|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 281, Issue 48, 37069-37080, December 1, 2006
Identification of Tctex2
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
(TGF-
) receptor family and has been identified as the gene involved in hereditary hemorrhagic telangiectasia. Although endoglin is known to affect cell responses to TGF-
, its mode of action is largely unknown. We performed yeast two-hybrid screening of a human placental cDNA library and isolated a new endoglin-binding partner, a novel 221-amino acid member of the Tctex1/2 family of cytoplasmic dynein light chains named Tctex2
, as the founder of a new Tctex1/2 subfamily. The interaction was localized exclusively to the cytoplasmic domain of endoglin. Reverse transcription-PCR showed expression of Tctex2
in a wide range of tissues, including vascular endothelial and smooth muscle cells, placenta, and testis, as well as in several tumor cell lines. High expression levels were found in human umbilical vein endothelial cells and the large cell lung cancer cell line. Forced expression of Tctex2
had a profound inhibitory effect on TGF-
signaling. Additional Tctex2
-interacting receptors were identified to be the TGF-
type II receptor and most likely beta-glycan, but not ALK5, ALK1, or the bone morphogenetic protein type II receptor. Upon fluorescence tagging, co-localization of Tctex2
and endoglin, as well as Tctex2
, endoglin, and the TGF-
type II receptor, was observed by different microscopy techniques. Our findings link endoglin for the first time to microtubule-based minus end-directed transport machinery, suggesting that some endoglin functions might be regulated and directed by its interaction with the cytoplasmic dynein light chain Tctex2
. | INTRODUCTION |
|---|
|
|
|---|
180 kDa that is synthesized to high levels in proliferating endothelial cells in both culture and angiogenic vasculature (1-4). Cell type-specific expression has further been observed in macrophages (5), T-cells (6), bone marrow cells (7), stromal cells (8), vascular smooth muscle cells (9), and different types of cancer cells (10). Endoglin is classified as a transforming growth factor-
(TGF-
)5 type III receptor that needs the TGF-
type II receptor (T
RII) to bind to TGF-
1 and TGF-
3 (11), in contrast to betaglycan, the second TGF-
type III receptor (12). Endoglin has been identified as the gene mutated in hereditary hemorrhagic telangiectasia type 1, an autosomal dominant inherited vascular disorder characterized by multi-systemic vascular dysplasia and recurrent hemorrhage (13). Mice embryos homozygously deleted of endoglin are unable to progress beyond embryonic days 10.5-11.5, with failure to form mature blood vessels in the yolk sac, poor vascular smooth muscle development, and arrested endothelial remodeling (14-16).
TGF-
is involved in vascular development and homeostasis with both pro- and anti-angiogenic effects (17, 18). Upon ligand binding, T
RII recruits, phosphorylates, and activates the ALK5 (activin receptor-like kinase-5) type I receptor. Activated ALK5 phosphorylates the receptor Smads (Smad2/Smad3), which are then translocated to the nucleus, where they act as co-transcription factors on specific genes (19). In endothelial cells, a second type I receptor exists, ALK1. ALK5 and ALK1 mediate, in a concentration-dependent manner, TGF-
signaling with opposing effects (20, 21). Mutations in ALK1 also lead to the vascular disorder hereditary hemorrhagic telangiectasia type 2 (13). ALK1 signaling is propagated through Smad1/Smad5, promoting vascular endothelial cell proliferation and migration ("activation phase"), whereas ALK5 signaling suppresses endothelial cell proliferation and induces smooth muscle differentiation ("resolution phase") (18). Thus, angiogenesis seems to be regulated in part by an ALK1/ALK5 signaling balance.
Recent findings suggest that endoglin is involved in the fine-tuning of this balance between TGF-
/ALK1 and TGF-
/ALK5 signaling. Endoglin interacts with T
RII, ALK5, and ALK1 both in vitro and in vivo (11, 22, 23). Ectopic expression of endoglin in several cell types inhibits the TGF-
/ALK5 signaling pathway and counteracts TGF-
-induced growth inhibition, but promotes TGF-
/ALK1 signaling (24-27). Of note is the discrepancy that, although the extracellular domain of endoglin is involved in and required for both pathways, the relatively short cytoplasmic domain of 47 amino acids is required only for TGF-
/ALK5 (but not TGF-
/ALK1) signaling (24). Thus, this domain appears to have a key role in regulating the signaling balance in endothelial cells.
The cytoplasmic domain of endoglin is highly conserved in human, rat, and mouse with 99% identity, and there is 71% homology between the corresponding domains in human endoglin and betaglycan. Recent findings have identified the LIM domain proteins ZRP-1 (zyxin-related protein-1) and zyxin as intracellular partners for the cytoplasmic domain of endoglin (28, 29). Interaction of ZRP-1 or zyxin with endoglin influences the intracellular distributions of proteins involved in the organization of the actin cytoskeleton or the assembly of focal adhesions, respectively. However, the mechanisms by which endoglin achieves these functions remain unknown.
To gain more understanding of the role of endoglin in TGF-
signaling and angiogenesis, we performed yeast two-hybrid screening to identify cellular binding partners for this protein. We report here the interaction between a novel Tctex1/2 (t-complex testis-expressed protein-1/2)-like protein, designated Tctex2
, and the cytoplasmic domain of endoglin as well as T
RII. To the best of our knowledge, this is the first evidence that endoglin can interact with a member of the dynein light chain (DLC) protein family.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Antibodies and CytokineHis-tagged proteins were detected in immunoblots or precipitated with anti-His monoclonal antibody (Serotec, GmbH, Germany). Hemagglutinin (HA)-tagged proteins were detected in immunoblots with anti-HA monoclonal antibody 12CA5 (22). Endoglin was immunodetected or precipitated with anti-endoglin polyclonal antibody (22). TGF-
1 and TGF-
3 were purchased from R&D Systems (Wiesbaden, Germany).
Expression ConstructsFor the yeast two-hybrid screening and the following growth assay, the coding sequences of the cytoplasmic domain of human endoglin (amino acids 612-658, Endocyto), a truncated form of endoglin lacking the cytoplasmic domain (amino acids 1-611, Endo
cyto), and full-length wild-type (wt) endoglin (amino acids 1-658, Endowt) were PCR-amplified from pCMV5-endoglin (30) and cloned in-frame into pGBT9 (Clontech), resulting in the pGBT9-Endocyto, pGBT9-Endo
cyto, and pGBT9-Endowt constructs, respectively. The cytoplasmic domains of different TGF-
type II (pGBT9-T
RIIcyto, amino acids 186-567; pGBT9-ActRIIAcyto, amino acids 162-513; and pGBT9-BMPRIIcyto, amino acids 530-1038) and type I (pGBT9-ALK5cyto, amino acids 148-503; pGBT9-ALK1cyto, amino acids 142-503; and pGBT9-caALK1cyto (where "ca" is constitutively active), amino acids 142-503 with mutation Q201D, respectively) receptors were as described previously (31). The cytoplasmic domain of betaglycan was PCR-amplified from pGEX4T3-betaglycan (kindly provided by Dr. Calvin Vary) (28) and cloned into pGBT9, yielding pGBT9-betaglycancyto (amino acids 805-849). The complete coding sequence of Tctex2
was PCR-amplified and cloned into pACT2 (Clontech), generating pACT2-Tctex2
.
For the mammalian two-hybrid assay (Clontech), the coding sequence of the endoglin cytoplasmic domain was cloned into vector pM, resulting in pM-Endo. The whole coding sequence of Tctex2
was cloned into pVP16, yielding pVP16-Tctex2
. For expression in mammalian cells and immunoprecipitation assays, the full coding sequence of Tctex2
was fused to the N-terminal His6 tag of the pcDNA4/HisMax vector (Invitrogen), resulting in HisTctex2
. Human endoglin and HA-tagged T
RII (T
RIIHA) are in the pCMV5 vector (22, 30). For fluorescence microscopy studies, human endoglin was fused to the N-terminal HcRed sequence of the pHcRed-N1/1 vector (a kind gift from Dr. Peter March, Faculty of Life Sciences, University of Manchester) or pECFP (Clontech), resulting in EndoHcRed or EndoECFP, respectively. The full-length coding sequence of Tctex2
was fused to the C-terminal enhanced green fluorescent protein (EGFP) sequence of the pEGFP-C1 vector (Clontech), resulting in EGFPTctex2
. The correct sequences and reading frames of all constructs derived from PCR products were verified by DNA sequencing.
Yeast Two-hybrid Screening and Growth AssayA yeast strain (PJ69-4A) based on the Gal4 system was used (32). Yeast media were purchased from Clontech. Yeast transformations were performed using a standard lithium acetate method as recommended in the Matchmaker yeast protocol handbook (Clontech). For library screening, a sequential transformation was performed with first the bait plasmid (pGBT9-Endocyto) and then with 50 µg of human placental library cDNA (cloned into the pACT2 vector). The co-transformants were streaked onto appropriate selective media plates. To determine the strength of interactions, high stringency synthetic medium lacking histidine and adenine but containing X-gal was also used. Interacting clones were selected by their abilities to grow or turn blue on appropriate selective plates. Plasmid DNA from positive yeast clones was rescued into bacterial strain KC8 (Clontech) and sequenced using a poly(T) sequencing primer. The resultant sequences were checked for similarity to known transcripts in the nucleotide sequence data bases using the BLAST algorithm. For yeast two-hybrid growth assays, yeast cells were sequentially transformed first with endoglin, beta-glycan, or different type I/II receptor constructs and then with pACT2-Tctex2
. Phenotypes of yeast co-transformants on selective media were tested.
Mammalian Two-hybrid AssayHEK293 cells were seeded 1 night before transfection at an initial density of 1.5 x 105 cells/well in 6-well plates in Dulbecco's modified Eagle's medium plus 10% fetal bovine serum. Prior to transfection, cells were switched to medium containing 5% fetal bovine serum to reduce the endogenous level of alkaline phosphatase in the serum. Upon reaching 50-60% confluence, cells were transfected with the pG5SEAP reporter construct (0.3 µg) and a specific combination of pM-Endo (1.5 µg)/pVP16-Tctex2
(1.5 µg) or pM (1.5 µg)/pVP16 (1.5 µg) as a negative control using the CalPhosTM mammalian transfection kit (Clontech). 48 h after transfection, the cell culture medium was collected and subjected to secreted alkaline phosphatase activity assay using the Great EscAPe kit (Clontech). Relative light units were measured using a Berthold Lumat LB 9507 luminometer and expressed as the means ± S.E. Values from mock-transfected samples served as the basal level of alkaline phosphatase activity in the culture medium. Transfection experiments were carried out in triplicate and repeated three times.
Immunoprecipitation and Western BlottingHEK293 cells were transfected with appropriate combinations of pCMV5, HisTctex2
, endoglin, and T
RIIHA as indicated. 48 h later, cells were lysed with lysis buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.5% Nonidet P-40, 50 mM NaF, 1 mM phenylmethylsulfonyl fluoride, and Sigma protease inhibitor mixture) at 4 °C for 30 min. The cell lysates were precleared with 20 µl of protein G-Sepharose (Sigma) for 1 h before they were immunoprecipitated overnight at 4 °C with 50 µl of protein G-Sepharose and the indicated antibodies. The immunocomplexes were then washed three times with 500 µl of lysis buffer and resolved in 20 µl of Laemmli buffer. The resulting immunoprecipitated sample and 20 µl of each total cell lysate were separated on SDS-8% (for endoglin and T
RIIHA) and 12% (for HisTctex2
) polyacrylamide gels and blotted onto nitrocellulose membranes (Bio-Rad) for immunoblotting with the indicated antibodies. Immunodetection were performed with the ECL Western blotting detection kit (Amersham Biosciences) or with the Odyssey infrared imaging system (LI-COR Biosciences).
5'-Rapid Amplification of cDNA Ends (RACE) and Reverse Transcription (RT)-PCRFor cloning of Tctex2
cDNA, 5'-RACE was performed with the SMARTTM RACE kit (Clontech) using human placental and testis total RNAs (Clontech). RACE-PCR products were cloned into the pCR2.1-TA cloning vector (Invitrogen) and then sequenced using forward and reverse M13 sequencing primers. The Tctex2
gene-specific primer used for 5'-RACE was 5'-TTGTAGCGTGGCGGGCTGAGCTCG-3'.
For RT-PCR, total RNAs from primary human umbilical vein endothelial cells (HUVECs) and HMEC-1, HepG2, large cell lung cancer (LCLC), and T47D cells were isolated as described previously (31). Total RNA from smooth muscle cells was generously supplied by Dr. Judith Gillard (Department of Biophysics, University of Manchester). To exclude the possibility of genomic DNA contamination, total RNA was digested with RNase-free DNase I (Roche Applied Science, Mannheim, Germany) according to the manufacturer's instructions. Subsequently, 1 µg of each total RNA was reverse-transcribed in a 50-µl volume with a mixture of oligo(dT) oligonucleotides and (dN)6 random hexamers following the Fermentas RevertAid H Minus Moloney murine leukemia virus protocol. In parallel, negative control samples lacked Moloney murine leukemia virus. 2 µl of the resulting first-strand cDNA was PCR-amplified with appropriate primer pairs using a ReadyMixTM PCR kit (Sigma). Samples were first held at 96 °C for 5 min and then cycled 30 times at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min, followed by an additional 7 min at 72 °C. PCR products were visualized by electrophoresis on 1.5% agarose gel containing ethidium bromide. Primer pairs were based on human sequences (given here from 5' to 3'): Tctex2
, ATGGCCAGCAGGCCTCTGCC (forward) and TCACTCGCAGTAGAGCCCGT (reverse); and glyceraldehyde-3-phosphate dehydrogenase, TCAACGGATTTGGTCGTAT (forward) and ATGAGTCCTTCCACGATAC (reverse).
Fluorescence Microscopy and ImmunofluorescenceFor fluorescence microscopy, HeLa cells were seeded on coverslips and transfected as indicated. 1 day after transfection, cells were fixed with 4% paraformaldehyde on ice, mounted on Mowiol (Dabco), and used for digital imaging.
Two-photon microscope images were obtained with the TriMScope 2-photon system for multiphoton microscopy (LaVision BioTec, Bielefeld, Germany) with a Zeiss Axiovert 200 fluorescence microscope equipped with a 63x oil objective. This system was upgraded for two-photon live-time imaging with a Chamelon XR laser (Coherent Inc.). Two-photon excitation was at 800 nm, and emission for GFP was at 530 nm and for CFP at 480 nm. Images were analyzed using ImSpector Version 3.0 software. Images obtained with the Zeiss ApoTome system were acquired with an inverted wide-field microscope (Zeiss Axiovert 200 M and Axiovision Version 05.2005 software) equipped with a 75-watt xenon lamp (Hamamatsu Photonics), a 12-bit CCD camera (Zeiss AxioCam HRm), a 63x oil objective (Plan Neofluar, 1.25 numerical aperture), and appropriate filter sets for the different fluorophores (CFP, excitation at 436/20 nm, beam splitter at 455 nm, and emission at 480/40 nm; yellow fluorescent protein, excitation at 500/20 nm, beam splitter at 515 nm, and emission at 535/30 nm; and DsRed, excitation at 565/30 nm, beam splitter 585 nm, and emission at 620/60 nm).
Immunofluorescence was done as described (31). In brief, HeLa cells transfected with endoglin were seeded on coverslips, fixed, permeabilized, and incubated with a 1:100 dilution of the endoglin-specific monoclonal antibody SN6 (Serotec). Subsequently, cells were incubated with a TRITC-labeled anti-mouse secondary antibody (Molecular Probes). After several washing steps, cells were mounted on Mowiol and used for fluorescence microscopy.
For confocal microscopy, 1 night before transfection, NIH3T3 or HEK293 cells were seeded on polylysine-coated coverslips in 6-well plates at a density of 0.8 x 105 cells/well. Cells were transiently transfected with combinations of different constructs (EGFPTctex2
, EndoHcRed, or vectors alone as controls). After an additional 48 h, cells were fixed with 4% paraformaldehyde on ice. Coverslips were mounted on Mowiol and subjected to fluorescence analysis using a Zeiss confocal microscope. Cells were imaged using LSM 510 software, and the Multi-track function was chosen to collect potentially overlapping emissions separately. Green and red fluorophores were excited using the argon (488 nm) and helium/neon (543 nm) visible lasers, respectively.
Luciferase Reporter AssayThe luciferase assay was performed as described previously (31). In brief, Mv1Lu or HepG2 cells were transiently transfected with (CAGA)12-luciferase (an ALK5 signaling-responsive reporter construct) (33) together with HisTctex2
or endoglin constructs as indicated. The pEYFP-N1 vector (Clontech) was always included to serve as an internal control for transfection efficiency. Luciferase activity was assayed 16 h after incubation with 4 ng/ml TGF-
3or TGF-
1. All experiments were performed in triplicate and repeated at least three times.
Proteasome Inhibitor AssayThe proteasome inhibitors MG132, lactacystin, and proteasome inhibitor I (proteasome inhibitor set I, catalog no. 539164, Calbiochem) were used. Inhibitors were suspended in Me2SO at 5 mM. HEK293 or COS-1 cells were seeded in 6-well plates. Cells were mock-transfected; transfected with HisTctex2
, endoglin, or T
RIIHA alone; or cotransfected with HisTctex2
and endoglin or with HisTctex2
and T
RIIHA using the cationic transfection reagent jetPEITM (Polyplus Transfection) according to the manufacturer's instructions. The next day, cells were either left untreated or were incubated overnight for 16 h with a combination of 1 µl/ml each inhibitor or equal amounts of Me2SO. After incubation, cells were lysed in 400 µl, and the protein concentration of each lysate was determined using the BCATM protein assay (Pierce) according to the manufacturer's instructions. Subsequently, equal amounts of protein (30 µg) were separated by SDS-PAGE and blotted onto a nitrocellulose membrane (Macherey-Nagel). After incubation of the membrane with specific primary and secondary antibodies as indicated, expressed proteins were visualized with the Odyssey infrared imaging system.
Cell Migration in the Wound AssayHeLa cells were seeded in 6-well plates and either singly transfected with 3 µg of mock DNA or 1.5 µg of HisTctex2
, endoglin, or T
RII supplemented with 1.5 µg of mock DNA or doubly transfected with 1.5 µg of HisTctex2
and 1.5 µg of endoglin or T
RII using jetPEITM. The next day, cells were wounded with a 20-200-µl tip. Cells were washed once with phosphate-buffered saline, and fresh growth medium was added. Subsequently, the wounded cell layers were photographed at four different positions. After 48 h, the same positions were photographed again to document cell migration.
Cell Proliferation AssayTo assess cell proliferation under fixed cell culture conditions, the increase in cell numbers was measured after different time points by staining the cell nuclei with crystal violet as described previously (34). In brief, 5 x 105 primary human dermal microvascular endothelial cells were transfected with 3 µg of mock DNA or HisTctex2
by nucleo-fection with a Nucleofector® (Amaxa Biosystems, Cologne, Germany) according to the manufacturer's instructions using the S-005 nucleofection program. After nucleofection, cells were plated in 6-well plates to recover for 1 day. Subsequently, cells were trypsinized and seeded in a 96-well plate at a density of 2000 cells/well. After 4 h of adhesion, cells were incubated for 24 and 48 h with 0.5 ng/ml TGF-
1 or 4 ng/ml TGF-
1 or were left untreated. After the different time points, cells were fixed with 5.5% glutaraldehyde and subsequently washed three times with double-distilled H2O and then air-dried for 1 h. A 0.1% crystal violet solution (100 µl/well; pH 4.5) was added for 20 min. Cells were washed three times with double-distilled H2O and air-dried again. Finally, 10% acidic acid (100 µl/well) was added, and extinction was measured at 595 nm. An aliquot of cells assayed after 4 h of adhesion served as a reference at time 0.
| RESULTS |
|---|
|
|
|---|
, a Novel Tctex1/2 Family Protein, as an Interacting Partner for the Cytoplasmic Domain of EndoglinTo identify new intracellular binding partners for endoglin, the yeast Gal4 two-hybrid system was used (32). A human placental cDNA library was screened with the cytoplasmic domain of endoglin (Endocyto) as bait and cloned into the Gal4 DNA-binding domain vector pGBT9. A number of clones strongly and reproducibly interacting with endoglin were identified as determined by their abilities to grow in the absence of adenine and histidine and to activate the lacZ reporter. Among the identified clones was ZRP-1, confirming a previous report (29). However, the strongest interaction was identified in a clone provisionally named N22.1 with an
650-bp insert. When sequenced, it was found to correspond to a hypothetical protein (GenBankTM accession number XM_291623) with homology to mouse Tctex1. The N22.1 clone is only a partial sequence of this predicted protein, corresponding to the C-terminal 182-amino acid region (residues 40-221). A computational expression sequence tag (EST) "walk" was performed in the EST data base. The only two EST entries overlapping with N22.1 correspond to its 3'- and 5'-ends, respectively. The 3'-EST, from human lung epithelial cells (699 bp; GenBankTM accession number CA314455 [GenBank] ), covered the whole N22.1 insert sequence, whereas the 5'-EST, from human placenta (726 bp; GenBankTM accession number CF994778 [GenBank] ) extended an additional 626 bp upstream of the insert sequence. To determine and isolate the full-length N22.1 cDNA, 5'-RACE with human placental and testis RNAs was performed. The cloned and sequenced RACE products confirmed the 5'-EST sequence from our computational analysis. Taken together, the putative complete N22.1 cDNA was determined to be 1276 bp long, consisting of a single open reading frame of 666 bp, a 5'-untranslated region of 509 bp, and a 3'-untranslated region of 101 bp containing a consensus polyadenylation signal (aataaa) located 15 bases upstream of the poly(A) tail.
Because of the homology to the Tctex1/2 protein family and additional analyses (see below), N22.1 was renamed and is henceforth referred to as Tctex2
. The complete nucleotide sequence and its deduced amino acid sequence are shown in Fig. 1A and have been deposited in the GenBankTM Data Bank with accession number DQ132441
[GenBank]
. An additional BLASTn search with the whole cDNA mapped this gene to human chromosome 1p34.1, with two exons and one intron of 108 bp. The existence of the intron was confirmed by RT-PCR with primer pairs located in exons 1 and 2 flanking the intron (data not shown).
Bioinformatic Analysis of the Tctex2
ProteinA series of software-based analyses were performed to provide clues about the structural features of the Tctex2
protein. The Compute pI/Mw program showed that Tctex2
has a theoretical pI of 9.87 and an expected molecular mass of 23 kDa. In amino acid composition, it is
10% serine and has a proline-rich N terminus (20% prolines of the N-terminal 114 amino acids). Motif searching by PROSITE (35) showed four consensus protein kinase C phosphorylation sites and two casein kinase II phosphorylation sites. Secondary structure prediction by PSIPRED (36) showed the layout of the helixstrand structure, in which the N-terminal section formed several
-helices, whereas in the C terminus, four
-strands were predicted. This predicted structure agrees very well with the known secondary structure of the Tctex1 protein (37, 38).
By BLASTp and EST data base searches, Tctex2
homologs have been identified in several different mammalian species, including mouse (70% identity; GenBankTM accession number BC092499
[GenBank]
), pig (80% identity; GenBankTM accession number AJ973122
[GenBank]
), rat (74% identity; GenBankTM accession number AJ973123
[GenBank]
), and chimpanzee (98% identity; GenBankTM accession number XM_513130
[GenBank]
). An alignment of amino acid sequences using ClustalW (39) revealed the homology between Tctex2
and members of the Tctex1/2 protein family, especially in the C-terminal regions (Fig. 1B). For example, Tctex2
shares 27% identity with mouse Tctex2, 18% identity with human Tctex1, and 26% identity with a human Tctex2b homolog (GenBankTM accession number BC021177
[GenBank]
). The unrooted tree generated by PhyloDraw (40) shows the phylogenesis of Tctex2
(Fig. 1C). Of the 15 proteins we aligned, human Tctex2
and its several close homologs clearly form a distinct subdivision (the Tctex2
group) different from the other three subfamilies, i.e. the Tctex1 group (including mouse, rat, human, and Chlamydomonas Tctex1 as well as human RP3), Tctex2 group (including mouse, rat, and human Tctex2) and Tctex2b group (including Chlamydomonas Tctex2b and a human testis Tctex2b homolog).
Confirming the Specific Interaction between Endoglin and Tctex2
The interaction between endoglin and full-length Tctex2
was reconfirmed in yeast by sequential transformation, first with different endoglin constructs as indicated in Table 1 or the pGBT9 empty vector and subsequently with pACT2-Tctex2
. For this purpose, full-length wild-type endoglin (Endowt) and the endoglin-coding sequence lacking the cytoplasmic part (Endo
cyto) were cloned into pGBT9. As summarized in Table 1 (first four rows), yeast cells co-transformed with either Endowt/Tctex2
or Endocyto/Tctex2
not only were able to grow on His/Ade-deficient selection medium, but also could turn blue because of activation of the lacZ reporter. However, neither the Tctex2
/pGBT9 nor Endo
cyto/Tctex2
co-transformant was able to grow on selective medium. These results strongly suggest that Tctex2
specifically interacts with the cytoplasmic domain of endoglin.
|
was also confirmed using a mammalian two-hybrid assay in HEK293 cells in which the cytoplasmic domain of endoglin was fused to the DNA-binding domain of the pM vector, whereas Tctex2
was fused to the activation domain of the pVP16 vector. A third vector, pG5SEAP, encoding the secreted alkaline phosphatase gene, served as the reporter, the induction of which is caused by interaction of pM and pVP16 fusion proteins. Cotransfection of the three constructs, pM-endoglin, pVP16-Tctex2
, and pG5SEAP, resulted in a 4.1-fold induction of secreted alkaline phosphatase activity compared with the negative control samples (p < 0.01). This indicates that the endoglin/Tctex2
interaction also happens in mammalian cells.
HEK293 cells were transiently transfected with the pCMV5 vector (mock), HisTctex2
, or Endowt alone or with HisTctex2
/Endowt together as indicated in Fig. 2. Western blotting of the total cell lysate using anti-His antibody showed a single specific band (
28 kDa), which corresponded to the 221-amino acid Tctex2
polypeptide. Endoglin showed two bands, with the lower molecular mass band corresponding to the non-fully processed form. As shown in Fig. 2A, Tctex2
was coprecipitated by anti-endoglin antibody from the lysates of HisTctex2
/Endowt cotransfectants. Furthermore, we observed that HEK293 cells expressed low amounts of endogenous endoglin. Thus, we transfected HEK293 cells with HisTctex2
alone and precipitated the endogenous endoglin protein from cell lysates. Subsequent Western blotting demonstrated that the His-tagged Tctex2
protein was coprecipitated (Fig. 2B). These experiments further confirm the specific in vivo interaction between endoglin and Tctex2
.
Expression Profiling of Tctex2
To investigate the potential physiological relevance of the novel Tctex2
protein, the expression pattern of Tctex2
was studied by RT-PCR analysis with glyceraldehyde-3-phosphate dehydrogenase as an internal control. Given that the whole coding sequence of Tctex2
is within one exon, genome-free cDNAs were prepared. This was verified by the fact that non-reverse transcriptase-treated samples gave negative PCR results (Fig. 3, lanes 2). Tctex2
gene expression could be seen in primary vascular endothelial cells (HUVECs), an endothelial cell line (HMEC-1) and smooth muscle cells, all of which are supposed to be key cell types of endoglin function. Expression was also detected in other tissues and cell types, including human placenta and testis, as well as in several tumor cell lines such as LCLC, HepG2 (hepatocellular carcinoma cells), and T47D (breast cancer cells). Different levels of expression were observed, with the highest expression in LCLC cells and HUVECs; lower expression in HepG2, HMEC-1, and smooth muscle cells; and weakest expression in T47D cells, placenta, and testis.
Tctex2
Inhibits TGF-
-induced ALK5 SignalingConsidering the role of endoglin in modulating cell responses to TGF-
, we next investigated whether Tctex2
is also involved in the TGF-
signaling pathway and what the functional implications of the interaction between endoglin and Tctex2
are. The (CAGA)12-luciferase reporter has been widely used as a specific reporter for TGF-
/ALK5 signaling specifically responding to Smad3/Smad4 activity (33). Mv1Lu cells were used to test the role of Tctex2
and endoglin in TGF-
signaling. Cells transfected with (CAGA)12-luciferase responded with a >11-fold increase in reporter activity after TGF-
3 treatment (Fig. 4A). Overexpression of endoglin decreased ligand-induced reporter activity by 33% as expected. In contrast to the previously identified DLC km23/mLC7-1, which enhances and supports TGF-
signaling responses (41), Tctex2
overexpression caused an even stronger down-regulation of signaling compared with endoglin, with 45% inhibition of ligand-induced reporter activity. However, cotransfection of endoglin and Tctex2
did not alter the level of inhibition as for Tctex2
alone, suggesting that there is no synergistic inhibitory effect for endoglin and Tctex2
. Similar results were obtained with HepG2 cells. Here again, overexpression of Tctex2
inhibited TGF-
1-induced signaling (Fig. 4B). This suggests that the inhibitory activity of Tctex2
on signaling is less likely cell type-specific, but a more general feature of Tctex2
function.
|
|
|
and Other Members of the TGF-
Receptor FamilyWe were greatly interested in the possibility that Tctex2
might interact with other members of the TGF-
receptor family. In view of this, the cytoplasmic domains of different type I receptors (ALK5, wild-type ALK1, and constitutively active ALK1), type II receptors (activin type IIA receptor (ActRIIA), T
RII, and bone morphogenetic protein type II receptor (BMPRII)), and the betaglycan type III receptor were cloned into the pGBT9 vector and tested for their ability to interact with pACT2-Tctex2
in a yeast two-hybrid system. Of the different receptors, T
RII, betaglycan, and ActRIIA could also associate with Tctex2
, as inferred by colony growth on His/Ade-deficient plates, whereas BMPRII, ALK5, ALK1, and constitutively active ALK1 failed to interact with Tctex2
(Table 1, fifth through eleventh rows). Nevertheless, it is worth noting that, as judged by the inability of T
RII/Tctex2
or ActRIIA/Tctex2
co-transformants to turn blue on high stringency plates, it seemed that these interactions were less strong than the endoglin/Tctex2
or betaglycan/Tctex2
interaction. Association between T
RII and Tctex2
was further confirmed by co-immunoprecipitation studies in HEK293 cells (Fig. 5), whereas interaction between ActRIIA and Tctex2
could not be detected by co-immunoprecipitation (data not shown).
|
|
|
and Co-localization Studies with Endoglin and T
RIIHeLa, HEK293, and NIH3T3 cells were transiently transfected with EGFPTctex2
in the presence and absence of EndoECFP or EndoHcRed and then subjected to two-photon microscopy and confocal fluorescence microscopy. Microscopy analysis revealed that Tctex2
was distributed throughout the cytoplasm and nucleus (Fig. 6, A-C). Cells cotransfected with endoglin and Tctex2
showed clear co-localization of Tctex2
and endoglin (Fig. 6A). Similar results were also found in HEK293 and NIH3T3 cells (data not shown). HeLa cells transfected with EGFPTctex2
alone clearly showed that Tctex2
localized to vesicles and microtubules and was highly abundant in the nucleus, but not in the nucleoli (Fig. 6, B and C).
Next, we analyzed in more detail the co-localization and intracellular distribution of Tctex2
, endoglin, and T
RII using HeLa cells cotransfected with all three constructs. Fluorescence microscope images were taken using the ApoTome imaging system, which produces images of confocal microscopy quality and properties. Endoglin and T
RII both localized to vesicles and the plasma membrane and clearly co-localized, although there was not a complete vesicular overlap (Fig. 7). Tctex2
was, as seen before, distributed throughout the cytoplasm as well as in the nucleus and was associated with vesicles and what we think are microtubule structures. Co-localization of Tctex2
, endoglin, and T
RII was seen at the cell membrane forming the junction (Fig. 7, white arrowheads) between two cells and in cellular protrusions and therefore maybe areas of cell adhesion. Surprisingly, there was almost no co-localization of Tctex2
, endoglin, and T
RII in vesicles. Vesicles containing endoglin and T
RII were in general larger than and distinct from those associated with Tctex2
, although these data at least suggest that Tctex2
, endoglin, and T
RII can be present in one protein complex.
|
on Cell Proliferation and MigrationTo analyze what effects Tctex2
might have on cellular functions, we investigated its influence on cell proliferation. Given that Tctex2
interacts with endoglin and that endoglin is highly expressed in endothelial cells, primary human dermal microvascular endothelial cells were used. Cells were mock-transfected or transfected with Tctex2
and treated with low (0.5 ng/ml) and high (4 ng/ml) amounts of TGF-
1 for 24 and 48 h. This experiment was repeated three times, but there was no significant difference in the proliferation rate of Tctex2
- and mock-transfected cells (data not shown).
Next, we tested the effect of Tctex2
on cell migration. For this purpose, HeLa cells were mock-transfected or transfected with Tctex2
alone or in combination with endoglin or T
RII or with all three together. Subsequently, cells were wounded, and cell migration was analyzed after 48 h. No obvious difference could be observed between Tctex2
- and non-Tctex2
-transfected cells.
Ectopic Tctex2
Expression Increases Endoglin and T
RII Protein AmountsOver the course of our analyses, we observed that the amounts of endoglin or T
RII from Tctex2
cotransfections detected by Western blotting varied compared with single transfections. Thus, we speculated that Tctex2
might influence the proteasomal degradation of endoglin and T
RII. To test this hypothesis, HEK293 cells were transfected with either the different expression constructs alone or with endoglin or T
RII in combination with Tctex2
. Transfected cells were then treated for 16 h with either proteasome inhibitors or Me2SO or were left untreated. After cell lysis, equal amounts of proteins were analyzed by SDS-PAGE and Western blotting for the amounts of endoglin, T
RII, and Tctex2
. Coexpression of endoglin or T
RII with Tctex2
clearly resulted in an increased amount of endoglin as well as T
RII (Fig. 8A). This stabilizing effect in the presence of Tctex2
was equal to or even higher than that in the proteasome inhibitor-treated single transfectants. The same result was also seen in COS-1 cells coexpressing endoglin and Tctex2
(Fig. 8B).
| DISCUSSION |
|---|
|
|
|---|
that interacts with the TGF-
type III receptor endoglin as well as T
RII. Sequence alignment, phylogenetic analysis, and secondary structure prediction clearly placed Tctex2
in the Tctex1/2 family of DLCs, a family that was first identified in mouse testis and later found in the cytoplasmic dyneins of many tissues (42, 43). On the basis of our bioinformatic analyses, we are confident of the existence of a new Tctex subfamily (Tctex2
) formed by human Tctex2
and its several close homologs in chimpanzee, pig, mouse, and rat (Fig. 1C). Cytoplasmic dyneins are involved in a variety of intracellular motile processes, including mitosis, maintenance of the Golgi apparatus, and trafficking of membranous vesicles and other intracellular particles. These movements are required for the spatial organization of the cytoplasm and, as a consequence, are crucial for many processes such as cell division, embryonic development, and regulation of signaling (44, 45). DLCs bind to the cargo and therefore determine cargo specificity. Three distinct families of cytoplasmic DLCs have been identified and designated LC8, LC7/Roadblock, and Tctex1/2. Accumulating evidence shows that DLCs can interact with different, functionally unrelated proteins, facilitating dynein association with specific cargoes. For example, known binding partners for Tctex1 include rhodopsin, Doc2, Fyn kinase, the Trk receptor, CD5, and CD155 (46, 47).
|
revealed that Tctex2
mRNA is present in primary vascular endothelial and smooth muscle cells, where endoglin is preferentially expressed. Thus, it is possible that Tctex2
might play a role in angiogenesis or other endoglin-related functions in the vasculature. Other than that, a range of Tctex2
expression levels were found in placenta, testis, and several tumor cell lines. Even though the Tctex2
expression levels varied among the different cell types tested, the data suggest a ubiquitous expression profile. The highest expression was seen in LCLC cells and HUVECs, whereas the Tctex2
mRNA level in testis was relatively low. In contrast, both Tctex1 and Tctex2 are enriched in testis, whereas Tctex1 expression in lung tissue is differentially regulated, with greatly decreased levels in adult lung. Tctex2 is more restricted to testis, liver, and fetal thymus, with only very low levels detectable in fetal and adult lungs (43). These first expression data for Tctex2
in comparison with Tctex1 and Tctex2 suggest that this family of DLCs might have overlapping but also diverging cell type-specific functions.
Endoglin is a new member of the TGF-
receptor family identified to interact with a DLC. BMPRII and the bone morphogenetic protein type IA (ALK3) and IB (ALK6) receptors have been reported to bind to Tctex1 (48). In vitro kinase assays demonstrated that BMPRII phosphorylates Tctex1, which is abolished by BMPRII mutations causing the human disorder primary pulmonary hypertension. T
RII has been shown to interact with and phosphorylate a member of the LC7/Road-block group of DLCs, km23/mLC7-1 (41), upon TGF-
treatment. Overexpression of mLC7-1 induces specific TGF-
responses, including JNK (c-Jun N-terminal kinase) activation, c-Jun phosphorylation, and mink lung epithelial cell growth inhibition. Furthermore, TGF-
induces the recruitment of mLC7-1 to the dynein intermediate chain. In addition, it has been demonstrated that mLC7-1 is required for TGF-
-induced activation of the p3TP-Lux promoter reporter (49).
We also investigated the role of Tctex2
in TGF-
signaling and found that overexpression of Tctex2
in mink lung epithelial and HepG2 cells severely inhibited TGF-
-induced (CAGA)12-luciferase reporter activity by >40% (Fig. 4, A and B). This inhibitory effect was even stronger than that seen for endoglin. However, coexpression of Tctex2
and endoglin demonstrated no synergistic effect of further reduced reporter activity. At the moment, we do not know whether Tctex2
is upstream or downstream of endoglin in the signaling cascade. However, because Tctex2
is a DLC, and DLCs are generally involved in signaling by mediating the transport of receptor signaling complexes in a retrograde fashion along the microtubules toward the nucleus, it is conceivable that Tctex2
operates downstream of endoglin. Our results seem to be contradictory to the up-regulation of TGF-
signaling by mLC7-1; however, the (CAGA)12-luciferase reporter becomes activated by the Smad3/Smad4 pathway, whereas p3TP-Lux reporter induction depends on an intact MAPK (mitogen-activated protein kinase) pathway (49). Thus, it is possible that the functions of Tctex2
in Smad and non-Smad signaling pathways are different. In general, this raises the possibility that the function of DLCs might be pathway-specific.
Aside from endoglin, we have demonstrated that T
RII can associate with Tctex2
, too, and that the three proteins form a multimeric complex (Fig. 7). Fluorescence microscope images showed that the main co-localization of the multimeric Tctex2
-endoglin-T
RII complex occurred at the cell membrane, whereas in vesicles, only rarely did we observe the three proteins together or Tctex2
with endoglin or with T
RII. In contrast, vesicular co-localization of endoglin with T
RII was clearly visible. However, these vesicles appeared bloated compared with the smaller sized vesicles associated with Tctex2
. Endoglin and T
RII are transmembrane proteins transported from the Golgi toward the cell membrane, an anterograde movement. Only during ligand-induced signaling or protein recycling/proteasomal degradation would we expect to see membrane receptors in retrograde moving vesicles. Tctex2
is a DLC protein family member. These proteins are thought to be involved in retrograde protein transport. This suggests that the observed endosomal co-localization of endoglin and T
RII is most likely in vesicles on their way to the cell membrane and that Tctex2
is, under the conditions used in this study, not involved in receptor internalization and hence receptor recycling/proteasomal degradation of endoglin and T
RII. The current hypothesis is that Tctex2
may block signaling by preventing receptor internalization, which could lead to an increased retention time of the receptors at the cell membrane. This is supported by our finding that coexpression of Tctex2
with endoglin or T
RII leads to a more or less equivalent increase in the two receptors comparable with that in endoglin- or T
RII-transfected cells treated with proteasome inhibitors. In addition, these data also suggest that membrane-localized endoglin and T
RII are constantly degraded by the proteasome system and replaced by newly synthesized endoglin and T
RII. Apart from that, because the cytoplasmic domain of T
RII, which interacts with Tctex2
, has kinase activity, it would be very interesting to test whether Tctex2
might be phosphorylated by the T
RII kinase domain and whether the phosphorylated Tctex2
is involved in determination of cargo specificity or other signaling events.
In summary, we have identified a new DLC protein (Tctex2
) as a novel binding partner for endoglin and T
RII. Tctex2
shows an unexpected role as a TGF-
signaling inhibitor. By fluorescence microscopy, co-localization of Tctex2
, endoglin, and T
RII could be detected at the cell membrane, but was hardly seen in vesicles. Furthermore, coexpression of Tctex2
with endoglin or T
RII appears to stabilize the two receptors, therefore preventing proteasomal degradation of endoglin and T
RII. This prompted us to speculate that Tctex2
might increase the retention time of endoglin and T
RII at the cell surface by blocking internalization, which would also lead to inhibition of ligand-induced signaling. Further studies are now necessary to investigate this hypothesis.
| FOOTNOTES |
|---|
* This work was supported in part by the British Heart Foundation (to J. M. G.) and the Zentrum für Angewandte Forschung-Biotechnologie Zukunftsoffensive (Baden-Würtemberg, Germany) (to A. L., P. K., and M. H.) and the Fritz-Thyssen Foundation (to A. L., T. F.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. ![]()
1 Both authors contributed equally to this work. ![]()
4 Supported by the Biotechnology and Biological Sciences Research Council, the Wellcome Trust, the Wolfson Foundation, and the Royal Society. ![]()
2 To whom correspondence may be addressed. Tel.: 44-161-275-3928; Fax: 44-161-275-3938; E-mail: qjmeng{at}manchester.ac.uk.
3 To whom correspondence may be addressed. Tel.: 49-621-292-6537; Fax: 49-621--292-6420; E-mail: a.lux{at}hs-mannheim.de.
5 The abbreviations used are: TGF-
, transforming growth factor-
;T
RII, transforming growth factor-
type II receptor; DLC, dynein light chain; HA, hemagglutinin; wt, wild-type; ECFP, enhanced cyan fluorescent protein; EGFP, enhanced green fluorescent protein; X-gal, 5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside; RACE, rapid amplification of cDNA ends; RT, reverse transcription; HUVECs, human umbilical vein endothelial cells; LCLC, large cell lung cancer; TRITC, tetramethylrhodamine isothiocyanate; EST, expressed sequence tag; BMPRII, bone morphogenetic protein type II receptor; ActRIIA, activin type IIA receptor. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |