![]()
|
|
||||||||
J. Biol. Chem., Vol. 281, Issue 48, 36579-36587, December 1, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Section of Molecular Genetics and Microbiology and the Institute for Cellular and Molecular Biology, University of Texas, Austin, Texas 78172-1095
Received for publication, July 17, 2006 , and in revised form, September 12, 2006.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Yeast Nmd3p is 518 amino acids in length. The leucine-rich NES is within its C-terminal 50 amino acids (amino acids 470518) (1, 2) and is predicted to form an amphipathic
-helix. Upstream of the NES is a putative coiled-coil region (aa 426465) that could mediate intra- or intermolecular protein interactions, possibly to facilitate interaction of the NES or NLS with transport receptors. It has been suggested that this domain contains a secondary NES (NES2) (2) that can functionally substitute for the primary NES. Additionally, Nmd3p contains a highly basic region (aa 399419) that is necessary for efficient import of Nmd3p into the nucleus (1) in a Kap123p-dependent manner (8). These C-terminal shuttling motifs are found in the eukaryotic Nmd3 proteins but not in their archaeal counterparts. The N-terminal 27 kDa of Nmd3p comprises the domain that is conserved in all archaeal Nmd3 proteins. An additional 9 kDa is conserved among the euryarchaeotic proteins that also contain a C-terminal eIF5A-like domain (7). The highly conserved N-terminal domain contains four Cys-X2-Cys repeats that are probably zinc binding motifs reminiscent of Type IV zinc fingers (9) and treble clef motifs (10). This potential zinc-coordinating domain in Nmd3p is probably required for protein-RNA and/or protein-protein interaction with the 60 S subunit; however, this has not been established experimentally. In lieu of three-dimensional structural information for Nmd3p, we present a mutational analysis of the functional organization of Nmd3p, utilizing point mutations as well as deletion mutations.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
0 his3
1 leu2
0 lys2
0 nmd3::kanMX/pAJ112), AJY1539 (MATa leu2 ura3 his3
1 met15
0 CRM1(T539C)-HA) (5), and W303 (W303 MATa leu2-3,112 his3-11 ura3-1 trp1-1 ade2-1 can1-100 SSD1-d). Unless otherwise noted, standard yeast genetics methods and media were used as described in Ref. 11. All strains were grown at 30 °C unless otherwise indicated in rich medium (yeast extract-peptone) or dropout medium (synthetic complete) containing either 2% glucose or 1% galactose.
PlasmidsPlasmids used in this work are listed in Table 1. pAJ582 (NMD3-GFP) was made by amplifying GFP with 5' oligonucleotide AJO230 (AGAAGATGGAGTCGAGAACACACCCGTTGAATCTCAGCAGCGGATCCCGGGTTAATTAA) and 3' oligonucleotide AJO307 (GCGAAGCTTGGCCTCGAAACGTGAGTC) using pFA6a-GFP(S65T)-KanMX6 (12) as template, digesting with PacI and HindIII, and ligating it into the same sites of pAJ538. pAJ583 and pAJ584 were made similarly, using pAJ534 (nmd3
50) and pAJ535 (nmd3
100) (1), respectively. Unless otherwise noted, Myc denotes 13 tandem copies of the c-Myc epitope. pAJ537 was made similarly to pAJ536 (NMD3
120) (1). To make pAJ752 (NMD3AAA-myc), 5' oligonucleotide AJO247 (CGGAATTCACTGTCCAGTTTATGGATC) and 3' oligonucleotide AJO389 (5'-GCAAGCTTAGATTAATGTCATTTCATCTGCCTCGTCGGCTAATTCATCAGCGTTGATTT) were first used in PCR to amplify nucleotides 8431516 of NMD3 while introducing missense mutations as underlined. This product was amplified with AJO247 and 5' oligonucleotide AJO413 (GGCAAGCTTAGTTAATTAACCCGGGGATCCGCTGCTGAGATTCAACGGGTGTGTTCTCGACTCCATCTTCTAATGTCATTTCAT). The product was cut with BglII-PacI and ligated into BglII-PacI-cut pAJ535 to make pAJ752. GFP, amplified from pFA6a-GFP(S65T)-KanMX using 5'-oligonucleotide AJO230 (AGAAGATGGAGTCGAGAACACACCCGTTGAATCTCAGCAGCGGATCCCCGGGTTAATTAA) and AJO307 (GCGAAGCTTGGCCTCGAAACGTGAGTC) was cut with PacI-HindIII and ligated into the same sites of pAJ752 to give pAJ754. pAJ670 was made by replacing the NheI-HindIII fragment of pAJ237 (13) with the NheI-HindIII fragment from pAJ667 (XNG). pAJ665 was made by inserting the complementary oligonucleotides AJO364 (GATCCCCACAAATCAACATTGATGAATTATTGGACGAGTTAGATTA) and AJO365 (AGCTTAATCTAACTCGTCCAATAATTCATCAATGTTGATTTGTGGG) into BamHI-HindIII-cut pAJ667. Moving the NheI to HindIII fragment from pAJ665 into pAJ237 gave pAJ671. The PCR product from amplification of NMD3 with 5' oligonucleotide AJO384 (CGCGGATCCGATGAAGACGCTCCACAA) and 3' oligonucleotide AJO329 (CTGCATCCAGTATACACACCCA) was digested with BamHI-HindIII and ligated into BamHI-HindIII-cut pAJ675 (XNG) to make pAJ673 (XNG-NES-(485519)). pAJ676 (XNG-NES-(485505)) was made by replacing the NheI-HindIII fragment from pAJ675 with the NheI-HindIII fragment of the PCR product obtained using 5' oligonucleotide 3160 (ATCGAAGTTTATCGCGG) and 3' oligonucleotide AJO382 (CTAAGCTTAGATTAATGTCATTTCATCTAA) with pAJ673 as template. pAJ677 (XNG-NES(AA)) and pAJ678 (XNG-NES(AAA)) were made similarly to pAJ676 but using 3' oligonucleotide AJO388 (GCAAGCTTAGATTAATGTCATTTCATCTAACTCGTCGGCTGCTTCATCAATG) or AJO389 (GCAAGCTTAGATTAATGTCATTTCATCTGCCTCGTCGGCTAATTCATCAGCGTTGATTT), respectively, incorporating the underlined mutations. To make pAJ751 (NMD3AA-myc), 5' oligonucleotide AJO247 (CGGAATTCACTGTCCAGTTTATGGATC) and 3' oligonucleotide AJO388 (GCAAGCTTAGATTAATGTCATTTCATCTAACTCGTCGGCTGCTTCATCAATG) were used to amplify nucleotides 8431516 of NMD3. This product was then amplified with AJO247 (CGGAATTCACTGTCCAGTTTATGGATC) and 3' oligonucleotide AJO413 (GGCAAGCTTAGTTAATTAACCCGGGGATCCGCTGCTGAGATTCAACGGGTGTGTTCTCGACTCCATCTTCTAATGTCATTTCAT), cut with BglII-PacI, and ligated into BglII-PacI-cut pAJ535 (NMD3C
100-myc). pAJ752 (NMD3AAA-myc) was made similarly, except the 3' oligonucleotide used in the first PCR was AJO389 (GCAAGCTTAGATTAATGTCATTTCATCTGCCTCGTCGGCTAATTCATCAGCGTTGATTT. pAJ753 (NMD3AA-GFP) was made by replacing the Myc tag with GFP as a PacI-HindIII fragment from pAJ582. pAJ377 (NMD3C
33-myc) was made by replacing the BglII-PacI fragment of pAJ538 with the BglII-PacI fragment from the PCR product of amplifying NMD3 with 5' oligonucleotide AJO245 (CGGAATTCGCTAAGGACGGGTTGGAT) and 3' oligonucleotide AJO348 (GCACTTAATTAACCCGGGCTGCAGCTCGTCTTCATCCATTTC). pAJ414 was made by moving NMD3-myc from pAJ408 (NMD3-myc LEU2 CEN) as a EheI-HindIII fragment into SmaI-HindIII-cut pRS416. pAJ521 (nmd3
123) was made by replacing the EcoRI-HindIII fragment of pAJ271 (NMD3 URA3 CEN) with the EcoRI-HindIII fragment from the PCR product obtained by amplifying NMD3 with oligonucleotides AJO243 (CGGAATTCACAAATACTATTATTCAG) and AJO109 (GCGCAAGCTTGAGTATATACTACTCTCC). pAJ522 and pAJ523 were made similarly but using oligonucleotides AJO244 (CGGAATTCAAGAGAACATTTTTGTTTTTGG) and AJO245 (CGGAATTCGCTAAGGACGGGTTGGAT), respectively. The BglII fragment from pAJ401 (24) was ligated into pAJ521, pAJ522, and pAJ523 (nmd3N
123) to make pAJ515 (nmd3N
123-myc), pAJ516 (nmd3N
167-myc), and pAJ517 (nmd3N
192-myc), respectively. pAJ1358 (NMD3
NLS399418), pAJ1359 (NMD3
LS384418), pAJ1360 (NMD3
NLS384398), and pAJ1416 (NMD3
cc446468) were all derived from appropriate fusions based on pAJ538. pAJ1423 and pAJ1424 were made by combining mutations from pAJ1416 with pAJ751 and pAJ752, respectively. To make pAJ1593, the PCR product from oligonucleotides AJO247 (CGGAATTCACTGTCCAGTTTATGGATC) and AJO885 (GTTCTCGACTCCATCTTCTGCTGTCATTTCATC) was reamplified with AJO247 and AJO887 (GACTTAATTAACCCGGGGATCCGCTGCTGAGATTCAACGGGTGTGTTCTCGACTCCATC). The resulting product was cut with BglII and PacI and cloned into the same sites of pAJ534.
|
Loss of Function MutantsThe NMD3 open reading frame was mutagenized by PCR using TaqDNA polymerase and primers AJO106 (GCCGCTCGAGACACCATGGAATTCACACCTATA) and AJO305 (TCCCCCGGGCTGCTGAGATTCAACGGG) as described previously (14) and cotransformed with BsgI-digested pAJ538 into the nmd3
ade2 ade3 strain AJY1414 containing pAJ363 (NMD3, URA3, ADE3). The presence of this plasmid results in red colonies, whereas cells that have lost the plasmid give rise to white or sectored colonies. Transformants that gave rise to solid red colonies, indicating an inability to lose the wild-type NMD3 plasmid, were picked for further analysis. Extracts were prepared from cultures of these mutants and screened by Western blotting for the expression of the C-terminal c-Myc tag. Isolates that did not express the c-Myc tag were assumed to contain truncation mutants and discarded.
Indirect ImmunofluorescenceIndirect immunofluorescence was performed as described previously (1). Antibodies used were monoclonal
-c-Myc (9E10) for the primary antibody (1:1000 dilution; Covance), and the secondary antibody was Cy2-conjugated
-mouse antibody (1:300 dilution; Jackson IRL). DNA was stained with DAPI. Fluorescence was visualized on a Nikon E800 microscope fitted with a x100 objective and a Diagnostic Instruments SPOT II camera controlled with SPOT software. Images were prepared using Adobe Photoshop 5.0.
GFP LocalizationCulture conditions are given in the corresponding figure legends. Cultured cells were fixed with a 1:9 volume of 37% formaldehyde for 40 min. The cells were washed twice with 0.1 M potassium phosphate, pH 6.6, and resuspended in 0.1 M potassium phosphate, pH 6.6, 1.2 M sorbitol. 0.05% Triton X-100 was added to permeabilize cells. After 4 min, 1 µg/ml DAPI was added to stain nuclei. After an additional 2 min, cells were washed twice with PBS and visualized as described for indirect immunofluorescence.
ImmunoprecipitationsFor immunoprecipitations of Myctagged Nmd3 proteins, cultures were grown as indicated in the respective figure legends. All subsequent steps were carried out at 04 °C. Cells were thawed and washed in immunoprecipitation buffer (10 mM Tris, pH 7.6, 150 mM NaCl, 10% glycerol, 0.1% Nonidet P-40, 1 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, and 1 µg/ml each of leupeptin and pepstatin A). The cells were resuspended in one volume of immunoprecipitation buffer, and extracts were made by glass bead lysis (5 x 50 s with 1-min intervals on ice). Insoluble material was pelleted by centrifugation at 15,000 x g for 10 min at 4 °C. 1.5 µl of
-c-Myc (9E10 monoclonal; Covance) antibody was added to equal A260 units of sample supernatants and rocked for 1 h at 4 °C. 30 µl of bovine serum albumin-blocked protein A-agarose beads (Invitrogen) were then added, and rocking was continued for an additional 1 h. Beads were washed three times with immunoprecipitation buffer and eluted in 50 µlof1x Laemmli sample buffer without
-mercaptoethanol. Proteins were run on a 10% SDS-polyacrylamide gel and transferred to nitrocellulose for Western blotting using
-c-Myc or
-Rpl8p antibodies.
Leptomycin B (LMB) TreatmentFor LMB treatment, overnight cultures were diluted to an A600 of
0.1 and incubated for 6 h at 30 °C. They were then concentrated 10-fold in fresh medium. LMB (from M. Yoshida or LC Laboratories) was added at a final concentration of 0.1 µg/ml, and cultures were incubated an additional 20 min before fixation, antibody staining, and visualization as described for indirect immunofluorescence.
| RESULTS |
|---|
|
|
|---|
123, N
167, N
192) were unable to complement an nmd3 deletion (data not shown). The C-terminal truncations (nmd3
50, nmd3
100, and nmd3
120) have been described previously (1). Selected truncated proteins were tested for their ability to bind to 60 S subunits using a co-immunoprecipitation assay. Samples were analyzed by SDS-PAGE, followed by Western blotting for Nmd3p and for Rpl8p as a reporter for 60 S subunits. Removal of up to 120 amino acids from the C terminus of the protein did not affect binding to 60 S subunits (Fig. 1B). However, removal of an additional 74 amino acids (NMD3C
194) completely disrupted 60 S interaction in this assay. Deletion of 123 amino acids from the N terminus of Nmd3p, including the first three Cys-X2-Cys motifs, led to reduced binding to 60 S subunits, whereas deletion of 167 or more amino acids, including all four Cys-X2-Cys motifs, completely abolished 60 S binding as indicated by the lack of coimmunoprecipitation of Rpl8p (Fig. 1B). From these results, we conclude that the N terminus of Nmd3p (aa 1398), which contains two putative zinc-coordinating domains and is conserved in archaeal Nmd3p orthologs, is required for 60 S binding.
|
|
Although the coiled-coil region does not support efficient export, it does significantly enhance the function of the canonical NES. Because coiled-coils are typically protein-protein interaction motifs, this region of Nmd3 may enhance the function of the canonical NES by recruiting an additional factor that stabilizes the interaction of Nmd3p with Crm1p. Residual interaction with this factor in the absence of the canonical NES may account for the weak export activity of this region.
Nuclear LocalizationWe previously showed that deletion of the C-terminal 120 amino acids of Nmd3p was lethal and resulted in a cytoplasmic localization of the protein, due to removal of sequences that are necessary for nuclear localization (1). Amino acids 399418 are highly basic (50% Arg and Lys), typical of an NLS. To test if this region was entirely responsible for NLS activity, an internal deletion encompassing these residues was made. This mutant protein localized to the cytoplasm but accumulated in the nucleus upon treatment with LMB (Fig. 4). LMB blocks Crm1 interaction with its ligands (15, 16), thereby trapping molecules dependent on Crm1 export in the nucleus. Furthermore, this mutant was viable, albeit slowly growing (Fig. 2D). These results indicate that nuclear import was impaired but not abolished in this mutant. Interestingly, when fused to GFP as a reporter, amino acids 399418 were not sufficient to localize GFP to the nucleus (data not shown), but a larger region (aa 387434) was sufficient (1). This larger region included a highly conserved patch of hydrophobic residues immediately upstream of the basic region implicated in NLS activity. Nmd3p deleted of the hydrophobic patch (aa 384398) or both the hydrophobic patch and the basic region (aa 383418), was non-complementing (Fig. 2D) but retained 60 S binding (data not shown). However, only removal of the entire region (aa 384418) resulted in a complete inability of Nmd3p to localize to the nucleus, even in the presence of LMB (Fig. 4). Thus, the hydrophobic patch (aa 384398) and the basic region (aa 399418) are necessary and sufficient for nuclear localization activity.
|
|
|
Cysteine MutantsThe screen for loss of function mutants identified five mutations that affected three of the universally conserved cysteine residues (Cys35, Cys58, and Cys146). Because of the high frequency of cysteine mutants, we decided to mutate each of the eight cysteines in these putative zinc binding motifs to serine, an amino acid of similar size but unable to coordinate Zn2+. In general, mutations in the first two pairs of cysteines (Cys19 and Cys21, Cys35 and Cys38) were well tolerated, whereas and mutations in the second two pairs (Cys58 and Cys61, Cys143 and Cys146) were generally not tolerated (Fig. 6A). Because of the similar behavior of mutations in the first four cysteines, we suggest that they act together to coordinate one Zn2+ ion and that the second two pairs of cysteines coordinate a second Zn2+ ion. The viability of the C146S mutant may indicate that this residue is not absolutely essential for zinc binding. Changing Cys146 to arginine, a bulkier residue that could sterically block Zn2+ binding or cause charge repulsion, resulted in a more severe growth defect (data not shown). As with the random loss of function mutants, the cysteine mutants showed a close correlation between 60 S binding and ability to complement an nmd3 deletion (Fig. 6).
Cellular Localization of MutantsWe examined the cellular localization of the loss of function mutants in cells in the presence and absence of LMB, and results are summarized in Table 2. Wild-type and most mutant Nmd3 proteins were distributed throughout the nucleus and cytoplasm in the absence of LMB (data not shown). Upon more careful examination at different stages of cell growth, we noticed that several mutants, V340D, the double mutant L263P,F318I and the triple mutant I139T,L259S,L296P showed apparent nuclear envelope localization, most notably during log phase growth (data not shown). A more comprehensive analysis of these mutants will be described elsewhere5. Upon treatment with LMB, all mutant Nmd3 proteins accumulated in the nucleus (data not shown), indicating that all were capable of shuttling.
Mutations in NMD3 That Suppress rpl10 MutantsThree spontaneous nmd3 mutants (I279F, L291F, and A336P) were previously identified as suppressors of the temperature-sensitive rpl10[G161D] allele of the large ribosomal subunit protein Rpl10p (17). To understand the genetic interaction of Nmd3p with Rpl10p more completely, we screened for additional NMD3 suppressors. NMD3 was randomly mutagenized by PCR and cotransformed into rpl10[G161D] (5, 18) or rpl10[F85S] (19) mutant strains with an NMD3 vector deleted of most of the NMD3 open reading frame to allow for in vivo recombination. Suppressors were selected for their ability to enhance growth at 35 °C.
|
|
-strand and could represent an RNA binding surface. The second region (approximately aa 290380) spans the region in which suppressor mutations were identified previously (Fig. 7A) (17). The strongest suppressor, I112T,I362T, contained two mutations, one in each domain. Subcloning each mutation revealed that both contribute to suppression of rpl10[G161D] (Fig. 7C).
|
Several of the mutations identified in the screen for loss of function mapped to the same domains as the suppressor mutations. Because several of these showed only partial loss of function, we tested them for their ability to suppress rpl10[G161D] and LSG1[K349T]. Interestingly, two of these mutants (L82P and H108R) suppressed both rpl10 and lsg1 mutants. NMD3[L82P] showed relatively weak suppression of rpl10 and lsg1, whereas H108R suppressed the rpl10 and lsg1 mutants to a greater extent (Fig. 7B). The mapping of suppressor mutations to the same regions in which we found loss of function mutants suggests that suppression is due to a partial loss of function in Nmd3p. Mutations in both suppressor domains were found to affect 60 S binding, and nmd3[I112T,I362T] has a reduced affinity for 60 S subunits in vivo and in vitro (5). We suggest that these two domains represent two 60 S binding domains within Nmd3p (Fig. 8).
| DISCUSSION |
|---|
|
|
|---|
|
|
It has been reported that Kap123 is the primary importer for Nmd3 (8), since the fusion of this NLS to GFP makes the nuclear accumulation of GFP Kap123-dependent. However, unlike Nmd3, Kap123 is not essential, and in our hands, the nuclear import of full-length Nmd3 is not obviously affected by deletion of KAP123,6 suggesting that an additional import pathway(s) can efficiently replace Kap123.
Nuclear export of Nmd3 depends on its canonical leucinerich NES. This NES can confer nuclear export activity on exogenous proteins (1, 2). Here, we show that some mutations are well tolerated in the NES when it is in the context of full-length Nmd3 but not when fused to an exogenous reporter. This suggests that other regions of Nmd3 enhance its NES function. One such region appears to be the coiled-coil, since deletion of this region sensitizes the NES point mutants. Nmd3 export is mediated by Crm1, which recognizes the leucine-rich NES.
From our mutational analysis of Nmd3, we conclude that its interaction with the 60 S subunit is divalent, although additional, weaker contacts may also exist. Such a multivalent interaction could provide a means of ensuring that only properly assembled subunits are exported. In the milieu of ribosome assembly, any single interaction between Nmd3 and constituents of the 60 S subunit may not be strong enough for stable interaction with Nmd3. By requiring the correct spatial organization of more than one binding surface, stable interaction with Nmd3 could then be strictly dependent on the completion of multiple assembly events on the ribosome, thereby utilizing structural proofreading of the subunit for quality control of exported subunits (21). Along this line of thought, it is also possible that the final steps of assembling the Nmd3 binding site are facilitated by Nmd3 by induced fit. Although there is presently no evidence for this, nascent pre-60 S subunits are highly unstable in the absence of Nmd3 (22), possibly because of failure of correct assembly.
Last, one can imagine that the release of Nmd3 from the subunit in the cytoplasm may be driven by a conformational change in the subunit that alters the spatial organization of its multivalent binding site. We have shown recently that the release of Nmd3 is dependent on loading the ribosomal protein Rpl10 and the activity of the GTPase Lsg1 (5, 6). We proposed that the proper accommodation of Rpl10 into the subunit in the cytoplasm depends on Lsg1, whose GTPase activity may induce a conformational change in the subunit as Rpl10 loads. Rpl10 binds in a deep cleft between the central protruberance and the GTPase stalk, and its presence in the subunit appears to organize this region. Bacterial ribosomes lacking L16, the bacterial counterpart to Rpl10, are in a conformation distinct from intact ribosomes (23). The change in conformation upon Rpl10 loading or the presence of Rpl10 itself could alter the organization of the Nmd3 binding site, disrupting one of its interaction surfaces to initiate release of Nmd3. The release of Nmd3 then may not be the target of Lsg1 function but rather the consequence of conformational changes that are the consequence of Rpl10 loading.
| FOOTNOTES |
|---|
1 Present address: Asuragen, 2150 Woodward St., Suite 100, Austin, TX 78744. ![]()
2 Present address: Dept. of Cell Biology, University of Oklahoma Health Science Center, Oklahoma City, OK 73104. ![]()
3 To whom correspondence should be addressed: Section of Molecular Genetics and Microbiology, 1 University Station, A5000, University of Texas, Austin, TX 78712-1095. Tel.: 512-475-6350; Fax: 512-471-7088; E-mail: arlen{at}mail.utexas.edu.
4 The abbreviations used are: NES, nuclear export signal; NLS, nuclear localization signal; aa, amino acids; DAPI, 4',6-diamidino-2-phenylindole; GFP, green fluorescent protein. ![]()
5 M. West, J. Hedges, K-Y. Lo, and A. W. Johnson, unpublished results. ![]()
6 K-Y. Lo, M. West, and A. W. Johnson, unpublished observations. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
N.-J. Hung, K.-Y. Lo, S. S. Patel, K. Helmke, and A. W. Johnson Arx1 Is a Nuclear Export Receptor for the 60S Ribosomal Subunit in Yeast Mol. Biol. Cell, February 1, 2008; 19(2): 735 - 744. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hofer, C. Bussiere, and A. W. Johnson Mutational Analysis of the Ribosomal Protein Rpl10 from Yeast J. Biol. Chem., November 9, 2007; 282(45): 32630 - 32639. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. West, J. B. Hedges, K.-Y. Lo, and A. W. Johnson Novel Interaction of the 60S Ribosomal Subunit Export Adapter Nmd3 at the Nuclear Pore Complex J. Biol. Chem., May 11, 2007; 282(19): 14028 - 14037. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE |