Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M604720200 on September 2, 2006

J. Biol. Chem., Vol. 281, Issue 46, 35425-35435, November 17, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/46/35425    most recent
M604720200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gastwirt, R. F.
Right arrow Articles by Donoghue, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gastwirt, R. F.
Right arrow Articles by Donoghue, D. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Spy1 Expression Prevents Normal Cellular Responses to DNA Damage

INHIBITION OF APOPTOSIS AND CHECKPOINT ACTIVATION*

Randy F. Gastwirt{ddagger}, Daniela A. Slavin§, Christopher W. McAndrew§, and Daniel J. Donoghue{ddagger}§1

From the {ddagger}Biomedical Sciences Program, §Department of Chemistry and Biochemistry, and Moores University of California San Diego Cancer Center, University of California San Diego, La Jolla, California 92093-0367

Received for publication, May 17, 2006 , and in revised form, August 10, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Spy1 is the originally identified member of the Speedy/Ringo family of vertebrate cell cycle regulators, which can control cell proliferation and survival through the atypical activation of cyclin-dependent kinases. Here we report a role for Spy1 in apoptosis and checkpoint activation in response to UV irradiation. Using an inducible system allowing for regulated expression of Spy1, we show that Spy1 expression prevents activation of caspase-3 and suppresses apoptosis in response to UV irradiation. Spy1 expression also allows for UV irradiation-resistant DNA synthesis and permits cells to progress into mitosis, as demonstrated by phosphorylation on histone H3, indicating that Spy1 expression can inhibit the S-phase/replication and G2/M checkpoints. We demonstrate that Spy1 expression inhibits phosphorylation of Chk1, RPA, and histone H2A.X, which may directly contribute to the decrease in apoptosis and checkpoint bypass. Furthermore, mutation of the conserved Speedy/Ringo box, known to mediate interaction with CDK2, abrogates the ability of Spy1 to inhibit apoptosis and the phosphorylation of Chk1 and RPA. The data presented indicate that Spy1 expression allows cells to evade checkpoints and apoptosis and suggest that Spy1 regulation of CDK2 is important for the response to DNA damage.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
X-Spy1 (Xenopus Speedy) was originally identified by its ability to confer resistance to UV irradiation in a Rad1-deficient strain of Schizosaccharomyces pombe (1) and was found to bind to and activate CDK2 (1). Human Spy1 was subsequently shown to enhance cellular proliferation through the direct activation of CDK2. Moreover, RNA interference knockdown of Spy1 prevented cellular proliferation by inhibiting efficient S-phase entry (2). In addition, Spy1 was shown to enhance mammalian cell survival in response to a number of genotoxic agents, including hydroxyurea, cisplatin, and camptothecin (3). This survival effect of Spy1 was depressed when a CDK2 dominant negative was expressed (3), indicating that the ability of Spy1 to activate CDK2 may be required for Spy1-associated cell survival.

A Spy1 homolog, Ringo, also identified in Xenopus (4), was shown to activate both CDK2 and Cdc2 independent of their respective cyclins (5). Recently, Spy1 and Ringo have been placed in a larger family of vertebrate proteins, designated the Speedy/Ringo family. The members of the Speedy/Ringo family share high sequence homology within a central region known as the Speedy/Ringo box (S/R box),2 which has been shown to mediate interaction with and activation of CDK2 (6, 7). Spy1 and its homologs can activate CDK2 in the absence of known mechanisms of activation (7). In fact, Spy1 has been shown to facilitate phosphorylation of Cdc25 by CDK2 in an event that both stabilizes Cdc25 and further activates CDK2 (8). Spy1 can also activate CDK2 in the absence of the Thr160 activating phosphorylation (8). This phosphorylation event is mediated by the CDK-activating kinase, which is known to be regulated by p53 in response to DNA damage (9). Finally, Spy1 and its homologs can prevent CDK inhibition by CDK inhibitors, such as p21 and p27 (5, 10).

Cancer arises when a cell evades normal proliferative controls, often by mutations in genes that control cell growth and division (11). Various checkpoints exist to ensure that cells replicate without genetic errors and repair damaged DNA, to avoid both the uncoupling of replication from cell cycle control and the transmission of genetic mutations (12-14). Recent evidence demonstrates that DNA damage responses are activated in early premalignant tissue but not in normal tissue (15). Checkpoints are often the targets for oncogenic mutation, thereby uncoupling proliferation from apoptosis while enhancing proliferation itself during transformation and tumorigenesis (11, 16, 17). In addition to evasion of checkpoints, cancer cells must also inactivate the apoptotic pathways (18). Apoptotic mechanisms exist to protect cells against the loss of checkpoints, irreparable DNA damage, and sustained oncogenic stimuli.

Significantly, a correlation between Spy1 and breast cancer was recently published (19). This study examined the altered regulation of genes in nodal metastatic and invasive ductal breast carcinomas, identifying Spy1 as one of the 50 most upregulated genes (19). These data suggest that deregulation of Spy1 expression plays a key role in oncogenesis.

In this study, we have investigated the role of Spy1 expression in apoptosis and checkpoint activation to begin to understand the molecular mechanisms by which Spy1 may contribute to oncogenesis as reported for breast cancer (19). In this study, we show that Spy1 expression enhances cell survival in response to UV irradiation by preventing the activation of caspases and apoptosis in a U2OS osteosarcoma cell line. Interestingly, Spy1 expression suppresses the activation of both an S-phase/replication checkpoint and a G2/M checkpoint. In addition, Spy1 expression prevents the activation of checkpoint proteins, such as Chk1 and the histone variant H2A.X, in response to UV irradiation and prevents other ATR-mediated signaling events, such as the phosphorylation of RPA32 on its N terminus. Furthermore, mutations within the S/R box of Spy1, known to mediate the interaction with and activation of CDK2 (6, 7), prevent these effects of Spy1. Expression of this mutant does not suppress the phosphorylation of Chk1 or RPA32 in response to UV-induced DNA damage, indicating a specific role for Spy1 and Spy1-associated CDK2 activity in the regulation of the DNA damage response. The expression of Spy1 thus facilitates the evasion of checkpoints and apoptotic pathways that are activated in response to DNA damage.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines, Creation of Inducible Cell Lines, and UV Irradiation Conditions—U2OS human osteosarcoma cells with wild type p53 (American Type Culture Collection, Manassas, VA) and all derivatives were maintained in Dulbecco's modified Eagle's medium (Invitrogen), supplemented with 0.1% penicillin/streptomycin (Sigma), 10% fetal bovine serum, and 1.5 mM L-glutamine (Invitrogen). Cells were incubated at 37 °C in 5% CO2.

Inducible U2OS cell lines were created using the ecdysone system (Invitrogen) (20) as follows. U2OS cells were transfected with pVgRXR regulatory vector and selected for 14 days with Zeocin. Subsequently, Myc-Spy1 and the Myc-SpyS/R box mutant were cloned into the BamHI and XbaI sites of the pIND vector and transfected into pVgRXR-expressing U2OS cells. Cells were selected with G418 and Zeocin (Invitrogen) for 14 days, and colonies were isolated and then tested for expression of Myc-Spy1 or the Myc-Spy1S/R box mutant induced by ponasterone A (20). Induction conditions were determined to be maximal with 1.25 nM ponasterone A (subsequently referred to as induction medium). Cell culture conditions were as above with the inclusion of 0.48 mg/ml G418 and 0.5 mg/ml Zeocin.

For UV irradiation, medium was aspirated, and plates were washed twice with PBS. After removing as much PBS as possible, the cells were irradiated with 50 J/m2 UVC (254 nm) using a Stratalinker1800 (Stratagene, La Jolla, CA). Induction medium was then added back, and plates were returned to the incubator until processed. Where indicated, the human pRcCMV-CDK2 expression plasmid was transfected into cells with FuGENE (Roche Applied Science) according to the manufacturer's protocol.

Creation of Spy1 S/R Box Mutant—To create the S/R box mutation of Spy1, BglII and MluI sites were cloned into wild type pIND-Myc-Spy1, flanking the acidic region of the S/R box at residues 458 and 525, respectively, using QuikChange (Stratagene), using the following primers: for BglII, GGGCTAAATTTACTATAAGTGAGCATACCAGATCTAATTTCTTTATTGCTCTGTATCTGC; for MluI, ACCAAGTACGCGTTTTTTCCATGGGCTTTAGGG. The region flanking the mutation sites was then excised using BglII and MluI. A short oligonucleotide containing the mutations E134Q, E135Q, E137Q, E138Q, E139Q, and D136N was then ligated into these sites (GATCTAATTTCTTTATTGCTCTGTATCTGGCTAATACAGTTCAACAAAATCAACAACAAACCAAGTA).

Antibodies—Anti-caspase-3 (FL) rabbit antibody (9662), anti-cleaved caspase-3 Alexa Fluor 488 conjugated rabbit antibody (9669), anti-phospho-Chk1 (Ser345) rabbit antibody (2341), anti-phospho-Chk1 (Ser345) (133D3) rabbit monoclonal antibody (2348), anti-phospho-Chk1 (Ser317) rabbit anti-body (2344), and anti-phosphohistone H3 (Ser10) Alexa Fluor 488-conjugated rabbit antibody (9708) were purchased from Cell Signaling Technology (Beverly, MA). Anti-Myc (9E10) (sc-40) mouse antibody, anti-Chk1 (G4) (sc-8408) mouse antibody, anti-CDK2 (D12) (sc-6248) mouse antibody, anti-RPA32 (C16) (sc-14692) goat antibody, anti-CDK2 (M2) (sc-163) rabbit antibody, and anti-beta-tubulin (H235) (sc-9104) rabbit antibody were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Anti-phosphohistone H2A.X (Ser139; {gamma}H2AX) clone JBW301 mouse antibody was purchased from Upstate%20Biotechnology">Upstate Biotechnology, Inc. (Lake Placid, NY). Anti-phospho-RPA32 (Ser4 and Ser8) (BL647) (A300-245A) was purchased from Bethyl Laboratories, Inc. (Montgomery, TX).

Detection of Apoptosis—To determine apopotosis in response to UV, 5 x 105 pIND:U2OS and Spy1:U2OS cells were seeded on 10-cm plates, induced for 24 h, and then irradiated with UV. Cells were allowed to recover in induction medium until the indicated time points. Floating and adherent cells were collected by centrifugation, washed twice with PBS, and fixed in 95% ethanol at 4 °C overnight. After fixation, cells were washed twice with 1% bovine serum albumin/PBS and resuspended in 1 ml of PBS. Cells were then stained with a propidium iodide solution (0.25 mg/ml propidium iodide, 0.01% Triton X-100, 100 µg/ml RNase A in PBS) and analyzed for sub-G1 DNA content by flow cytometry using a FACScalibur (BD Biosciences).

To detect apoptosis by Annexin V binding to the outer cell membrane, 5 x 105 cells were seeded on 10-cm plates and induced for 24 h. Cells were then irradiated with UV and incubated for 24 h in induction medium. Floating and adherent cells were collected, washed twice with PBS, and resuspended in Annexin V binding buffer (BD Biosciences). 1 x 105 cells were stained with Annexin V-fluorescein isothiocyanate and 7-amino-actinomycin D (to detect necrotic cells) as per the manufacturer's instructions (BD Biosciences). Cells were analyzed for apoptosis by flow cytometry.

Western Blotting—Cells were lysed in 0.1% Nonidet P-40 lysis buffer (20 mM Tris, pH 8.0, 150 mM NaCl, 0.1% Nonidet P-40, 1 mM Na3VO4, 1 mM NaF, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin) and clarified by centrifugation, and protein concentrations were determined by Bradford Assay (Bio-Rad). Equal amounts of protein for each sample were resolved by SDS-PAGE (10% SDS-PAGE except for caspase-3 experiment at 17.5%) and transferred to nitrocellulose. Proteins were detected by immunoblotting with the indicated antiserum, followed by secondary antibodies (anti-mouse Ig-horseradish peroxidase conjugate; GE Healthcare) or anti-rabbit Ig-horseradish peroxidase conjugate (GE Healthcare), followed by ECL (GE Healthcare).

Detection of Cleaved Caspase-3 by Intracellular Staining and Flow Cytometry—To detect cleaved caspase-3 in response to UV irradiation, pIND:U2OS and Spy1:U2OS cells were induced for 24 h with ponasterone A and then irradiated with UV. Cells were allowed to recover in induction medium, and at the indicated time points postirradiation, floating and adherent cells were collected, washed twice with PBS, and fixed in 2% formaldehyde for 10 min at 37 °C. Cells were put on ice for 1 min and then permeabilized with methanol so that the final concentration of methanol is 90%. Cells were kept in methanol at -20 °C until all time points were collected. Cells were then washed with 0.5% bovine serum albumin/PBS by centrifugation and stained with anti-cleaved caspase-3 Alexa Fluor 488-conjugated rabbit antibody (Cell Signaling Technology). Cells were analyzed by flow cytometry for the presence of cleaved caspase-3.

UV Irradiation-resistant DNA Synthesis Assay (UVDS)—The UVDS assay was performed as previously described (21). Briefly, pIND:U2OS and Spy1:U2OS cells were induced for 24 h, followed by incubation in induction medium containing 20 nCi/ml [14C]thymidine (Applied Biosystems, Chicago, IL) for a subsequent 24 h. The medium was then replaced with fresh normal induction medium and incubated for another 24 h. Cells were then irradiated with UV and incubated in normal induction medium for 0, 30, 60, or 120 min, followed by a 15-min incubation with 5 µCi/ml [3H]thymidine (Applied Bio-systems). Cells were harvested, washed twice in PBS, and fixed in 70% methanol. Cells were transferred to Whatman filters and rinsed sequentially with 70% methanol then 90% methanol. Filters were allowed to dry, and radioactivity was assayed by liquid scintillation counting. The ratio of 3H cpm to 14C cpm, corrected for channel crossover, was a measure of DNA synthesis.

G2/M Checkpoint Assay—A G2/M checkpoint assay was performed, similar to previous descriptions (22). Briefly, pIND: U2OS and Spy1:U2OS cells were induced for 24 h, irradiated with UV, and allowed to recover in induction medium. At the indicated time points, cells were harvested by trypsinization/centrifugation and stained with phosphohistone H3 Alexa Fluor 488-conjugated antibody (Cell Signaling Technology) according to the manufacturer's protocol. The percentage of phosphohistone H3-positive cells was determined by flow cytometry.

Immunofluorescence Microscopy—Cells were seeded onto glass coverslips and induced for 24 h followed by irradiation with UV. 2 h post UV irradiation, coverslips were fixed with 4% formaldehyde for 10 min at room temperature and permeabilized with 0.1% Triton X-100 for 5 min at room temperature. Cells were then stained with either mouse antiphosphohistone H2A.X (Ser139) at 1:2500 or rabbit antiphospho-Chk1 (Ser317) at 1:1000. After extensive washing, cells were counterstained with anti-mouse IgG (fab-specific)-fluorescein isothiocyanate-conjugated antiserum (Sigma) at 1:500 or goat anti-rabbit-Alexa Flour (488)-conjugated antiserum (Molecular Probes) at 1:5000, respectively. Hoechst dye 33342 (1 µg/ml) was used to detect nuclei. For {gamma}H2AX, images were acquired using a Nikon Microphot-FXA microscope equipped with a Hamamatsu C5810 camera. For phospho-Chk1, images were acquired using an Applied Precision Delta Vision Deconvolution Microscope System (Nikon TE-200 Microscope) at the Digital Imaging Core University of California San Diego Cancer Center.

Isolation of Chromatin—To isolate chromatin-bound RPA, cells were removed from plates and preextracted with a chromatin isolation buffer (23) containing 20 mM Hepes (pH 7.4), 0.5% Triton X-100, 50 mM NaCl, 3 mM MgCl2, 300 mM sucrose, and protease/phosphatase inhibitors on ice for 5 min. Insoluble material was collected by centrifugation, sheared with a 23-gauge needle, and treated with DNase (0.1 units/ml) to extract chromatin-bound proteins.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Construction of Spy1-inducible and Control Cells in the U2OS Osteosarcoma Cell Line
To investigate the role of Spy1 in apoptosis and checkpoint activation, we created U2OS osteosarcoma cell lines allowing inducible expression of Spy1 using the ecdysone-inducible system (Fig. 1A). In brief, this expression system uses the steroid hormone ponasterone A, an analog of ecdysone, to activate expression of the inserted gene via a heterodimeric nuclear receptor. The gene of interest is cloned into the vector pIND and transfected into cells stably expressing pVgRXR. The pVgRXR vector encodes the heterodimer of the ecdysone receptor (VgEcR) and the retinoid X receptor (RXR) that binds a hybrid ecdysone response element (E/GRE) in the presence of ponasterone A (20).

Fig. 1B presents an analysis of the U2OS-derived cell lines used in this study. The control cell line, designated pIND: U2OS, contains an empty expression vector and does not express protein in response to ponasterone A induction. A matched cell line, designated Spy1:U2OS, exhibits inducible expression of Myc-Spy1 in response to ponasterone A. Previously, our work and that of others has demonstrated that Spy1 is a potent regulator of CDK2 (and Cdc2), activating the kinase through direct binding of the two proteins. The domain of Spy1 required for this interaction and subsequent activation of CDK2 is a central region containing an acidic stretch, known as the S/R box (6, 7). To examine whether Spy1 requires CDK2 binding to mediate responses to UV irradiation, we created a construct based on mutations previously shown to prevent CDK2 binding and activation (6, 7), mutating the five glutamate residues and the one aspartate residue within the Speedy/Ringo box to glutamine and asparagine, respectively (Spy1S/R box). We also constructed a matched cell line, Spy1S/R box:U2OS, allowing inducible expression of Myc-Spy1S/R box in response to ponasterone A. Following induction with ponasterone A, the inducible expression of Myc-Spy1S/R box was detected by immunoblotting of cell lysates with the Myc (9E10) antibody (Fig. 1B). To confirm the inability of the Spy1S/R box mutant protein to bind CDK2 efficiently (7), in Fig. 1C we compared CDK2 immunoprecipitates prepared from induced Spy1:U2OS cells and from induced Spy1S/R box:U2OS cells. Due to low levels of endogenous CDK2 expression (second panel, lanes 1 and 3), CDK2 was overexpressed by transfection in this experiment. Under these conditions, binding of Myc-Spy1 to CDK2 was readily detected, whereas binding of the mutant Myc-Spy1S/R box protein to CDK2 was barely detectable (third panel, lanes 2 and 4).


Figure 1
View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 1.
Spy1- and Spy1S/R box-inducible U2OS cells created with the ecdysone system. A, the ecdysone system consists of the pVgRXR vector, which encodes the heterodimer of the ecdysone receptor (VgEcR) and the retinoid X receptor (RXR) that binds a hybrid ecdysone response element (E/GRE) in the presence of ponasterone A (PonA), and the pIND vector into which the gene of interest is cloned. U2OS cells were stably transfected with pVgRXR and either empty pIND vector (pIND:U2OS), pIND-Spy1 (Spy1:U2OS), or pIND-Spy1S/R box (Spy1S/R box: U2OS). B, U2OS-inducible cells were induced with ponasterone A for 12 or 24 h. Mock-induced samples were prepared after 24 h. Lysates were resolved by SDS-PAGE, transferred to membrane, and probed with anti-Myc (9E10) antiserum to detect Myc-tagged Spy1 expression and tubulin as a loading control. C, Spy1:U2OS- or Spy1S/R box:U2OS-inducible cells were induced with ponasterone A and either mock- or CDK2-transfected for 24 h, after which cell lysates were resolved by SDS-PAGE, transferred to membrane, and probed with anti-Myc (9E10) antiserum to detect Myc-tagged Spy1 expression and also probed for CDK2 expression. Cell lysates were subsequently immunoprecipitated with CDK2 antiserum, resolved by SDS-PAGE, transferred to membrane, and probed with anti-Myc (9E10) antiserum to detect Spy1 protein binding to CDK2 and with CDK2 antiserum to detect total CDK2. IB, immunoblot; IP, immunoprecipitation.

 
Spy1 Prevents Apoptosis in U2OS Cells and Requires Interaction with CDK2 through the Speedy/Ringo Box
To examine the effect of Spy1 expression on UV-induced apoptosis, control pIND and Spy1:U2OS-inducible cell lines were irradiated with 50 J/m2 UVC after being induced for 24 h. At the indicated time points after UV irradiation, cells were collected, and apoptosis was determined by staining for DNA content using propidium iodide. The percentage of cells containing Sub-G1 DNA was determined and identified as apoptotic by flow cytometry. As seen in Fig. 2A, Spy1 expression drastically decreases apoptosis in U2OS cells at 12, 24, 48, and 72 h after UV irradiation by ~13, 20, 55, and 50%, respectively. In the experiment presented, pIND:U2OS cells served as the negative control in comparison with Spy1:U2OS cells, both treated with ponasterone A. As an additional negative control, Spy1:U2OS cells were examined in the absence of ponasterone A and exhibited UV-induced apoptosis similar to pIND: U2OS cells (Fig. 2D). For the remainder of the paper, pIND: U2OS cells are used as the negative control, whereas Spy1:U2OS cells without induction were omitted.

To further confirm that Spy1 prevents apoptosis, an Annexin V binding assay was used. In response to apoptotic stimuli, cells lose the asymmetry of the cell membrane as indicated by flipping of phosphatidylserine from the inner membrane leaflet to the outer leaflet (24-27). Annexin V is a protein that specifically binds phosphatidylserine. Staining with an Annexin V-fluorescein isothiocyanate conjugate allows for the detection of apoptotic cells by flow cytometry. After 24 h of induction, pIND:U2OS and Spy1:U2OS cells were irradiated with 50 J/m2 UVC and allowed to recover for 24 h. Spy1-expressing cells have only small amounts of Annexin V-positive staining (~7.5%) in response to UV, compared with control cells (~60%), further demonstrating that Spy1 expression is able to prevent apoptosis (Fig. 2B).

When challenged with UV irradiation, Spy1S/R box-expressing cells underwent apoptosis to a similar extent as the control cells (20-25% at 24 h post-UV and ~60% at 48 h), whereas the Spy1-expressing cells did not (less than 20% at either time point) (Fig. 2C), indicating that Spy1 must interact with and activate CDK2 in order to suppress apoptosis. This suggests that non-cyclin-mediated CDK2 activity may play an important role in the regulation of apoptosis in response to DNA damage.

Spy1 Expression Prevents the Activation of the Effector Caspase, Caspase-3
Caspases belong to a family of cysteine proteases that serve as major regulators of apoptosis (28). Initiator caspases, such as caspase-8, -9, -10, and -12, are activated by proapoptotic signals. Once activated, these caspases cleave and activate downstream effector caspases (including caspase-3, -6, and -7), which, in turn, cleave cytoskeletal and nuclear proteins, such as poly(ADP-ribose) polymerase, {alpha}-fodrin, DNA fragmentation factor, and lamin A.

To confirm that Spy1 expression blocks apoptosis through the conventional caspase pathways, the cleavage of caspase-3 was examined. As seen by immunoblotting with caspase-3 antibody, cleaved fragments of caspase-3 appear in pIND:U2OS cells as early as 12 h post-UV and continue to increase over time (Fig. 3A). In contrast, Spy1-expressing U2OS cells do not accumulate cleaved caspase-3 (Fig. 3A) at any time post-UV irradiation, indicating that the apoptotic program is not activated in response to UV when Spy1 is expressed.

To further confirm the suppression of apoptosis and inhibition of caspase-3 activation by Spy1 expression, we used intracellular immunostaining to detect active, cleaved caspase-3 by flow cytometry. As seen in Fig. 3B, control pIND:U2OS cells accumulated significant amounts of the cleaved form of caspase-3 at 12, 24, and 48 h after UV irradiation, indicated by shifts of the blue peaks, whereas Spy1:U2OS cells did not accumulate a significant amount of cleaved caspase-3. These results confirm that Spy1 prevents apoptosis by interfering with the activation of apoptotic pathways.


Figure 2
View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 2.
Spy1 prevents apoptosis in U2OS cells and requires the CDK2-interacting, Speedy/Ringo box domain. A, pIND:U2OS and Spy1:U2OS cells were induced with ponasterone A for 24 h, irradiated with UV, and harvested at 12, 24, 48, and 72 h postirradiation. Cells were fixed with ethanol, stained with propidium iodide, and analyzed for DNA content. Apoptotic cells were identified by the presence of sub-G1 DNA content. The percentage of apoptotic cells was calculated from at least three separate experiments and is presented as the mean ± S.D. normalized to unirradiated samples. B, pIND:U2OS and Spy1:U2OS cells were induced for 24 h and then irradiated with 50 J/m2 UV. 24 h after irradiation, cells were harvested, fixed, and stained with Annexin V-fluorescein isothiocyanate conjugate to detect apoptotic cells. Quadrants to the right of the bar indicate Annexin V-positive cells indicative of apoptosis. Cells in the upper quadrants have begun to lose membrane integrity. The results from one representative experiment are shown. C, pIND: U2OS, Spy1:U2OS, and Spy1S/R box:U2OS were induced for 24 h, irradiated with UV, and analyzed for apoptosis as in A. D, as an additional negative control, Spy1:U2OS cells in the absence or presence of ponasterone A (24-h treatment) were irradiated with UV and harvested at 24, 48, and 72 h postirradiation and analyzed as in A. 7-AAD, 7-amino-actinomycin D.

 
Spy1 Prevents the Activation of Both the S-phase Checkpoint and the G2/M Checkpoint
Checkpoint activation integrates the signals that regulate DNA damage responses, including DNA damage repair, cell cycle arrest, cell senescence, and apoptosis (12-14, 29, 30). To determine the role of Spy1 in S-phase checkpoints, pIND:U2OS and Spy1:U2OS cells were induced for 24 h and assayed for UVDS (21). The UVDS assay provides an indication of whether an S-phase or replication checkpoint is activated. As seen in Fig. 4A, control pIND:U2OS cells activate the checkpoint response when challenged with UV irradiation, showing almost a 50% decrease in DNA synthesis within 15 min postirradiation. In these cells, the checkpoint persists through 135 min, as demonstrated by continuous inhibition of DNA synthesis (31% of control DNA synthesis postirradiation). In contrast, Spy1:U2OS cells do not efficiently activate the S-phase checkpoint, as demonstrated by only small amounts of DNA synthesis inhibition. At 15 min, Spy1-expressing cells still have 76% of control DNA synthesis post-UV irradiation and 62% of control at the final time point of 135 min. These data indicate that Spy1 expression in U2OS cells confers a partial UVDS phenotype and that the S-phase checkpoint is not efficiently activated. These results also show that Spy1 expression allows for replication in the presence of DNA damage.


Figure 3
View larger version (55K):
[in this window]
[in a new window]
  		FIGURE 3.
Spy1 expression prevents the cleavage-associated activation of caspase-3. A, pIND:U2OS and Spy1:U2OS cells were induced for 24 h and then irradiated with 50 J/m2 UV. At the indicated times after irradiation, cell lysates were resolved by SDS-PAGE and immunoblotted with antiserum against caspase-3 to detect both the full-length and cleaved (active) fragments. The cleaved Caspase-3 panel is a longer exposure of the blot in the upper panel (caspase-3 full length). B, pIND:U2OS and Spy1:U2OS cells were induced for 24 h and then irradiated with 50 J/m2 UV. At the indicated times, cells were harvested and fixed. Subsequently, cells were permeabilized and stained with antiserum against the cleaved form of caspase-3 conjugated to Alexa Fluor 488. Flow cytometry was used to determine cells with active caspase-3. Results are representative of three independent experiments. Red peaks, nonirradiated cells; blue peaks, irradiated cells. IB, immunoblot.

 
The G2/M checkpoint is activated to prevent cells with damaged DNA or incomplete DNA replication from undergoing mitosis. Cells that fail to activate an S-phase checkpoint should prevent movement into mitosis by activating the G2/M checkpoint (31-33). To examine the effects of Spy1 expression on the G2/M checkpoint, pIND:U2OS and Spy1:U2OS cells were induced for 24 h, challenged with UV, and labeled with phosphohistone H3 antibody as a marker of M-phase entry (22, 34, 35). As shown in Fig. 4, B and C, a G2 arrest was observed in pIND:U2OS control cells as early as 2 h postirradiation (~30-fold decrease in phosphohistone H3 in UV-irradiated cells compared with unirradiated cells), and the G2/M checkpoints continued through 6 h, resulting in virtually no cells with detectable phosphohistone H3. In contrast, Spy1:U2OS cells showed no decrease in phosphohistone H3 staining compared with unirradiated cells at either time point. At 2 and 6 h post-UV irradiation, there was no detectable difference between the number of phosphohistone H3-positive UV-irradiated Spy1:U2OS cells as compared with unirradiated cells, suggesting that the cells continue to enter mitosis. Taken together, the data presented in Fig. 4 indicate that Spy1 expression prevents activation of checkpoints, allowing both replication and cell division to continue even as cells accumulate DNA damage.

Spy1 Suppresses Checkpoint Signaling
Spy1 Expression Prevents Maximal Phosphorylation of H2A.X in Response to UV Irradiation—To examine whether the antiapoptotic effects and checkpoint bypass observed in Spy1-expressing cells resulted from impaired checkpoint signaling, we examined the phosphorylation and localization of the histone variant H2A.X. In response to DNA damage, histone H2A.X becomes phosphorylated ({gamma}H2A.X) and localizes to discrete foci at sites of DNA damage. The ability of ATR to phosphorylate H2A.X in response to UV-induced DNA damage is required for proper localization of repair machinery, and phosphorylation of H2A.X is a reliable indicator of whether DNA damage response pathways are activated in response to damage stimuli (36-38). {gamma}H2A.X is believed to play a role in the recruitment of repair factors to sites of DNA damage (38). When pIND:U2OS control cells were examined by immunofluorescence microscopy, the induction of foci formation of {gamma}H2A.X was readily apparent (Fig. 5, compare A with C). In contrast, Spy1-expressing U2OS cells (Spy1:U2OS) showed very little phosphorylation or foci formation of {gamma}H2A.X, compared with control cells (Fig. 5G). Although a small increase in {gamma}H2A.X foci formation was observed in response to UV in the Spy1:U2OS cells, as compared with unirradiated control cells, the number of cells with foci compared with UV-irradiated pIND:U2OS cells was very low (Table 1). These results demonstrate that Spy1 expression interferes with the signaling of DNA damage to proteins such as histone H2A.X, suggesting that Spy1 interferes not only with the activation of checkpoints and apoptosis but also the signaling that leads to DNA repair in response to UV.


View this table:
[in this window]
[in a new window]
  		TABLE 1
Effects of Spy1 expression on {gamma}H2A.X foci formation in response to UV irradiation

Averages are representative of three separate experiments in which 100 cells/sample were counted.

 
Spy1 Expression Prevents the Phosphorylation of Chk1 and RPA32 N Terminus—To determine whether Spy1 expression prevents the phosphorylation of other ATR substrates, the activation of Chk1 by phosphorylation was examined. When Spy1-expressing cells were challenged with UV, phosphorylation of Chk1 at the activating site, Ser345, was inhibited compared with control cells (Fig. 6A). As early as 30 min after UV irradiation, pIND:U2OS cells accumulated Ser345-phosphorylated Chk1, which persisted through 6 h post-UV irradiation (Fig. 6A). In marked contrast, Spy1:U2OS cells failed to accumulate phosphorylated Chk1 at any time point. These results clearly demonstrate that Spy1 expression interferes with the signaling of DNA damage to the checkpoint kinase Chk1. These results were confirmed by examining cells for Chk1 phosphorylation using immunofluorescence microscopy. In control pIND: U2OS cells, UV irradiation resulted in the formation of intranuclear phospho-Chk1 foci, whereas Spy1:U2OS cells did not show phosphorylation of Chk1 nor the formation of foci (Fig. 6B), consistent with the data on {gamma}H2A.X foci formation.

Another ATR-specific signaling event in response to DNA damage induced by UV irradiation is the phosphorylation of the 32-kDa subunit of RPA on its N terminus (39, 40). Phosphorylation on Ser4 and Ser8 of RPA32 occurs after the coating of single-stranded DNA by RPA and activation of ATR and may play a role in defining distinct regions of DNA for damage signaling and repair (41, 42). Whereas hyperphosphorylation of RPA32 is associated with checkpoint activation, hypophosphorylation is associated with replication and replicative processivity (42, 43). Therefore, the phosphorylation of RPA32 by ATR may play a dual role in which distinct sites of repair are established while replication arrest is also promoted, which is an event required for the maximal activation of ATR and checkpoints in response to UV irradiation.


Figure 4
View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 4.
Spy1 expression prevents activation of the S-phase and G2/M checkpoints. A, UV irradiation induced S-phase checkpoint. pIND:U2OS and Spy1:U2OS cells were induced for 24 h, and DNA synthesis was assessed 15, 35, 75, and 135 min after UV irradiation and shown as a percentage of the control ± S.D. B, UV irradiation-induced G2/M checkpoint. pIND:U2OS and Spy1:U2OS cells were induced for 24 h and then irradiated with 50 J/m2 UV. At 0, 2, and 6 h postirradiation, cells were harvested, fixed, permeabilized, and stained with phosphohistone H3-Alexa Fluor-conjugated antibody and analyzed by flow cytometry. Data are representative of one of three independent experiments shown in C. C, percentage of cells positive for phosphohistone H3 at 0 and 6 h post-UV irradiation as determined by flow cytometry. Data from three independent experiments, including the experiment shown in B, are shown ± S.D.

 
To further investigate the DNA damage signaling response and to evaluate both ATR activity and replication status in response to UV irradiation, we examined phosphorylation of chromatin-bound RPA32 on Ser4 and Ser8. In response to UV irradiation, both control and Spy1-expressing cells had similar amounts of RPA32 bound to chromatin, indicating the presence of single-stranded DNA, but the phosphorylation status of RPA32 was significantly different. In control cells, 3 h postirradiation, RPA32 was phosphorylated extensively on Ser4 and Ser8 (Fig. 6C), and this modification persisted through 24 h. In marked contrast, Spy1:U2OS cells accumulated low amounts of phosphorylated RPA32. These results demonstrate that UV-induced DNA damage signaling is depressed by Spy1 expression. The hypophosphorylation of RPA32 further suggests that ATR is not fully activated in Spy1-expressing cells, consistent with the UVDS assay described above, demonstrating that DNA synthesis is not arrested in response to UV irradiation in Spy1-expressing cells (Fig. 4A).


Figure 5
View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 5.
Spy1 expression impairs the phosphorylation of histone H2A.X. A, C, E, and G, pIND:U2OS and Spy1:U2OS cells on coverslips were induced for 24 h and irradiated with 50 J/m2 UV. 2 h later, coverslips were fixed and stained with antiserum against phosphorylated histone H2A.X. Cells were counterstained with fluorescein isothiocyanate-conjugated secondary antibody. 100 cells were examined per sample in three independent experiments. Representative cells are shown. B, D, F, and H, cells were stained with Hoechst to detect the nucleus.

 
Inhibition of Chk1 and RPA32 Phosphorylation by Spy1 Requires Its Interaction and Activation of CDK2—To determine whether interaction with and activation of CDK2 by Spy1 are required for the inhibition of Chk1 phosphorylation in response to UV irradiation, we again used the S/R box mutant of Spy1, which does not bind or activate CDK2. Unlike expression of wild type Spy1, expression of this mutant does not result in suppression of UV irradiation damage-induced phosphorylation of Chk1 (Fig. 7A). Cells expressing the S/R box mutant accumulate phosphorylated Chk1 (at Ser345) at comparable levels and kinetics when compared with the control pIND:U2OS cells (Fig. 7A). These data indicate that Spy1 is required to bind and activate CDK2 for inhibition of Chk1 phosphorylation in response to UV-induced DNA damage, and therefore Spy1mediated CDK2 activity plays a role in checkpoint regulation, modulating the dynamics of Chk1 and other checkpoint protein activation.

To determine whether the interaction and activation of CDK2 is also required to suppress phosphorylation of RPA32, we again used the S/R box mutant of Spy1 and found that expression of this mutant had similar effects as those seen for Chk1 (Fig. 7B). In response to UV irradiation, Spy1 S/R box mutant expression did not have inhibitory effects on the phosphorylation of RPA32 compared with wild type Spy1. In fact, RPA32 phosphorylation in response to UV was increased over control when the mutant was expressed, indicating that the Spy1/CDK2 interaction plays a significant role in the regulation of RPA32 phosphorylation. This implies that Spy1-associated CDK2 activity may act to regulate the balance between replication processivity, arrest, and checkpoint activation, consistent with the previously described data demonstrating that Spy1 association with CDK2 functions in the regulation of apoptosis and checkpoint activation.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
We report here a role for Spy1 expression in checkpoint activation and apoptosis. We thus begin to describe the molecular mechanisms by which Spy1 exerts survival effects originally observed in our earlier report (3). We now show that Spy1 expression in U2OS cells decreases apoptosis in response to UV irradiation and that Spy1 expression allows for the bypass of both the S-phase/replication checkpoint and the G2/M checkpoint. Furthermore, checkpoint signaling is inhibited by Spy1 expression, demonstrated by impairment of H2A.X phosphorylation, inhibition of Chk1 activation by phosphorylation, and inhibition of RPA32 phosphorylation. Last, we demonstrate that these effects are mediated through CDK2, since a Spy1 mutant deficient in CDK2 activation fails to inhibit the DNA damage response.

Inhibition of Checkpoint Signaling to Chk1, RPA, and H2A.X—When replication stress is detected, ATR becomes active and begins a signaling cascade that leads to the further activation of checkpoints and/or apoptosis. One substrate of ATR is the checkpoint kinase, Chk1, which mediates activation of checkpoints (32, 33, 44, 45). Histone H2A.X is also phosphorylated within minutes of UV irradiation and localizes to sites of DNA damage (36). In this report, we show that Spy1-expressing cells do not accumulate activated Chk1. In addition, we found that histone H2A.X phosphorylation is impaired in Spy1-expressing cells. These results indicate impaired checkpoint responses and demonstrate that the cellular programs that ensure genomic fidelity fail to be activated when Spy1 is overexpressed.


Figure 6
View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 6.
Spy1 expression prevents the activation of Chk1. A, pIND:U2OS and Spy1:U2OS cells were induced for 24 h and irradiated with 50 J/m2.At0, 0.5, 1, 2, and 6 h after UV irradiation, cell lysates were prepared, resolved by SDS-PAGE, and transferred to membrane. The membrane was then blotted with phospho-Chk1 (Ser345) rabbit polyclonal antiserum, followed by chemiluminescence detection. The membrane was subsequently stripped and reprobed with total Chk1 antiserum, followed by Myc (9E10) antiserum to detect Myc-Spy1. B, immunofluorescent detection of phospho-Chk1 intranuclear foci. pIND:U2OS and Spy1:U2OS cells were seeded onto coverslips, induced for 24 h, and irradiated with 50 J/m2. 6 h after irradiation, coverslips were pulled and processed for phospho-Chk1 (Ser317) foci (green; Alexa Fluor 488). Cells were visualized with a Deltavision microscope and deconvolved. C, pIND:U2OS and Spy1:U2OS cells were induced for 24 h and irradiated with 50 J/m2. At the indicated time points, cells were harvested and preextracted to isolate chromatin-bound proteins. Extracts were resolved by SDS-PAGE and transferred to membrane. The membrane was then blotted with phospho-RPA32 (Ser4/Ser8) antiserum, followed by detection. The membrane was subsequently stripped and reprobed with RPA32 antiserum to determine total levels. Myc-Spy1 expression was detected by immunoblotting associated lysates with Myc (9E10) antiserum. IB, immunoblot.

 


Figure 7
View larger version (62K):
[in this window]
[in a new window]
  		FIGURE 7.
Binding of Spy1 to CDK2 is required for checkpoint inhibition. A, pIND:U2OS, Spy1:U2OS, and Spy1S/R box:U2OS were induced for 24 h, irradiated with UV, and harvested at the indicated time points. Half of the cells were lysed for use in immunoblotting (IB), and half were used as in B. Extracts were resolved by SDS-PAGE and transferred to membrane. The membrane was then blotted with a rabbit monoclonal antibody to phospho-Chk1 (Ser345). The membrane was subsequently stripped and reprobed with total Chk1 antiserum, followed by Myc (9E10) antiserum to detect Myc-Spy1. B, half of the cells from A were preextracted with chromatin buffer for 5 min on ice to isolate chromatin-bound proteins. Extracts were analyzed for phosphorylation on RPA32 using a phospho-RPA32 (Ser4/Ser8) antiserum, followed by chemiluminescence detection. The membrane was subsequently stripped and reprobed with RPA32 antiserum to determine total levels. The Myc (9E10) blot from A serves as the control for Myc-Spy1 and Myc-Spy1S/R box for this experiment.

 
Another event during the response to UV-induced DNA damage is the phosphorylation of the N terminus of RPA32 by ATR. This phosphorylation is believed to establish distinct domains for checkpoint signaling and DNA damage repair while preventing the progression of replication (41, 42). In addition, hyperphosphorylation of the N terminus of RPA32 promotes DNA repair, whereas hypophosphorylation is associated with DNA replication (42, 43). In the results presented here, we found that Spy1 expression prevented the accumulation of phosphorylated RPA32, consistent with the inability of Spy1-expressing cells to signal DNA damage and indicating that ATR is not activated at sites of damage. This may be attributable to the inability of cells to arrest DNA replication, prevent replication reinitiation, or prevent late origin firing.

In support of the replication arrest defects, we found that Spy1-expressing cells continue to synthesize DNA after UV irradiation, a phenomenon known as radio-resistant DNA synthesis (22). This result clearly demonstrates that DNA replication is not inhibited when Spy1 is expressed. We hypothesize that enhanced DNA repair would not account for the results we have observed and suggest other mechanisms by which Spy1 could prevent activation of DNA damage signaling events mediated by ATR. First, through CDK2 hyperactivation, Spy1 could cause rapid reinitiation of stalled replication forks, leading to virtually undisturbed DNA polymerase activity and replication. Second, Spy1 expression could promote bypass polymerization during which error-prone polymerases synthesize DNA through UV-induced lesions, bypassing a fork-stalling event. Last, through its atypical activation of CDKs, Spy1 expression could effectively remove the targets of checkpoints, setting up feedback loops that result in checkpoint inactivation.

Checkpoint Bypass in Spy1-expressing Cells—The S-phase checkpoint, or replication checkpoint, arrests DNA replication by inhibiting the firing of late origins through inhibition of CDK2, thereby preventing cells from progressing into G2 with DNA damage or incomplete replication (30). Previous work has demonstrated that inhibition or depletion of many of the DNA damage response proteins, including ATM (46), ATR (47), and Chk1 (48), and disruption of the checkpoint-regulated Cdc25A-CDK2 pathway (49) leads to a radio-resistant DNA synthesis or UVDS phenotype. We assayed the activation of this checkpoint using a UVDS assay (21) and found that Spy1-expressing cells show a partial UVDS phenotype.

The G2/M checkpoint prevents cells from entering mitosis by inhibiting Cdc2. This is accomplished through Chk1-dependent degradation of Cdc25A (31, 50, 51). When assayed for G2 checkpoint activation, Spy1-expressing cells were refractory to cell cycle arrest. This may be explained by the fact that Chk1 is not activated in Spy1-expressing cells.

These results indicate that Spy1 plays an inhibitory role in checkpoint activation, achieved by direct inhibition of one of the checkpoint response pathways. One explanation for checkpoint bypass would be the hyperactivation of CDKs by Spy1, given that Spy1 and its homologs can activate CDKs in the absence of known mechanisms of activation (7, 8). In fact, Spy1 would be able to overcome checkpoint-inhibitory mechanisms that depend upon CDK2.

We show here that Spy1 expression prevents Chk1 phosphorylation as well as H2A.X and RPA32 phosphorylation, which are most likely attributable to defects in ATR signaling. ATR activation in response to DNA damage requires DNA replication or inhibition thereof (52, 53), indicating that ATR activation is confined to the S-phase of the cell cycle. Spy1 may interfere with the ability of a cell to recognize disturbances in DNA replication in S-phase that normally lead to ATR activation. CDK2 has been shown to regulate the initiation of DNA synthesis, replication resumption after arrest, and the expression of many S-phase regulators (54-56). Thus, the hyperactivation of CDK2 by Spy1 may lead to S-phase disturbances that prevent activation of an ATR-dependent checkpoint.

Inhibition of Apoptosis by Spy1—We have observed (Fig. 2) that inducible Spy1 expression protects cells from apoptosis in response to UV damage and that the apoptotic machinery is not activated when Spy1 is expressed (Fig. 3), reflected in the inhibition of caspase-3 activation. Apoptosis is activated in response to DNA damage by complex pathways involving checkpoint signaling. This inhibition of apoptosis may be attributed to the fact that Spy1-expressing cells fail to sense the accumulation of DNA damage that would normally impair replication, as described earlier, and therefore fail to activate appropriate responses, such as programmed cell death.

In summary, we show that Spy1 expression prevents activation of apoptotic machinery and, importantly, prevents activation of both the S-phase/replication checkpoint and the G2/M checkpoint. Spy1 expression suppresses signaling to mediators of the checkpoint response, which are specific for apoptosis (caspase-3), checkpoint activation/DNA repair ({gamma}H2A.X and RPA), or are common to both pathways (Chk1). Furthermore, we show that the interaction of Spy1 with CDK2 is required for these effects, suggesting that Spy1 association with CDKs may play a prominent role in abnormal cell cycle events, such as the DNA damage response, checkpoint signaling, and apoptosis. The evasion of checkpoints and apoptosis are both traits selected by cancer cells. These findings are relevant to the role of Spy1 overexpression reported in invasive breast carcinomas (19).


   FOOTNOTES
 
* This work was supported by NCI, National Institutes of Health, Ruth L. Kirschstein National Research Service Award T32 CA009523 [GenBank] (to R. G.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: University of California San Diego, Dept. of Chemistry and Biochemistry, 9500 Gilman Dr., La Jolla, CA 92093-0367. Tel.: 858-534-2463; Fax: 858-534-7481; E-mail: ddonoghue{at}ucsd.edu.

2 The abbreviations used are: S/R, Speedy/Ringo; UVDS, UV irradiation-resistant DNA synthesis; RXR, retinoid X receptor; Spy1:U2OS, Spy1-expressing U2OS cells; PBS, phosphate-buffered saline; CDK, cyclin-dependent kinase. Back


   ACKNOWLEDGMENTS
 
We thank Jeff Esko and Omai Garner for assistance with flow cytometry, Geoff Wahl for critical discussion, Jim Feramisco and Kersi Pestonjamasp for assistance with deconvolution microscopy, and Mark Wade for valuable advice.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lenormand, J. L., Dellinger, R. W., Knudsen, K. E., Subramani, S., and Donoghue, D. J. (1999) EMBO J. 18, 1869-1877[CrossRef][Medline] [Order article via Infotrieve]
  2. Porter, L. A., Dellinger, R. W., Tynan, J. A., Barnes, E. A., Kong, M., Lenormand, J. L., and Donoghue, D. J. (2002) J. Cell Biol. 157, 357-366[Abstract/Free Full Text]
  3. Barnes, E. A., Porter, L. A., Lenormand, J. L., Dellinger, R. W., and Donoghue, D. J. (2003) Cancer Res. 63, 3701-3707[Abstract/Free Full Text]
  4. Ferby, I., Blazquez, M., Palmer, A., Eritja, R., and Nebreda, A. R. (1999) Genes Dev. 13, 2177-2189[Abstract/Free Full Text]
  5. Karaiskou, A., Perez, L. H., Ferby, I., Ozon, R., Jessus, C., and Nebreda, A. R. (2001) J. Biol. Chem. 276, 36028-36034[Abstract/Free Full Text]
  6. Dinarina, A., Perez, L. H., Davila, A., Schwab, M., Hunt, T., and Nebreda, A. R. (2004) Biochem. J. 386, 349-355
  7. Cheng, A., Xiong, W., Ferrell, J. E., Jr., and Solomon, M. J. (2005) Cell Cycle 4, 155-165[Medline] [Order article via Infotrieve]
  8. Cheng, A., Gerry, S., Kaldis, P., and Solomon, M. J. (2005) BMC Biochem. 6, 19[CrossRef][Medline] [Order article via Infotrieve]
  9. Schneider, E., Montenarh, M., and Wagner, P. (1998) Oncogene 17, 2733-2741[CrossRef][Medline] [Order article via Infotrieve]
  10. Porter, L. A., Kong-Beltran, M., and Donoghue, D. J. (2003) Mol. Biol. Cell 14, 3664-3674[Abstract/Free Full Text]
  11. Evan, G. I., and Vousden, K. H. (2001) Nature 411, 342-348[CrossRef][Medline] [Order article via Infotrieve]
  12. Abraham, R. T. (2001) Genes Dev. 15, 2177-2196[Free Full Text]
  13. Shiloh, Y. (2003) Nat. Rev. Cancer 3, 155-168[CrossRef][Medline] [Order article via Infotrieve]
  14. Zhou, B. B., and Elledge, S. J. (2000) Nature 408, 433-439[CrossRef][Medline] [Order article via Infotrieve]
  15. Bartkova, J., Horejsi, Z., Koed, K., Kramer, A., Tort, F., Zieger, K., Guldberg, P., Sehested, M., Nesland, J. M., Lukas, C., Orntoft, T., Lukas, J., and Bartek, J. (2005) Nature 434, 864-870[CrossRef][Medline] [Order article via Infotrieve]
  16. Lowe, S. W., Cepero, E., and Evan, G. (2004) Nature 432, 307-315[CrossRef][Medline] [Order article via Infotrieve]
  17. Fridman, J. S., and Lowe, S. W. (2003) Oncogene 22, 9030-9040[CrossRef][Medline] [Order article via Infotrieve]
  18. Brown, J. M., and Attardi, L. D. (2005) Nat. Rev. Cancer 5, 231-237[CrossRef][Medline] [Order article via Infotrieve]
  19. Zucchi, I., Mento, E., Kuznetsov, V. A., Scotti, M., Valsecchi, V., Simionati, B., Vicinanza, E., Valle, G., Pilotti, S., Reinbold, R., Vezzoni, P., Albertini, A., and Dulbecco, R. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 18147-18152[Abstract/Free Full Text]
  20. No, D., Yao, T. P., and Evans, R. M. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 3346-3351[Abstract/Free Full Text]
  21. Tsao, C. C., Geisen, C., and Abraham, R. T. (2004) EMBO J. 23, 4660-4669[CrossRef][Medline] [Order article via Infotrieve]
  22. Lin, S. Y., Li, K., Stewart, G. S., and Elledge, S. J. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 6484-6489[Abstract/Free Full Text]
  23. Syljuasen, R. G., Sorensen, C. S., Hansen, L. T., Fugger, K., Lundin, C., Johansson, F., Helleday, T., Sehested, M., Lukas, J., and Bartek, J. (2005) Mol. Cell. Biol. 25, 3553-3562[Abstract/Free Full Text]
  24. Flores, E. R., Tsai, K. Y., Crowley, D., Sengupta, S., Yang, A., McKeon, F., and Jacks, T. (2002) Nature 416, 560-564[CrossRef][Medline] [Order article via Infotrieve]
  25. Martin, S. J., Reutelingsperger, C. P., McGahon, A. J., Rader, J. A., van Schie, R. C., LaFace, D. M., and Green, D. R. (1995) J. Exp. Med. 182, 1545-1556[Abstract/Free Full Text]
  26. van Engeland, M., Nieland, L. J., Ramaekers, F. C., Schutte, B., and Reutelingsperger, C. P. (1998) Cytometry 31, 1-9[CrossRef][Medline] [Order article via Infotrieve]
  27. Vermes, I., Haanen, C., Steffens-Nakken, H., and Reutelingsperger, C. (1995) J. Immunol. Methods 184, 39-51[CrossRef][Medline] [Order article via Infotrieve]
  28. Liu, X., Kim, C. N., Yang, J., Jemmerson, R., and Wang, X. (1996) Cell 86, 147-157[CrossRef][Medline] [Order article via Infotrieve]
  29. Bartek, J., and Lukas, J. (2001) FEBS Lett. 490, 117-122[CrossRef][Medline] [Order article via Infotrieve]
  30. Bartek, J., Lukas, C., and Lukas, J. (2004) Nat. Rev. Mol. Cell Biol. 5, 792-804[CrossRef][Medline] [Order article via Infotrieve]
  31. Xiao, Z., Chen, Z., Gunasekera, A. H., Sowin, T. J., Rosenberg, S. H., Fesik, S., and Zhang, H. (2003) J. Biol. Chem. 278, 21767-21773[Abstract/Free Full Text]
  32. Zhao, H., and Piwnica-Worms, H. (2001) Mol. Cell Biol. 21, 4129-4139[Abstract/Free Full Text]
  33. Liu, Q., Guntuku, S., Cui, X. S., Matsuoka, S., Cortez, D., Tamai, K., Luo, G., Carattini-Rivera, S., DeMayo, F., Bradley, A., Donehower, L. A., and Elledge, S. J. (2000) Genes Dev. 14, 1448-1459[Abstract/Free Full Text]
  34. Xu, B., Kim, S., and Kastan, M. B. (2001) Mol. Cell Biol. 21, 3445-3450[Abstract/Free Full Text]
  35. Taylor, W. R. (2004) Methods Mol. Biol. 281, 293-299[Medline] [Order article via Infotrieve]
  36. Ward, I. M., and Chen, J. (2001) J. Biol. Chem. 276, 47759-47762[Abstract/Free Full Text]
  37. Rogakou, E. P., Pilch, D. R., Orr, A. H., Ivanova, V. S., and Bonner, W. M. (1998) J. Biol. Chem. 273, 5858-5868[Abstract/Free Full Text]
  38. Paull, T. T., Rogakou, E. P., Yamazaki, V., Kirchgessner, C. U., Gellert, M., and Bonner, W. M. (2000) Curr. Biol. 10, 886-895[CrossRef][Medline] [Order article via Infotrieve]
  39. Carty, M. P., Zernik-Kobak, M., McGrath, S., and Dixon, K. (1994) EMBO J. 13, 2114-2123[Medline] [Order article via Infotrieve]
  40. Liu, J. S., Kuo, S. R., and Melendy, T. (2006) DNA Repair 5, 369-380[Medline] [Order article via Infotrieve]
  41. Iftode, C., Daniely, Y., and Borowiec, J. A. (1999) Crit. Rev. Biochem. Mol. Biol. 34, 141-180[Medline] [Order article via Infotrieve]
  42. Vassin, V. M., Wold, M. S., and Borowiec, J. A. (2004) Mol. Cell Biol. 24, 1930-1943[Abstract/Free Full Text]
  43. Binz, S. K., Sheehan, A. M., and Wold, M. S. (2004) DNA Repair 3, 1015-1024[CrossRef][Medline] [Order article via Infotrieve]
  44. Guo, Z., Kumagai, A., Wang, S. X., and Dunphy, W. G. (2000) Genes Dev. 14, 2745-2756[Abstract/Free Full Text]
  45. Kumagai, A., Kim, S. M., and Dunphy, W. G. (2004) J. Biol. Chem. 279, 49599-49608[Abstract/Free Full Text]
  46. Morgan, S. E., Lovly, C., Pandita, T. K., Shiloh, Y., and Kastan, M. B. (1997) Mol. Cell Biol. 17, 2020-2029[Abstract]
  47. Garg, R., Callens, S., Lim, D. S., Canman, C. E., Kastan, M. B., and Xu, B. (2004) Mol. Cancer Res. 2, 362-369[Abstract/Free Full Text]
  48. Wang, J. L., Wang, X., Wang, H., Iliakis, G., and Wang, Y. (2002) Cell Cycle 1, 267-272[Medline] [Order article via Infotrieve]
  49. Falck, J., Mailand, N., Syljuasen, R. G., Bartek, J., and Lukas, J. (2001) Nature 410, 842-847[CrossRef][Medline] [Order article via Infotrieve]
  50. Shimuta, K., Nakajo, N., Uto, K., Hayano, Y., Okazaki, K., and Sagata, N. (2002) EMBO J. 21, 3694-3703[CrossRef][Medline] [Order article via Infotrieve]
  51. Jin, J., Shirogane, T., Xu, L., Nalepa, G., Qin, J., Elledge, S. J., and Harper, J. W. (2003) Genes Dev. 17, 3062-3074[Abstract/Free Full Text]
  52. Lupardus, P. J., Byun, T., Yee, M. C., Hekmat-Nejad, M., and Cimprich, K. A. (2002) Genes Dev. 16, 2327-2332[Abstract/Free Full Text]
  53. Ward, I. M., Minn, K., and Chen, J. (2004) J. Biol. Chem. 279, 9677-9680[Abstract/Free Full Text]
  54. Alexandrow, M. G., and Hamlin, J. L. (2005) J. Cell Biol. 168, 875-886[Abstract/Free Full Text]
  55. Zhu, Y. (2004) Cell Cycle 3, 1358-1362[Medline] [Order article via Infotrieve]
  56. Ye, X., Wei, Y., Nalepa, G., and Harper, J. W. (2003) Mol. Cell. Biol. 23, 8586-8600[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
M. Al Sorkhy, R. Craig, B. Market, R. Ard, and L. A. Porter
The Cyclin-dependent Kinase Activator, Spy1A, Is Targeted for Degradation by the Ubiquitin Ligase NEDD4
J. Biol. Chem., January 30, 2009; 284(5): 2617 - 2627.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/46/35425    most recent
M604720200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gastwirt, R. F.
Right arrow Articles by Donoghue, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gastwirt, R. F.
Right arrow Articles by Donoghue, D. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement