised but has been refused by the family. Until today no episodes of cardiac arrest occurred. The family history revealed no other family members with congenital deafness, recurrent syncope, or sudden death. ECG and clinical history of the parents, the mother's sister, and the mother's parents were inconspicuous. The uncle of the index patient (Fig. 1, II.1) has a history of epileptic seizures, an ECG could not be obtained. The index patient's parents are distantly related because ancestral consanguinity occurred five generations ago.
Genetic AnalysisWe focused our analysis on the JLNS candidate genes encoding the potassium channel subunits KCNQ1 and KCNE1, which together form the IKs channel (5, 6). Exon sequences of both genes were assayed by PCR of genomic DNA extracted from blood samples of all family members followed by SSCP analysis (23). Evaluation of the intronless KCNE1 gene revealed no abnormalities in the corresponding sequence and allowed us to exclude the To identify the mutation underlying the altered migration pattern, DNA sequence analysis of exon 1-derived PCR products of the family members was performed on both strands and revealed a single nucleotide change. Due to a guanine (G) to adenine (A) transition at the exon 1 (uppercase letters) intron 1 (lowercase letters) border of the KCNQ1 gene (TGGATGgtacgt >> TGGATGatacgt), one of the most conserved nucleotides at the splice donor sequence (14) is altered in individuals carrying the mutated allele. Both symptomatic patients appeared homozygous for the observed replacement, whereas parents, paternal uncle, and maternal grandfather appeared heterozygous (Fig. 2B). Altered Transcription in KCNQ1 Mutant CarriersExpression analysis was performed using cDNA fragments generated by RT-PCR of total RNA from blood cells (lymphocytes) of healthy and affected individuals. As expected from the KCNQ1 mRNA sequence (27), in healthy individuals primer KCNQ1-433 and LQT-201 exclusively amplified a 277-bp KCNQ1 cDNA fragment (Fig. 2C, lane I.2). Corresponding to the altered splice donor site, heterozygous family members produce two different KCNQ1 cDNA fragments, the 277-bp cDNA fragment of the wild type allele, and a shorter 186-bp cDNA fragment of the mutant allele (Fig. 2C, lanes II.1, II.2, II.3, and I.1). Symptomatic patients, homozygous for the mutant allele, solely amplify the shorter 186bp cDNA fragment (Fig. 2C, lanes III.1 and III.2). DNA sequence analysis showed that heterozygous individuals produce a normal spliced wild type KCNQ1 transcript and an alternative spliced mutant KCNQ1 transcript lacking exon 1. The JLNS patients selectively produce transcripts missing exon 1 (Fig. 2D). It is important to note that the human heart expresses two different KCNQ1-isoforms, the wild type KCNQ1 subunit transcript isoform 1 (embl: AF000571 [GenBank] ) encoding 676 amino acids (27) and an alternative spliced transcript, KCNQ1-isoform 2 (embl: NM_181798 [GenBank] ), encoding a KCNQ1 subunit lacking the N-terminal 127 amino acids (24) (Fig. 3). Consequently, altered transcripts encoding both isoforms were expected to appear in lymphocytes of mutant carriers (Fig. 3). However, RT-PCR analysis of total RNA of lymphocytes detected isoform 1 but could not detect isoform 2 transcripts. Composition of Mutant KCNQ1 IsoformsIn the heart both isoforms are transcribed (24, 27). Deletion of KCNQ1 exon 1 yielded mutant isoform 1 transcripts (KCNQ1-iso1M) composed of exon 1a fused to exon 2-15 and mutant isoform 2 transcripts (KCNQ1-iso2M) composed of exon 1b fused to exon 2-15 (Fig. 3). Skipping of exon 1 generates a frameshift that introduced a premature termination codon at exon 4. Accordingly, mutant isoform 1 subunits consist of the exon 1a-encoded N-terminal 129 amino acids (aa) fused to 76 aa encoded by the introduced frameshift, whereas mutant isoform 2 subunits were composed of the exon 1b-encoded N-terminal 2 aa fused to the same, frameshift provided 76 aa (Fig. 3). Thus, homozygous and heterozygous carriers of the JLNS causing mutation express truncated KCNQ1 subunits of either 205 aa (KCNQ1-iso1M) or 78 aa (KCNQ1-iso2M), which have little similarity to KCNQ1 potassium channel subunits present in healthy individuals. Functional Properties of Mutant KCNQ1 SubunitsFirst, we analyzed homomeric channels formed by wild type KCNQ1-iso1 subunits or mutant KCNQ1-iso1M and KCNQ1-iso2M subunits following injection of cRNA (1.8 ng each) into Xenopus oocytes. Currents were elicited by 2-s steps to potentials ranging from -60 to 120 mV (increment 20 mV), and tail currents were recorded at -40 mV. The holding potential was -80 mV, and pulses were applied at a frequency of 0.2 Hz during all electrophysiological measurements (25). Under these conditions, expression of KCNQ1-iso1 subunits produced channels with a mean tail current amplitude of 0.98 ± 0.092 µA (n = 20) (Fig. 4A, column 1), whereas oocytes expressing mutant KCNQ1-iso1M (Fig. 4A, column 2) or KCNQ1-iso2M subunits (Fig. 4A, column 7) produced no currents (KCNQ1-iso1M: 0.041 ± 0.01 µA, n = 20; KCNQ1-iso2M: 0.037 ± 0.011 µA, n = 20) comparable with uninjected oocytes (Fig. 4A, column 4).
Mutant KCNQ1 Subunits Affect KCNQ1-iso1 ChannelsTo further investigate the functional consequences of this JLNS mutation, we determined the ability of the mutant subunits to influence wild type KCNQ1-iso1 currents. In coexpression experiments the same amount (1.8 ng) of KCNQ1-iso1M or KCNQ1-iso2M cRNA was injected with equal amounts of KCNQ1-iso1 cRNA, and the resulting currents were compared with KCNQ1-iso1 currents. KCNQ1-iso1M subunits caused little changes (5%) with currents similar to KCNQ1-iso1 currents (0.932 ± 0.079 µA, n = 20; Fig. 4A, column 3). Surprisingly, mutant KCNQ1-iso2M subunits reacted differently and caused a pronounced reduction (45%) of KCNQ1-iso1 currents to 0.543 ± 0.055 µA (n = 20) (Fig. 4A, column 6), an attribute basically associated to dominant-negative RWS-type, but absent from JLNS-type, mutations (12).
KCNQ1 Mutant Isoforms Cause Dominant-negative Suppression of IKsTo examine whether the truncated mutant KCNQ1 subunits interfere with IKs, we measured Xenopus oocytes injected with equal amounts (1.8 ng) of KCNQ1-iso1, KCNQ1-iso2, KCNQ1-iso1M, or KCNQ1-iso2M cRNA together with (1.8 ng) KCNE1 cRNA. The combination of KCNQ1-iso1 and KCNE1 subunits induced outward potassium currents with properties nearly identical to native cardiac IKs with an average tail amplitude of 3.58 ± 0.5 µA (n = 20, Fig. 4B and E, column 1), whereas coexpression of KCNQ1-iso2 with KCNE1 displayed very low IKs amplitudes of 0.02 ± 0.02 µA (Fig. 4E, column 2) not different from uninjected control oocytes (Fig. 4E, column 6). In contrast, expression of KCNE1 KCNQ1 Wild Type and Mutant Subunit Expression in COS-1 CellsTo study whether mutant subunits show differences in abundance, cellular distribution, and cellular localization, transient transfections of COS-1 cells were performed to express mutant and wild type KCNQ1 subunits that were FLAG-tagged at their C terminus. Antibody staining using anti-FLAG antibodies showed that mutant and wild type subunits were distributed in a similar pattern (Fig. 5, A-C), indicating that the marked truncation of the mutant subunits did neither compromise their cellular location nor their transport to the cell surface. This is in line with the functional analysis of wild type and mutant channels in Xenopus oocytes.
The JLNS is a rare autosomal recessive inherited disease characterized by a profound hearing loss associated with QT prolongation in ECG, syncopal attacks, seizures, and sudden death from ventricular arrhythmias. JLNS-associated mutations have been identified in the pore-forming -subunit KCNQ1 and in the auxiliary -subunit KCNE1 (1, 2, 8-13), which coassemble to form IKs in the heart (5, 6). To date, several frameshift or truncation mutations generated by altered splicing, deletion, or insertion have been reported to be responsible for the majority of the JLNS cases caused by homozygous as well as compound heterozygous mutations of the KCNQ1 or the KCNE1 gene (2, 8-13, 15-19, 27-31). With this study we characterized the structural and functional features of a mutation at the splice donor site of the KCNQ1 geneÕs exon 1 (G477 + 1A) in a German family with JLNS. Mutant carriers produce KCNQ1 transcripts lacking exon 1 leading to a frameshift. By this, a premature stop codon is introduced causing the expression of truncated KCNQ1 subunits. Thus, the JLNS patients in this family selectively produce altered transcripts, leading to mutant isoform 1 subunits (KCNQ1-iso1M) composed of 205 aa comprising one-third of the first transmembrane segment (129 aa encoded by exon 1a fused to 76 aa encoded by the frameshift) and mutant isoform 2-derived subunits (KCNQ1-iso2M) composed of 78 aa (2 aa encoded by exon 1b fused to the frameshift provided 76 aa) lacking any KCNQ1 transmembrane segment. In consequence, KCNQ1 wild type and mutant subunits show little structural similarities. In agreement with these findings, mutant subunits encoded by isoform 1 or 2, KCNQ1-iso1M and KCNQ1-iso2M, respectively, were unable to form homomeric potassium channels. Moreover, KCNQ1-iso1M subunits failed to affect the formation of homomeric KCNQ1-iso1 channels, whereas the much smaller KCNQ1-iso2M subunits, when coexpressed in Xenopus oocytes, reduced KCNQ1-iso1 currents to 46%, a feature well assigned to RWS-type mutations and used to distinguish RWS from JLNS mutations (12). Of even greater importance is that in coexpression experiments with KCNE1, mutant KCNQ1 subunits showed the ability to affect IKs currents in a dominant-negative mode with current reduction to 38 and 14% (KCNQ1-iso1M and KCNQ1-iso2M), respectively. Thus, mutant subunits confer properties more related to RWS-associated than to JLNS-associated KCNQ1 mutations (12, 27), and these features may explain, at least in part, the variety of clinical manifestations in heterozygous carriers associated with KCNQ1 transcripts lacking exon 1. Heterozygous individuals appear asymptomatic with normal QTc intervalls (this report and Ref. 17), asymptomatic with QTc prolongation (15, 17), as RWS patients (15, 19) and as compound JLNS (17) or compound RWS (18). In respect to such a discrepancy, expression of mutant KCNQ1 subunits and hence their ability to influence IKs in the heart might be regulated on an individual level. A lack of IKs reduction in healthy heterozygous individuals implies mechanisms that in cardiomyocytes prevent the potentially noxious influence of the truncated subunits. In this view, the abundance and distribution of the truncated subunits in cardiaomyocytes could be affected, or alternatively, the transport of the truncated subunits to the cell surface could be impaired leading to the absence of IKs channels composed of mutant and wild type subunits. Interestingly, anti-FLAG antibody staining of COS-1 cells transiently transfected with plasmids encoding the FLAG-tagged mutant and wild type subunits revealed a similar expression pattern with mutant and wild type subunits indistinguishably distributed. In combination with their functional analysis in Xenopus oocytes, these data suggested that independent of their truncation, mutant subunits were transported to the cell surface, like wild type subunits. Apart from these features, we do not know whether the stability of the truncated subunits in cardiomyocytes differs from the stability of wild type subunits, yet an additional fact that could explain the presence of healthy heterozygous individuals. On the other hand, a recently described mRNA surveillance system, the nonsense-mediated decay, which rapidly degrades mutant transcripts carrying a premature stop codon (20, 21), might offer an alternative explanation how cardiomyocytes abolish or reduce the dominant-negative effect required to establish the recessive nature of JLNS in heterozygous carriers with KCNQ1 transcripts lacking exon 1.
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Both authors contributed equally to this work.
2 Supported by a "Tandemprojekt" grant of the Max-Planck-Gesellschaft in cooperation with the Universitätsklinikum Heidelberg. 3 To whom correspondence should be addressed: Max-Planck-Institut für Medizinische Forschung, Abteilung Zellphysiologie, Jahnstrasse 29, D-69120 Heidelberg, Germany. Tel.: 49-6221-486-475; Fax: 49-6221-486-549; E-mail: koenen{at}mpimf-heidelberg.mpg.de.
4 The abbreviations used are: RWS, Romano-Ward syndrome; aa, amino acids; ECG, electrocardiogram; JLNS, Jervell and Lange-Nielsen syndrome; RT, reverse transcribed; SSCP, single strand conformation polymorphism; PBS, phosphate-buffered saline; BSA, bovine serum albumin.
The excellent technical assistance of Michaela Bauer, Simone Bauer, Sonja Lueck, Ramona Bloehs, and Ulrike Mersdorf is gratefully acknowledged.
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||