Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M604638200 on September 19, 2006

J. Biol. Chem., Vol. 281, Issue 47, 36173-36179, November 24, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/47/36173    most recent
M604638200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Opitz, B.
Right arrow Articles by Hippenstiel, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Opitz, B.
Right arrow Articles by Hippenstiel, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Legionella pneumophila Induces IFNbeta in Lung Epithelial Cells via IPS-1 and IRF3, Which Also Control Bacterial Replication*

Bastian Opitz{ddagger}12, Maya Vinzing{ddagger}1, Vincent van Laak{ddagger}, Bernd Schmeck{ddagger}, Guido Heine§, Stefan Günther, Robert Preissner, Hortense Slevogt{ddagger}, Philippe Dje N'Guessan{ddagger}, Julia Eitel{ddagger}, Torsten Goldmann||, Antje Flieger**, Norbert Suttorp{ddagger}, and Stefan Hippenstiel{ddagger}

From the {ddagger}Department of Internal Medicine/Infectious Diseases and Pulmonary Medicine, Charité Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany, the §Department of Dermatology and Allergy, Allergy Center Charité, Charité Universitätsmedizin Berlin, Schumannstrasse 20/21, 10117 Berlin, Germany, Institute of Biochemistry Charité, Monbijoustrasse 2, 10117 Berlin, Germany, ||Clinical and Experimental Pathology, Research Center Borstel, Parkallee 3, 23845 Borstel, Germany, and **Robert Koch Institute, Research Group NG5 Pathogenesis of Legionella Infections, Nordufer 20, D-13353 Berlin, Germany

Received for publication, May 15, 2006 , and in revised form, August 7, 2006.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Legionella pneumophila, a Gram-negative facultative intracellular bacterium, causes severe pneumonia (Legionnaires' disease). Type I interferons (IFNs) were so far associated with antiviral immunity, but recent studies also indicated a role of these cytokines in immune responses against (intracellular) bacteria. Here we show that wild-type L. pneumophila and flagellin-deficient Legionella, but not L. pneumophila lacking a functional type IV secretion system Dot/Icm, or heat-inactivated Legionella induced IFNbeta expression in human lung epithelial cells. We found that factor (IRF)-3 and NF-{kappa}B-p65 translocated into the nucleus and bound to the IFNbeta gene enhancer after L. pneumophila infection of lung epithelial cells. RNA interference demonstrated that in addition to IRF3, the caspase recruitment domain (CARD)-containing adapter molecule IPS-1 (interferon-beta promoter stimulator 1) is crucial for L. pneumophila-induced IFNbeta expression, whereas other CARD-possessing molecules, such as RIG-I (retinoic acid-inducible protein I), MDA5 (melanoma differentiation-associated gene 5), Nod27 (nucleotide-binding oligomerization domain protein 27), and ASC (apoptosis-associated speck-like protein containing a CARD) seemed not to be involved. Finally, bacterial multiplication assays in small interfering RNA-treated cells indicated that IPS-1, IRF3, and IFNbeta were essential for the control of intracellular replication of L. pneumophila in lung epithelial cells. In conclusion, we demonstrated a critical role of IPS-1, IRF3, and IFNbeta in Legionella infection of lung epithelium.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The innate immunity serves as a first line defense system against invading pathogens, including bacteria or viruses. It senses microbial derived molecules by so-called pattern recognition receptors (PRRs),3 such as the Toll-like receptors (TLRs), the Nod-like receptors, or the RNA helicases RIG-I (retinoic acid-inducible gene-I) and MDA5 (melanoma differentiation-associated gene 5), and mediates up-regulation and production of antibacterial and antiviral mediators (1-4). IFN{alpha} and -beta constitute the type I IFN family and were originally identified as humeral factors that confer an antiviral state on cells (5). The expression of IFN{alpha}/beta is essentially controlled by transcription factors of the IFN regulatory factor (IRF) family (6). After expression and secretion, IFN{alpha}/beta binds to the IFN{alpha}/beta receptor, which, via signaling to the signal transducers and activators of transcription/c-Jun-activated kinase pathway, induces expression of so-called IFN-stimulated genes, many of which have antiviral activities (7).

Much attention has recently been directed to the mechanism of pathogen-induced IRF activation. Double-stranded RNA and lipopolysaccharide, when recognized by TLR3 and TLR4, respectively, stimulated a TRIF (and TRAM for TLR4)-TBK1/IKKi signaling module leading to IRF3 and IRF7 activation; TLR7-TLR9 detect single-stranded RNA and CpG DNA and stimulate IRF5 and IRF7 via a MyD88-dependent pathway also involving IRAK1/4 and TRAF6 (2, 8, 9). Moreover, certain viruses or double-stranded RNA activated a TLR-independent pathway, which signals via the cytosolic RNA helicases RIG-I and/or MDA5, the adapter molecule IPS-1 (interferon-beta promoter stimulator 1) (also called MAVS, VISA, and Cardif), thereby stimulating IRF3 and IRF7 (1, 4, 10-13).

Besides antiviral immunity, recent work demonstrated an involvement of IFNbeta in innate immune responses against the intracellular, Gram-positive bacterium Listeria monocytogenes (14-19). Although TBK1 and IRF3, but not the TLRs or Nod1/2, participated in Listeria-induced IFNbeta induction, the upstream signaling molecules involved, including the PRRs, remained obscure (20-22).

The Gram-negative bacterium Legionella pneumophila, the causative agent of Legionnaires' disease, has also been shown to replicate in human cells, including alveolar macrophages and epithelial cells (23, 24). Legionella are enclosed within a vacuole during their intracellular replication. They possess the type IVB secretion system Dot/Icm that enables them to inject proteins and nucleic acids into the host cell cytoplasm. Here we demonstrate that wild-type L. pneumophila, but not Legionella deficient in the Dot/Icm system, induced IFNbeta expression through IPS-1 and IRF3. In addition, we observe a negative regulatory effect of IPS-1 and IRF3 on intracellular replication of L. pneumophila in lung epithelial cells.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Bacterial Strains—The L. pneumophila strains used in this study were wild-type serogroup 1 strains 130b (kindly provided by N. Cianciotto (Chicago, IL)), JR32, JR32 mutant with a knock out in dotA, encoding a protein essential for the type IVB secretion system (kindly provided by H. Shuman (New York, NY)), wild-type Corby, and Corby deficient in flagellin ({Delta}flaA; kindly provided by K. Heuner (Würzburg, Germany)). L. pneumophila was grown on buffered charcoal-yeast extract (BCYE) agar for 2 days at 37 °C before uses.

RNA Interference in A549 Cells—Control nonsilencing siRNA (sense, UUCUCCGAACGUGUCACGUtt; antisense, ACGUGACACGUUCGGAGAAtt), siRNAs targeting IPS-1 (IPS-1a (sense, UAGUUGAUCUCGCGGACGAtt; antisense, UCGUCCGCGAGAUCAACUAtt); IPS-1b (sense, CCACCUUGAUGCCUGUGAAtt; antisense, UUCACAGGCAUCAAGGUGGtt); and apoptosis-associated specklike protein containing a CARD (ASC) (sense, GAUGCGGAAGCUCUUCAGUtt; antisense, ACUGAAGAGCUUCCGCAUCtt)) were purchased from MWG. IRF3 siRNA (sense, GGAGGAUUUCGGAAUCUUCtt; antisense, GAAGAUUCCGAAAUCCUCCtg), RIG-I siRNA (sense, CGAUUCCAUCACUAUCCAUtt; antisense, AUGGAUAGUGAUGGAAUCGtt), MDA5 siRNA (sense, GGAUUGUGCAGAAAGAAAAtt; antisense, UUUUCUUUCUGCACAAUCCtt), Nod27 siRNA (sense, GCAGACAGGCUAUGCUUUCtt; antisense, GAAAGCAUAGCCUGUCUGCtg), and Nod5 siRNA (sense, GUUAUUCCUAAAGGAGACCtt; antisense, GGUCUCCUUUAGGAAUAACtt) were from Ambion. A549 cells were transfected by using Amaxa NucleofectorTM (Amaxa) according to the manufacturer's protocol (NucleofectorTM Solution V, NucleofectorTM program G-16) with 2 µg of siRNA/106 cells.

Infection/Stimulation of A549 Cells—Cells were infected with L. pneumophila at MOI as indicated, centrifuged for 30 min at 800 x g to enhance bacterial adherence and internalization, and incubated for 6.5 h at 37 °C (IFNbeta mRNA expression). In the chromatin immunoprecipitation (ChIP) and Western blot experiments, A549 cells were starved in culture medium without fetal calf serum overnight and subsequently infected with L. pneumophila (MOI 10) for the indicated time intervals. In certain experiments, LyoVec-complexed B-DNA (poly(dA-dT)-poly(dT-dA); InvivoGen) at 1 µg/ml was used as a control.

RT-PCR Analysis—Total RNA from A549 cells was isolated with the RNeasy Mini kit (Qiagen) and reverse transcribed using avian myeloblastosis reverse transcriptase (Promega). The generated cDNA was amplified by semiquantitative RT-PCR using specific primers (IFNbeta-sense, 5'-GCTCTCCTGTTGTGCTTCTCCAC-3'; IFNbeta-antisense, 5'-CAATAGTCTCATTCCAGCCAGTGC-3'; IRF3-sense, 5'-TACGTGAGGCATGTGCTGA-3'; IRF3-antisense, 5'-AGTGGGTGGCTGTTGGAAAT-3'; IPS-1-sense, 5'-ATGCCGTTTGCTGAAGAC-3'; IPS-1-antisense, 5'-CTAGTGCAGACGCCGCCG-3'; RIG-I-sense, 5'-TCCTTTATGAGTATGTGGGCA-3'; RIG-I-antisense, 5'-TCGGGCACAGAATATCTTTG-3'; MDA5-sense, 5'-TCCTGGTTGCTCACAGTGGTT-3'; MDA5-antisense, 5'-GAGACAAGGCAAATCTAAGCC-3'; ASC-sense, ATGCGCTGGAGAACCTGA; ASC-antisense, AGGTAGGACTGGGACTCCCTTA; Nod27-sense, TGGGAAGACACTCAGGCTAA; Nod27-antisense, ATCATCGTCCTCACAGAGGTT; Nod5-sense, GGAGTGCAGCTTTTGTGTGA; Nod5-antisense, AGATGCGTCAGGCTCTTGTT; IL-8-sense, 5'-CTAGGACAAGAGCCAGGAAGA-3'; IL-8-antisense, 5'-AACCCTCTGCACCCAGTTTTC-3'; GAPDH-sense, 5'-CCACCCATGGCAAATTCCATGGCA-3'; GAPDH-antisense, 5'-TCTAGACGGCAGGTCAGGTCCACC-3').

Quantitative RT-PCR—Real time PCRs were carried out using the SYBR-green DNA Amplification Kit (Roche Applied Science) on a Lightcycler® apparatus (Roche Applied Science). The primers used were IFNbeta-sense (5'-AAACTCATGAGCAGTCTGCA-3') and IFNbeta antisense (5'-AGGAGATCTTCAGTTTCGGAGG-3'). Input was normalized by the average expression of the housekeeping gene S9: S9-sense (5'-ATCCGCCAGCGCCATA-3') and S9-antisense (5'-TCAATGTGCTTCTGGGAATCC-3'). All PCRs were carried out in duplicates, and relative IFNbeta expression in control siRNA-transfected/Legionella-infected cells was set as 100%.

Western Blot—Cytoplasmatic or nuclear extracts of A549 cells were separated by SDS-PAGE and blotted. Membranes were exposed to antibodies specific to IRF3 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or p65 (Santa Cruz Biotechnology), respectively, and subsequently incubated with secondary antibodies (IRDye 800-labeled anti-mouse or Cy5.5-labeled anti-rabbit, respectively). Proteins were detected by using an Odyssey infrared imaging system (LI-COR Inc.).

Immunhistochemistry—Human lung specimens were fixed, paraffin-embedded by utilizing the HOPE-technique, and subjected to immunohistochemistry. After deparaffinization, the endogenous peroxidase was blocked by incubation with 3% H2O2. Nonspecific binding was minimized by incubation with heat-inactivated pig serum diluted 1:30 in Tris-buffered saline. Rabbit anti-IRF3 (Santa Cruz Biotechnology) was used as primary antibody, and detection and visualization were performed by the LSAB2 technique with aminoethylcarbazole as a chromogenic substrate for the horseradish peroxidase. Slides were counterstained by Mayer's hemalum, mounted with Kayser's glycerolgelatine, and photomicrographed. Negative controls were included by omission of the primary antibody.

ChIP—A549 cells were infected with L. pneumophila as indicated and then subjected to a ChIP assay as previously described using anti-IRF3 (Santa Cruz Biotechnology), anti-p65 (Santa Cruz Biotechnology), or anti-RNA polymerase II (Santa Cruz Biotechnology) antibodies (25). The IFNbeta enhancer region was amplified by PCR using HotstarTaq polymerase (Qiagen) and specific primers as follows: sense, 5'-GAATCCACGGATACAGAACCT-3'; antisense, 5'-TTGACAACACGAACAGTGTCG-3'. PCR amplification of the total input DNA in each sample is shown as a control.


Figure 1
View larger version (39K):
[in this window]
[in a new window]

  		FIGURE 1.
L. pneumophila induced IFNbeta expression in A549 cells. A549 cells were infected with wild-type L. pneumophila strain 130b (L. p.) (A) or wild-type L. pneumophila strains JR32 (L. p. JR) or JR32 Legionella (B), which were deficient in their type IVB secretion system (L. p. JR {Delta}dotA). C, A549 cells were infected with wild-type L. pneumophila strain 130b (L. p.) at an MOI of 10 or stimulated with an equal amount of heat-inactivated Legionella (hiL. p.). D, A549 cells were infected with wild-type L. pneumophila strain Corby (L. p. Corby) or flagellin-lacking Legionella (L. p. Corby {Delta}flaA). IFNbeta and GAPDH expressions were analyzed by RT-PCR. Results shown are representative of three independent experiments.

 
Bacterial Replication Assay—A549 cells were transfected with siRNA targeting IRF3 or IPS-1 or control siRNA. After 56 h, cells were pretreated with 1000 IU/ml rIFNbeta (InvivoGen) as indicated. After further 16 h, cells were infected with L. pneumophila (MOI 0.1), centrifuged for 30 min at 800 x g, and incubated further for 1.5 h at 37 °C. Cells were then washed twice with PBS, and culture medium containing 50 µg/ml gentamycin was added to the cells for 1 h to kill remaining extracellular Legionella. Subsequently, cells were washed, and culture medium with rIFNbeta, as indicated, was added (this time point represents 0 h). Cells were incubated and washed at the indicated time intervals with PBS and lysed with 0.1% saponin for 5 min, and lysates were plated on BCYE agar to count Legionella colony-forming units.

Statistics—Inhibitory effects of siRNAs used were statistically evaluated employing Student's t test. p values of <0.05 are indicated by one asterisk.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
L. pneumophila-induced IFNbeta Expression in Lung Epithelial Cells—In order to characterize the effects of L. pneumophila on lung epithelial cells, we incubated A549 cells with the bacteria at different MOIs. L. pneumophila infection with strain 130b and JR32 both dose-dependently increased IFNbeta mRNA expression (Fig. 1, A and B), whereas L. pneumophila JR32 deficient in its type IVB secretion system or heat-inactivated L. pneumophila did not (Fig. 1, B and C), suggesting that substrate translocation via the type IVB secretion system and/or intracellular replication were necessary for the IFNbeta response. Moreover, Legionella flagellin seemed not to be involved, since L. pneumophila strain Corby and a respective flagellin mutant were both capable of inducing IFNbeta induction (Fig. 1D).


Figure 2
View larger version (72K):
[in this window]
[in a new window]

  		FIGURE 2.
L. pneumophila induced IRF3 and p65 nuclear translocation and IFNbeta enhancer binding. A, detection of IRF3 in human lung tissues by immunohistochemistry. IRF3 is expressed in human lung airway epithelia (I; magnification x400), within alveolar epithelial cells (II; magnification x800), and within alveolar macrophages (III; magnification x400). The arrows indicate alveolar epithelial cells, and arrowheads show alveolar macrophages. B, A549 cells were infected with L. pneumophila (130b). After the indicated time intervals, nuclear cell extracts were probed by Western blot using the indicated antibodies. Shown is one representative experiment of three. C, A549 cells were infected with L. pneumophila for the indicated time intervals. A ChIP assay was performed by using antibodies as indicated and subsequent amplification of the IFNbeta enhancer. IFNbeta enhancer was also amplified from the DNA-protein complex before the precipitation (Input). Data are representative for three independent experiments. IP, immunoprecipitation.

 
IRF3 Is Required for L. pneumophila-stimulated IFNbeta Expression—IFNbeta responses upon Legionella infection led us to assess a possible link between Legionella infection and IRF3 activation. IRF3 is expressed in human lung tissue (Fig. 2A) and in A549 cells. L. pneumophila infection of A549 cells induced nuclear translocation of IRF3 as demonstrated by immunoblotting of nuclear extracts with a specific IRF3 antibody (Fig. 2B). Moreover, the NF-{kappa}B subunit p65/RelA also translocated into the nucleus of Legionella-infected cells.

In order to further address the effects of L. pneumophila on the transcription factors examined, we performed a ChIP assay by using IFNbeta enhancer-specific primers. A549 cells were infected with L. pneumophila, and immunoprecipitations with IRF3, p65, and RNA polymerase II antibodies were carried out. As shown in Fig. 2C, Legionella infection led to a temporary binding of IRF3 and p65 to the IFNbeta enhancer. After 60 min, recruitment of RNA polymerase II to the IFNbeta enhancer indicated gene transcription. Taken together, these results demonstrated that Legionella infection stimulated transcriptional activity of IRF3 and p65.

Next, we performed RNAi experiments to analyze the importance of IRF3 for IFNbeta expression. A549 cells were transfected either with nonspecific nonsilencing control siRNA or with specific siRNA targeting IRF3, respectively. After 72 h, cells were infected with L. pneumophila, and quantitative PCR and semiquantitative RT-PCR were carried out. As shown in Fig. 3, Legionella infection induced IFNbeta expression in cells that were transfected with the control siRNA. IRF3 siRNA strongly inhibited IFNbeta up-regulation caused by L. pneumophila. The expression of IRF3 was assessed in parallel in order to monitor the RNAi effects. Data indicate that the siRNA used was capable of silencing its specific target mRNA. As a second control, we checked mRNA expression of IL-8, a predominantly NF-{kappa}B-regulated gene (26); as expected, the Legionella-induced IL-8 mRNA up-regulation was hardly affected by any siRNA used. Overall, our data showed that IRF3 is important for IFNbeta induction by L. pneumophila.


Figure 3
View larger version (20K):
[in this window]
[in a new window]

  		FIGURE 3.
Role of IRF3 in L. pneumophila-induced IFNbeta expression. A549 cells were transfected with control siRNA (contr.) or siRNAs targeting IRF3. After 3 days, cells were infected with L. pneumophila (130b, MOI 10; L. p.) for 7 h, and quantitative and semiquantitative RT-PCRs as indicated were performed. Gels shown are representative of three independent experiments. Data obtained by quantitative PCR represent means ± S.D. of two independent experiments performed in duplicates.

 
IPS-1 Is Required for L. pneumophila-stimulated IFNbeta Expression—IPS-1/MAVS/VISA/Cardif has been demonstrated to be crucial for RIG-I- and MDA5-mediated IRF3 activation and subsequent IFNbeta induction by double-stranded RNA as well as certain viruses and very recently also for IFNbeta responses induced by cytosolic B-form DNA via a so far unidentified receptor (10-13, 27). Knowing in addition that in the TLR family different TLRs share adapter molecules and thereby activate similar signaling cascades (2, 8), overall, we hypothesized that IPS-1 mediates IFNbeta responses by Legionella. We therefore tested the involvement of IPS-1 by using two IPS-1 siRNAs that had already been used in two of the initial reports identifying IPS-1/MAVS (10, 12). Data obtained in A549 cells demonstrated that both siRNAs targeting IPS-1 abrogated the up-regulation of IFNbeta caused by L. pneumophila infection or by synthetic B-DNA (Fig. 4) (data not shown). We thus concluded that IPS-1 is critically involved in the IFNbeta responses to Legionella infection.


Figure 4
View larger version (26K):
[in this window]
[in a new window]

  		FIGURE 4.
Role of IPS-1 in L. pneumophila-induced IFNbeta expression. A549 cells were transfected with control siRNA (contr.) or two different siRNAs targeting IPS-1 (IPS-1a and IPS-1b). After 3 days, cells were infected with L. pneumophila (130b, MOI 10; L. p.), and quantitative and semiquantitative RT-PCRs were performed. Gels shown are representative of three independent experiments. Data obtained by quantitative PCR represent means ± S.D. of two independent experiments performed in duplicates with quantification of IFNbeta mRNA normalized to S9 mRNA.

 
RIG-I, MDA5, ASC, Nod27, and Nod5 siRNAs Did Not Inhibit the L. pneumophila-stimulated IFNbeta Expression—Since the CARD containing IPS-1 is known to interact with homologous domains within its upstream receptor molecules RIG-I and MDA5 (10-13), we hypothesized that the putative PRR or an intermediate that mediates the IFNbeta responses by Legionella lies upstream of IPS-1 and also contains a CARD (28). Our own search in the Pfam data base (29) with IPS-1-CARD together with published data (28) identified in addition to RIG-I and MDA5 several proteins, of which some were tested by RNAi for their involvement in IFNbeta responses to Legionella. Data indicated that siRNAs targeting RIG-I, MDA5, ASC, Nod27 (which might have a atypical CARD (28)), or Nod5 (which might not have a CARD (28)) inhibited their specific mRNA but not the IFNbeta induction activated by L. pneumophila infection or by synthetic B-DNA (Fig. 5) (data not shown). In the case of Nod27 siRNA, we even observed an enhancement of the Legionella-induced IFNbeta up-regulation. Overall, the data argue against RIG-I, MDA5, ASC, Nod27, and Nod5 mediating IFNbeta induction activated by L. pneumophila.

IPS-1, IRF3, and IFNbeta Negatively Regulate Intracellular Replication of L. pneumophila in Lung Epithelial Cells—Finally, we wanted to know if the IPS-1-IRF-IFNbeta cascade activated by L. pneumophila has a regulatory impact on the intracellular replication of the bacteria. Therefore, A549 cells were transfected either with nonsilencing control siRNA or with specific siRNAs targeting IPS-1 or IRF3, respectively. In addition, some cells were pretreated with rIFNbeta 56 h after transfection. 72 h after transfection (16 h after rIFNbeta treatment), cells were infected with L. pneumophila, and numbers of intracellular bacteria were counted at different time points, as described under "Experimental Procedures." As shown in Fig. 6, L. pneumophila replicated within the lung epithelial cells examined (0 h, 1533 ± 88; 48 h, 146,667 ± 37,564). Moreover, overall numbers of Legionella increased in cells in which expression of IPS-1 or IRF3 was inhibited by siRNA (Fig. 6, A and B). In the case of IPS-1 silencing, similar results were obtained by using the two different siRNA sequences (data not shown). In contrast, treatment with rIFNbeta diminished numbers of intracellular bacteria and rescued the IPS-1 and IRF3 deficiencies. Taken together, intracellular replication of L. pneumophila in lung epithelial cells was enhanced by IPS-1 and IRF3 silencing and inhibited by rIFNbeta treatment.


Figure 5
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 5.
RIG-I (A), MDA5 (B), ASC (C), Nod27 (D), and Nod5 (E) siRNA did not inhibit the IFNbeta responses against Legionella. A549 cells were transfected with control siRNA (contr.) or siRNAs targeting RIG-I, MDA5, ASC, Nod27, or Nod5. After 3 days, cells were infected with L. pneumophila (130b, MOI 10; L. p.), and RT-PCRs as indicated were performed. Gels shown are representative of at least two independent experiments.

 


Figure 6
View larger version (17K):
[in this window]
[in a new window]

  		FIGURE 6.
IPS-1 and IRF3 control replication of L. pneumophila in lung epithelial cells. A549 cells were transfected with control siRNA or siRNAs targeting IPS-1 (A) or IRF3 (B). In addition, cells were treated with rIFNbeta were indicated. 72 h after transfection, cells were infected with L. pneumophila (130b, MOI 0.1) for 2 h, extracellular bacteria were removed by washing and killed by gentamycin, and multiplication of Legionella was assessed by colony-forming unit (CFU) counting. Data represent means of three independent experiments.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Classically, type I IFNs had been particularly associated with antiviral immune responses, but an increasing body of work demonstrated that type I IFNs also played important roles in the host defense against bacterial infections (30). We expand on this by demonstrating 1) that L. pneumophila induced IFNbeta expression in lung epithelial cells, a process dependent on its type IVB secretion system but not on flagellin; 2) that IPS-1 and IRF3 are crucial for the IFNbeta response to L. pneumophila, and 3) that IPS-1 and IRF3 were important for the control of intracellular replication of L. pneumophila in lung epithelial cells. Our results showing enhanced multiplication of Legionella in IPS-1 or IRF3 siRNA-transfected cells, which was restored by IFNbeta treatment, did not formally prove but strongly suggest that endogenously produced IFNbeta controlled Legionella replication. Our finding demonstrating that the CARD-containing IPS-1 mediated the IFNbeta responses against Legionella led us to hypothesize that the upstream putative PRR or signaling mediator involved also possessed a CARD. We started to examine several CARD-containing molecules for their contribution in the IFNbeta induction by Legionella. Because Nod1 and Nod2 do not mediate IFNbeta induction (data not shown) (20-22) and Nod3 is not expressed in A549 cells (data not shown) (31), first we focused on Nod27 and Nod5, which might have a CARD or atypical CARD (28), as well as on CARD-containing RIG-I, MDA5, and ASC. Our results argue against these molecules mediating the Legionella-induced IFNbeta responses. Due to its CARD and leucine-rich repeats (LRR), IPAF/CARD12/CLAN (potentially together with NAIP/Birc1) would also have been a promising candidate, but recent reports demonstrating that IPAF together with NAIP5/Birc1e mediate host cell responses against Legionella flagellin in mice (32-34) and our finding that Legionella flagellin was not required for IFNbeta induction suggest that IPAF is not involved in the type I IFN response. On the other hand, both the IFNbeta response and the NAIP5-IPAF-caspase-1 cascade (32-34) restrict replication of Legionella in host cells or mice, respectively, potentially suggesting an interaction of these mechanisms. Thus, although we were so far unable to identify the exact sensing molecule upstream of IPS-1, further studies regarding identification of this putative PRR and a potential involvement of IPAF (and NAIP/Birc1) and other CARD-containing molecules in the Legionella-induced IFNbeta responses are needed.

Type I IFNs have been demonstrated to be both favorable and detrimental to the host defense during bacterial infections and may be dependent on the pathogen involved. In line with our results, multiplication of L. pneumophila in mouse macrophages was inhibited by treatment with IFN{alpha}/beta and enhanced by anti-IFN{alpha}/beta antibodies, thus also suggesting a role of endogenous type I IFNs in controlling replication of Legionella in host cells (35). In a different infection model with L. monocytogenes, however, murine macrophages defective in type I IFN receptor signaling were more resistant to infections than wild-type macrophages, and mice defective in type I IFN receptor were less susceptible to Listeria infections than wild-type mice in vivo (14, 15, 17, 19). The underlining mechanisms are poorly understood, but the differences observed may be related to the different pathogens (L. pneumophila versus L. monocytogenes).

After completion of this work, several studies pertinent to results presented were published. Akira's group (27) demonstrated an IPS-1-dependent, but TLR- and RIG-I-independent, induction of type I IFNs by B-DNA in human cells. In addition, Stetson and Medzhitov (36) showed a stimulation of IFNbeta response by L. pneumophila but not by Legionella lacking dotA, which was independent of Nod1/2 and the TLRs. The study suggested that by means of its type IVB secretion system, L. pneumophila translocated DNA into the host cell cytosol, which in turn activated IFNbeta expression. Thus, although these studies and our results suggest that L. pneumophila-derived DNA activates an IPS-1- and IRF3-dependent IFNbeta response, more recent data failed to support this hypothesis by demonstrating that IPS-1/MAVS-KO mouse cells showed an only moderately reduced or even equal IFN response to cytosolic B-DNA, DNA virus, or L. monocytogenes compared with wild-type cells (37, 38). In addition, IPS-1 siRNA did not block type I IFN induction by L. monocytogenes in mouse macrophages (39). Thus, this discrepancy might reflect differences between humans and mice. Moreover, in addition to B-DNA, further pathogen-associated molecular patterns of Legionella or Listeria might contribute to the observed responses, and different pathogens (L. pneumophila versus L. monocytogenes) might be sensed by distinct sensing mechanisms.

Overall, further work is warranted to further elucidate 1) the sensing mechanism that recognizes Legionella or potentially its DNA and activates IRFs and 2) which mechanism enables IPS-1-IRF-IFNbeta to control L. pneumophila replication in host cells.


   FOOTNOTES
 
* This work was supported in part by grants from the Bundesministerium für Bildung und Forschung, BMBF Competence Network CAPNETZ C15 (to S. H.), CAPNETZ C15 (to B. S.), and CAPNETZ C4 (to N. S.). Parts of this work will be included in the M.D. thesis of M. V. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 These two authors contributed equally to this work. Back

2 To whom correspondence should be addressed: Dept. of Internal Medicine/Infectious Diseases and Respiratory Medicine, Charité Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany. Tel.: 49-30-450-553383; Fax: 49-30-450-553992; E-mail: bastian.opitz{at}charite.de.

3 The abbreviations used are: PRR, pattern recognition receptor; TLR, Toll-like receptor; IFN, interferon; IRF, IFN regulatory factor; siRNA, small interfering RNA; ChIP, chromatin immunoprecipitation; MOI, multiplicity of infection; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IL, interleukin; RNAi, RNA interference; rIFNbeta, recombinant IFNbeta; CARD, caspase recruitment domain; IFN, interferon; IPS, IFNbeta promoter stimulator 1; IRF, IFN-regulatory factor; NF-{kappa}B, nuclear factor-{kappa}B; TLR, Toll-like receptor. Back


   ACKNOWLEDGMENTS
 
We are grateful to J. Hellwig and S. Schapke for excellent technical assistance and C. Dang for help with quantitative PCR.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Andrejeva, J., Childs, K. S., Young, D. F., Carlos, T. S., Stock, N., Goodbourn, S., and Randall, R. E. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 17264-17269[Abstract/Free Full Text]
  2. Kawai, T., and Akira, S. (2005) Curr. Opin. Immunol. 17, 338-344[CrossRef][Medline] [Order article via Infotrieve]
  3. Philpott, D. J., and Girardin, S. E. (2004) Mol. Immunol. 41, 1099-1108[CrossRef][Medline] [Order article via Infotrieve]
  4. Yoneyama, M., Kikuchi, M., Natsukawa, T., Shinobu, N., Imaizumi, T., Miyagishi, M., Taira, K., Akira, S., and Fujita, T. (2004) Nat. Immunol. 5, 730-737[CrossRef][Medline] [Order article via Infotrieve]
  5. Katze, M. G., He, Y., and Gale, M., Jr. (2002) Nat. Rev. Immunol. 2, 675-687[CrossRef][Medline] [Order article via Infotrieve]
  6. Barnes, B., Lubyova, B., and Pitha, P. M. (2002) J. Interferon Cytokine Res. 22, 59-71[CrossRef][Medline] [Order article via Infotrieve]
  7. Levy, D. E., and Darnell, J. E., Jr. (2002) Nat. Rev. Mol. Cell. Biol. 3, 651-662[CrossRef][Medline] [Order article via Infotrieve]
  8. Beutler, B. (2005) Immunogenetics 57, 385-392[CrossRef][Medline] [Order article via Infotrieve]
  9. Honda, K., Yanai, H., Takaoka, A., and Taniguchi, T. (2005) Int. Immunol. 17, 1367-1378[Abstract/Free Full Text]
  10. Kawai, T., Takahashi, K., Sato, S., Coban, C., Kumar, H., Kato, H., Ishii, K. J., Takeuchi, O., and Akira, S. (2005) Nat. Immunol. 6, 981-988[CrossRef][Medline] [Order article via Infotrieve]
  11. Meylan, E., Curran, J., Hofmann, K., Moradpour, D., Binder, M., Bartenschlager, R., and Tschopp, J. (2005) Nature 437, 1167-1172[CrossRef][Medline] [Order article via Infotrieve]
  12. Seth, R. B., Sun, L., Ea, C. K., and Chen, Z. J. (2005) Cell 122, 669-682[CrossRef][Medline] [Order article via Infotrieve]
  13. Xu, L. G., Wang, Y. Y., Han, K. J., Li, L. Y., Zhai, Z., and Shu, H. B. (2005) Mol. Cell. 19, 727-740[CrossRef][Medline] [Order article via Infotrieve]
  14. Auerbuch, V., Brockstedt, D. G., Meyer-Morse, N., O'Riordan, M., and Portnoy, D. A. (2004) J. Exp. Med. 200, 527-533[Abstract/Free Full Text]
  15. Carrero, J. A., Calderon, B., and Unanue, E. R. (2004) J. Exp. Med. 200, 535-540[Abstract/Free Full Text]
  16. McCaffrey, R. L., Fawcett, P., O'Riordan, M., Lee, K. D., Havell, E. A., Brown, P. O., and Portnoy, D. A. (2004) Proc. Natl. Acad. Sci. U. S. A. 101, 11386-11391[Abstract/Free Full Text]
  17. O'Connell, R. M., Saha, S. K., Vaidya, S. A., Bruhn, K. W., Miranda, G. A., Zarnegar, B., Perry, A. K., Nguyen, B. O., Lane, T. F., Taniguchi, T., Miller, J. F., and Cheng, G. (2004) J. Exp. Med. 200, 437-445[Abstract/Free Full Text]
  18. O'Riordan, M., Yi, C. H., Gonzales, R., Lee, K. D., and Portnoy, D. A. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 13861-13866[Abstract/Free Full Text]
  19. Stockinger, S., Materna, T., Stoiber, D., Bayr, L., Steinborn, R., Kolbe, T., Unger, H., Chakraborty, T., Levy, D. E., Muller, M., and Decker, T. (2002) J. Immunol. 169, 6522-6529[Abstract/Free Full Text]
  20. O'Connell, R. M., Vaidya, S. A., Perry, A. K., Saha, S. K., Dempsey, P. W., and Cheng, G. (2005) J. Immunol. 174, 1602-1607[Abstract/Free Full Text]
  21. Opitz, B., Puschel, A., Beermann, W., Hocke, A. C., Forster, S., Schmeck, B., van, L., V, Chakraborty, T., Suttorp, N., and Hippenstiel, S. (2006) J. Immunol. 176, 484-490[Abstract/Free Full Text]
  22. Stockinger, S., Reutterer, B., Schaljo, B., Schellack, C., Brunner, S., Materna, T., Yamamoto, M., Akira, S., Taniguchi, T., Murray, P. J., Muller, M., and Decker, T. (2004) J. Immunol. 173, 7416-7425[Abstract/Free Full Text]
  23. Neild, A. L., and Roy, C. R. (2004) Cell Microbiol. 6, 1011-1018[CrossRef][Medline] [Order article via Infotrieve]
  24. Swanson, M. S., and Hammer, B. K. (2000) Annu. Rev. Microbiol. 54, 567-613[CrossRef][Medline] [Order article via Infotrieve]
  25. Schmeck, B., Zahlten, J., Moog, K., van, L. V., Huber, S., Hocke, A. C., Opitz, B., Hoffmann, E., Kracht, M., Zerrahn, J., Hammerschmidt, S., Rosseau, S., Suttorp, N., and Hippenstiel, S. (2004) J. Biol. Chem. 279, 53241-53247[Abstract/Free Full Text]
  26. Mukaida, N., Mahe, Y., and Matsushima, K. (1990) J. Biol. Chem. 265, 21128-21133[Abstract/Free Full Text]
  27. Ishii, K. J., Coban, C., Kato, H., Takahashi, K., Torii, Y., Takeshita, F., Ludwig, H., Sutter, G., Suzuki, K., Hemmi, H., Sato, S., Yamamoto, M., Uematsu, S., Kawai, T., Takeuchi, O., and Akira, S. (2006) Nat. Immunol. 7, 40-48[CrossRef][Medline] [Order article via Infotrieve]
  28. Martinon, F., and Tschopp, J. (2005) Trends Immunol. 26, 447-454[CrossRef][Medline] [Order article via Infotrieve]
  29. Finn, R. D., Mistry, J., Schuster-Bockler, B., Griffiths-Jones, S., Hollich, V., Lassmann, T., Moxon, S., Marshall, M., Khanna, A., Durbin, R., Eddy, S. R., Sonnhammer, E. L., and Bateman, A. (2006) Nucleic Acids Res. 34, D247-D251[Abstract/Free Full Text]
  30. Decker, T., Muller, M., and Stockinger, S. (2005) Nat. Rev. Immunol. 5, 675-687[CrossRef][Medline] [Order article via Infotrieve]
  31. Conti, B. J., Davis, B. K., Zhang, J., O'connor, W., Jr., Williams, K. L., and Ting, J. P. (2005) J. Biol. Chem. 280, 18375-18385[Abstract/Free Full Text]
  32. Molofsky, A. B., Byrne, B. G., Whitfield, N. N., Madigan, C. A., Fuse, E. T., Tateda, K., and Swanson, M. S. (2006) J. Exp. Med. 203, 1093-1104[Abstract/Free Full Text]
  33. Ren, T., Zamboni, D. S., Roy, C. R., Dietrich, W. F., and Vance, R. E. (2006) PLoS Pathog. 2, e18[CrossRef][Medline] [Order article via Infotrieve]
  34. Zamboni, D. S., Kobayashi, K. S., Kohlsdorf, T., Ogura, Y., Long, E. M., Vance, R. E., Kuida, K., Mariathasan, S., Dixit, V. M., Flavell, R. A., Dietrich, W. F., and Roy, C. R. (2006) Nat. Immunol. 7, 318-325[CrossRef][Medline] [Order article via Infotrieve]
  35. Schiavoni, G., Mauri, C., Carlei, D., Belardelli, F., Pastoris, M. C., and Proietti, E. (2004) J. Immunol. 173, 1266-1275[Abstract/Free Full Text]
  36. Stetson, D. B., and Medzhitov, R. (2006) Immunity 24, 93-103[CrossRef][Medline] [Order article via Infotrieve]
  37. Kumar, H., Kawai, T., Kato, H., Sato, S., Takahashi, K., Coban, C., Yamamoto, M., Uematsu, S., Ishii, K. J., Takeuchi, O., and Akira, S. (2006) J. Exp. Med. 203, 1795-1803[Abstract/Free Full Text]
  38. Sun, Q., Sun, L., Liu, H. H., Chen, X., Seth, R. B., Forman, J., and Chen, Z. J. (2006) Immunity 24, 633-642[CrossRef][Medline] [Order article via Infotrieve]
  39. Soulat, D., Bauch, A., Stockinger, S., Superti-Furga, G., and Decker, T. (2006) FEBS Lett. 580, 2341-2346[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
P. Liu, K. Li, R. P. Garofalo, and A. R. Brasier
Respiratory Syncytial Virus Induces RelA Release from Cytoplasmic 100-kDa NF-{kappa}B2 Complexes via a Novel Retinoic Acid-inducible Gene-I{middle dot}NF-{kappa}B-inducing Kinase Signaling Pathway
J. Biol. Chem., August 22, 2008; 283(34): 23169 - 23178.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. Schmeck, J. Lorenz, P. D. N'Guessan, B. Opitz, V. van Laak, J. Zahlten, H. Slevogt, M. Witzenrath, A. Flieger, N. Suttorp, et al.
Histone Acetylation and Flagellin Are Essential for Legionella pneumophila-Induced Cytokine Expression
J. Immunol., July 15, 2008; 181(2): 940 - 947.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Vinzing, J. Eitel, J. Lippmann, A. C. Hocke, J. Zahlten, H. Slevogt, P. D. N'Guessan, S. Gunther, B. Schmeck, S. Hippenstiel, et al.
NAIP and Ipaf Control Legionella pneumophila Replication in Human Cells
J. Immunol., May 15, 2008; 180(10): 6808 - 6815.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. E. Cole, A. Santiago, E. Barry, T. J. Kang, K. A. Shirey, Z. J. Roberts, K. L. Elkins, A. S. Cross, and S. N. Vogel
Macrophage Proinflammatory Response to Francisella tularensis Live Vaccine Strain Requires Coordination of Multiple Signaling Pathways
J. Immunol., May 15, 2008; 180(10): 6885 - 6891.
[Abstract] [Full Text] [PDF]

Home page
 Eur Respir JHome page
H. Slevogt, L. Maqami, K. Vardarowa, W. Beermann, A. C. Hocke, J. Eitel, B. Schmeck, A. Weimann, B. Opitz, S. Hippenstiel, et al.
Differential regulation of Moraxella catarrhalis-induced interleukin-8 response by protein kinase C isoforms
Eur. Respir. J., April 1, 2008; 31(4): 725 - 735.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
G. Cheng, J. Zhong, J. Chung, and F. V. Chisari
Double-stranded DNA and double-stranded RNA induce a common antiviral signaling pathway in human cells
PNAS, May 22, 2007; 104(21): 9035 - 9040.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/47/36173    most recent
M604638200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Opitz, B.
Right arrow Articles by Hippenstiel, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Opitz, B.
Right arrow Articles by Hippenstiel, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement