|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 281, Issue 49, 37942-37951, December 8, 2006
Structure of FitAB from Neisseria gonorrhoeae Bound to DNA Reveals a Tetramer of Toxin-Antitoxin Heterodimers Containing Pin Domains and Ribbon-Helix-Helix Motifs* 1![]() ![]() 2
From the
Departments of
Received for publication, May 31, 2006 , and in revised form, September 11, 2006.
Neisseria gonorrhoeae is a sexually transmitted pathogen that initiates infections in humans by adhering to the mucosal epithelium of the urogenital tract. The bacterium then enters the apical region of the cell and traffics across the cell to exit into the subepithelial matrix. Mutations in the fast intracellular trafficking (fitAB) locus cause the bacteria to transit a polarized epithelial monolayer more quickly than the wild-type parent and to replicate within cells at an accelerated rate. Here, we describe the crystal structure of the toxin-antitoxin heterodimer, FitAB, bound to a high affinity 36-bp DNA fragment from the fitAB promoter. FitA, the antitoxin, binds DNA through its ribbon-helix-helix motif and is tethered to FitB, the toxin, to form a heterodimer by the insertion of a four turn -helix into an extensive FitB hydrophobic pocket. FitB is composed of a PIN (PilT N terminus) domain, with a central, twisted, 5-stranded parallel -sheet that is open on one side and flanked by five -helices. FitB in the context of the FitAB complex does not display nuclease activity against tested PIN substrates. The FitAB complex points to the mechanism by which antitoxins with RHH motifs can block the activity of toxins with PIN domains. Interactions between two FitB molecules result in the formation of a tetramer of FitAB heterodimers, which binds to the 36-bp DNA fragment and provides an explanation for how FitB enhances the DNA binding affinity of FitA.
Neisseria gonorrhoeae (GC)3 is the agent of the sexually transmitted disease, gonorrhea. The mechanisms used by GC to initiate infection have been very well characterized. Gonococci adhere via a multistep cascade and subsequently enter cells forming the epithelial barrier of the urogenital tract, traffic across these cells and exit into the subepithelial matrix (1, 2). Although studies have identified many of the molecular mechanisms used by GC to adhere to and enter cells, our knowledge of the mechanisms that operate in the later stages of infection is limited.
GC are able to survive and grow within epithelial cells (3); they also traverse the epithelial monolayer to infect the stromal tissue of the subepithelium (2). The immune response to bacteria in the subepithelium produces the inflammation and purulent discharge characteristic of gonorrhea (4, 5). On occasion, GC establish a carrier state in which an asymptomatic individual harbors culturable and transmissible bacteria. These carriers are key to the spread of gonococcal disease, as humans are the only known reservoir for GC (6). The mechanisms by which GC maintains this persistent state are unknown. One hypothesis is that the organism resides within the epithelial cells instead of crossing into the subepithelium, thus evading the host immune response. The gene product(s) that affect GC intracellular growth and transcytosis are therefore important for the maintenance of gonococci in the human population. The fitAB operon was identified in a screen for GC mutants with a fast intracellular trafficking phenotype across polarized epithelial monolayers (3). A GC mutant that lacks fitAB grows normally extracellularly, but has an accelerated rate of intracellular replication with a concomitant increase in the rate at which this mutant traverses a monolayer of polarized epithelial cells. Thus, either FitA or FitB, or their complex, is hypothesized to slow intracellular replication and intracellular trafficking of GC. FitA is an 8.4-kDa protein with a predicted N-terminal ribbon-helix-helix (RHH) DNA binding motif (7, 8). FitB is a 15.3-kDa protein with a predicted PIN (PilT-N terminus) domain according to the BLAST search tool (9). The function of the PIN domain is unknown; however many proteins that contain a PIN domain are thought to perform roles in nucleic acid metabolism including synthesis and remodeling. In genome studies on Archaea and thermophilic bacteria, sequences predicted to encode PIN domain-containing proteins are found in regions predicted to encode DNA polymerases, helicases, and nucleases (10). In addition, the Dis3p exonucleases from Saccharomyces cerevisiae and nonsense-mediated mRNA decay (NMD) proteins in Caenorhabditis elegans are predicted to have PIN domains (11, 12). Bicistronic operons where an RHH DNA-binding protein is juxtaposed with a PIN domain have been proposed to form one family of toxin/antitoxin systems (13). The PIN domain containing protein is thus predicted to act as a toxin; this is in agreement with the role of FitB in slowing GC replication when the bacteria are within epithelial cells (3). FitA and FitB form a heterodimer, and copurify after overexpression in Escherichia coli. The FitAB complex binds DNA from the fitAB upstream region with high affinity (8). In our current model the FitAB complex binds to the fitAB promoter when GC are in an extracellular environment. This results in both sequestration of FitAB and repression of fitAB transcription. Upon invasion, FitAB may be released from the DNA and subsequently dissociate to slow both GC replication and transcytosis by an as yet undefined mechanism. To understand the structural basis of the DNA binding specificity and possible nuclease function of the FitAB complex, the x-ray crystallographic structure of a FitAB complex bound to a high affinity 36-base pair DNA fragment from the fitAB upstream region was determined. Four FitA and four FitB proteins form a unique tetramer of heterodimers structure that explains the ability of FitAB to bind DNA with higher affinity than FitA alone (8). Furthermore, the structure suggests that FitB could slow intracellular GC replication by acting as a "toxin" when the FitA ("the antitoxin")-mediated inhibition of FitB nuclease activity is relieved upon complex dissociation.
Protein Preparation, Crystallization, and X-ray Intensity Data CollectionFitA and FitB were overexpressed in E. coli using a pET28b vector (Invitrogen) that encodes the intact FitAB operon (8). This vector incorporates a T7 promoter at the 5'-end of fitA and sequences encoding six histidine residues at the 3'-end of fitB. The C-terminal amino acid sequence of FitB was also slightly altered by the addition of an XhoI restriction site, changing from... NPWHD to... NPWHLEHHHHHH. The overexpressed FitAB complex was purified using nickel affinity chromatography (Qiagen). Purified FitAB complex was concentrated to 5 mg/ml in 25 mM Tris, pH 7.5, 500 mM NaCl, 200 mM imidazole.
The intact FitAB complex did not crystallize despite numerous attempts. Therefore, limited proteolysis was done on the FitAB complex in order to generate a stabile core that might be more amenable to crystallization. Using 0.1 mg/ml trypsin (Sigma) the complex was digested for 30 min at 22 °C before crystallization trials. Trypsin inhibitor cross-linked to agarose beads (Sigma) was used to remove trypsin from the FitAB solution after digestion. Polyacrylamide gel electrophoresis and mass spectrometry analysis revealed that this treatment removed the ribbon-helix-helix motif of FitA and the resulting complex, termed FitcAB, does not bind DNA (data not shown). Crystallization was carried out using hanging drop-vapor diffusion where FitcAB was mixed 1:1 (v:v) with a reservoir solution of 0.26 M sodium phosphate/citrate pH 4.7 and 2.0 M ammonium sulfate. Crystals appeared overnight and grew to final dimensions of 0.1 mm x 0.1 mm x 0.02 mm in
To generate selenomethionine (SeMet)-substituted FitcAB complex, the expression vector described above was used as a template for standard PCR mutagenesis (Stratagene) of FitB, which contains no methionines, to yield a construct encoding FitAB where residues Leu43, Leu63, and Leu116 of FitB were substituted with methionines (FitAB3(LxM)). The FitAB3(LxM) protein was purified as described above. DNA binding assays confirmed that the FitAB3(LxM) complex has the same affinity for DNA as wild-type FitAB (data not shown). For overexpression of SeMet-substituted FitAB3(LxM), E. coli harboring the expression vector were grown in minimal medium lacking methionine with added SeMet as described (14). Using nickel affinity column chromatography, SeMet-containing FitA and FitB3(LxM) copurify as do the wild-type proteins. The SeMet-containing heterodimer was concentrated and trypsinized as described for wild-type FitAB. Crystallization of the SeMet-FitcAB3(LxM) complex employed 0.26 M sodium citrate pH 5.6 and 2.0 M ammonium sulfate. Crystals with dimensions 0.2 mm x 0.2 mm x 0.2 mm were obtained after 4 weeks. To crystallize the FitAB-DNA complex, 5 mg/ml of purified native FitAB3(LxM) was mixed in a 4:1 molar ratio with IR36 DNA (8), where two of the thymine bases were replaced with 5-iodouracil (I) (top strand, 5'-AGATTGCTATCATTTTTTTTATTTTGATAGCATITG; bottom strand, 5'-CAAATGCTATCAAAAIAAAAAAAATGATAGCAATCT). The protein-DNA complex was then mixed 1:1 (v/v) with a reservoir solution of 0.1 M sodium acetate, pH 4.0, 0.27 M sodium acetate, pH 7.0, 7.2% PEG 20,000, 7.2% PEG monomethyl ether 550. Crystals with dimensions 0.02 x 0.1 x 0.5 mm were obtained after 1 week.
Cryoprotection conditions for crystals of both native and SeMet-substituted FitcAB were established by soaking crystals in 20% glycerol, 0.26 M sodium phosphate/citrate, pH 4.7, and 2.2 M ammonium sulfate for 30 s. Cryoprotection was achieved for FitAB-IR36 crystals by soaking the crystals in 20% 2-methyl-2,4-pentanediol, 0.1 M sodium acetate, pH 4.0, 0.27 M sodium acetate, pH 7.0, 7.2% PEG 20,000, 7.2% PEG monomethyl ether 550 for 30 s. All crystals were flash-frozen in a nitrogen stream at 100 K. x-ray intensity data were collected at the Advanced Light Source beamline 8.2.1 (Berkeley, CA) and processed using MOSFLM (15) as implemented in the CCP4 suite (16). Structure Determinations and RefinementsThe structure of SeMet-FitcAB3(LxM) was solved by multiple wavelength anomalous diffraction (MAD) methods using the SeMet-FitcAB3(LxM) data collected at three wavelengths (Table 1). Seven selenium sites were located and initial phases were calculated with SOLVE (17) using data from 20.0 to 3.0 Å resolution and improved by solvent flipping (with 45% solvent content) as implemented in the crystallography and NMR system (CNS) (18). The handedness was determined by inspection of electron density maps where the initial phases were derived either from the selenium atom sites found by SOLVE or sites with the coordinates inverted. Electron density maps for the entire resolution range (58.0-2.0 Å) were then calculated using CNS. FitB and amino acid residues 46-65 of FitA were built into the map using O (19), and the location of the selenomethionine residues as reference points. 66 water molecules were added to the model and simulated annealing (SA), positional, and thermal parameter refinement using CNS were performed, followed by rebuilding of the model in O. When the Rwork and Rfree were 28.2 and 29.7%, respectively, the coordinates were used to solve the structure of the wild-type, native FitcAB molecule by molecular replacement using MOLREP (20). Multiple rounds of positional and thermal parameter refinement in CNS followed by model rebuilding in O were done using the native data to the limiting resolution of 1.8 Å until the Rfree converged to 22.4%.
The final model contains residues 1-139 of FitB, 46-64 of FitA, 92 water molecules, 1 acetate ion, 2 sulfate ions, and 3 magnesium ions. The final model was verified by inspection of 2Fo - Fc simulated annealing-composite omit maps. The high resolution FitcAB structure was used as a model to solve the structure of the FitAB-IR36 complex by molecular replacement using MOLREP (20). The remainder of the FitA sequence and the DNA was built into the map using O (19). After simulated annealing (SA) and extensive positional and thermal parameter refinement using CNS followed by model rebuilding in O, the Rwork and Rfree converged to 21.2% and 26.9%, respectively, at 3.0 Å resolution. The model was verified by inspection of the 2Fo - Fc simulated annealing-composite omit maps. The final model contains four molecules of FitA (residues 2-69, 2-65, 2-68, 2-64), four molecules of FitB (residues 1-143, 1-140, 1-143, 1-140), the complete 36 base pair double-stranded IR36 DNA fragment and 54 water molecules. Figures were made using Swiss-PDB Viewer (21) and POV-Ray.
Structure of the FitAB HeterodimerThe structure of the FitB protein complexed with a C-terminal fragment of FitA (FitcAB) was determined to 1.8 Å resolution by multiple wavelength anomalous diffraction using selenomethionine substituted proteins ("Experimental Procedures" and Table 1). This structure was used as a model to solve the structure of the full-length FitAB complex bound to a 36-bp DNA molecule to 3.0 Å resolution by molecular replacement ("Experimental Procedures" and Table 1).
The FitA monomer has an extended structure, with the topology
FitB forms a compact domain with an / / -fold (Fig. 1a). This protein consists of a central 5-stranded parallel -sheet with four -helices packed on one side of the sheet and three helices on its other side. The topology is 1 (residues 1-5), 1 (residues 7-12), 2 (residues 19-26), 2 (residues 32-36), 3 (residues 38-48), 4 (residues 55-65), 3 (residues 74-76), 5 (residues 80-94), 6 (residues 102-112), 4 (residues 117-120), 7 (residues 124-128), 5 (residues 132-134) (Fig. 1a). Electron density for the entire FitB protein is visible, with only engineered histidine residues at the C terminus not observed in the structure (missing 3/6 His in 2 monomers and 6/6 His in 2 monomers). Searches, using both the DALI server (23) and the protein structure comparison service SSM (24) at the European Bioinformatics Institute, found structural homologues of FitB in PIN-domain containing proteins. Using the BLAST server, none of these PIN domain-containing proteins were found to have significant similarity at the primary structure level to FitB (9). The archetypical PIN domain is found in the PilT N terminus, and the closest FitB structural homologue is PAE2754 from Pyrobaculum aerophilim (Fig. 1b) (25, 26). The functional significance of this domain is unknown. However, the PIN domain is found in a wide variety of systems, from bacterial FitB-like genes that are thought to be involved in plasmid maintenance, to the yeast Dis3p exonucleases (11, 27, 28). Despite a lack of sequence similarity, the four acidic residues absolutely conserved among PIN domains are present in FitB (Fig. 1b, highlighted in red). In addition to the RHH and PIN domain-containing proteins, there is a group of prokaryotic proteins with a high level of sequence homology to FitAB (Fig. 1b). These typically consist of both a FitA and a FitB homologue in a conserved operon organization and little is understood about their biochemical function, although they are known to play a general role in plasmid stability and/or partition (27-31). These have been proposed to act as toxin/antitoxin pairs, with the RHH protein acting as the antitoxin, repressing the toxic activity of the PIN domain-containing protein (32). The structure of the FitAB complex is likely to predict the structures of these toxin/antitoxin proteins. The biochemical function of this group of proteins within prokaryotic cells is likely to be similar as that performed by FitAB. Sequence alignments of FitA and FitB with two examples of such systems (Y4jJ/K and StbCB) are shown in Fig. 1b.
The FitA-FitB InterfaceThe FitA and FitB proteins form a tightly associated dimer and the FitAB structure reveals the heterodimerization interface, which is formed predominantly by contacts between
FitA helix Structure of the FitAB-IR36 ComplexFour FitAB heterodimers form a unique tetramer structure that binds to one 36-base pair DNA fragment (Fig. 2). The FitA subunits from complexes I and IV form a tightly associated domain that binds to one of the inverted repeat half-sites while the corresponding FitA portions of complexes II and III bind to the other inverted repeat (Fig. 2a). By contrast, the FitB-FitB dimer interfaces are formed between subunits from complexes I and II and complexes III and IV (Fig. 2a). Such mixing and matching of dimer interfaces is novel for the RHH family and results in the formation of the tetramer of heterodimers. Other toxin-antitoxin pairs have also been shown to form various higher order structures. For example, the MazE-MazF complex forms an extended heterohexamer (MazF2-MazE2-MazF2), and the RelE-RelB complex is a single globular domain that assembles into a heterotetramer (RelE2-RelB2) (35, 36).
The FitA homodimer buries an extensive accessible surface area (2850 Å2). This compact dimeric domain is characteristic of the RHH DNA-binding proteins (22), and its formation involves nearly every amino acid residue of
The FitB homodimer also buries a large accessible surface area (1870 Å2). At this interface,
Together, the described interfaces (Figs. 1 and 3) create a stabile tetramer of FitAB heterodimers, which is in accord with the oligomerization state that was observed in previous solution studies (8). The biochemical significance of this unusual quaternary structure is underscored by the finding that FitA dimers bind the IR36 site with an affinity of
The IR36 FitAB binding site is found upstream of the fitAB operon in N. gonorrhoeae. The inverted repeat half-sites (Fig. 2c) were defined in biochemical studies as the specific bases required for FitAB binding to this region (8). In the FitAB-IR36 complex structure, the two FitA -sheets bind on the same face of the IR36 DNA (Fig. 2b). However, this positioning is unnecessary for high affinity DNA binding, as inverted repeats with various spacer lengths between the half-sites, ranging from 14 to as little as 2 base pairs, bind FitAB with equally high affinity (8). A 4-residue flexible loop that connects FitA helices 2 and 3 would allow facile rotation of the tetramer complex and thereby provides an explanation for the observed high affinity binding of FitAB to IR sites with different relative orientations.
The IR36 fragment is interesting and unusual because the two half-sites are separated by a long (14-base pair) spacer region of AT-rich DNA. Sequences like the central region of IR36, containing four or more consecutive A·T base pairs are known as A-tracts (37). These sequences adopt a structure different from that of typical B-form DNA in which A-tracts are essentially straight and rigid (38, 39). In addition, these sequences deviate from B-form DNA by having a compressed minor groove and a shorter helical repeat of only 10 bp (37, 40). The rigidity of A-tracts is predicted to allow for sharp bends at their edges (37), however there is no pronounced local bending in the structure of IR36 (Fig. 2, a and b and Table 2). Rather the DNA is smoothly curved such that the end-to-end bend angle is 44°. As expected, the central 14 base pairs are straighter, i.e. more rigid, than the rest of the DNA; there is a greater bend in the inverted repeat sequence (1.83° per base step) than in the A-tract region (1.08° per base step) (Table 2). The rigidity of the A-tract region is also demonstrated by the thermal parameters of the structure; the average B factor for the entire DNA molecule is 51 Å2, while it is only 42 Å2 for the isolated A tract (Table 1). The average twist between base pairs is comparable between the A-tract and inverted repeat segments of the sequence with the inverted repeats having slightly less twist than the A-tracts (Table 2). The central sequence shares another characteristic of canonical A-tract DNA, a significantly compressed minor groove, which is underscored when compared with the minor groove widths of the flanking sequences. Minor groove widths in the A-tract are 3.7 Å on average, while in the flanking sequences the width of the minor groove averages 7.1 Å (Table 2). The functional significance of the IR36 A-tract is unknown. However, its complete solvent exposure would allow access to the replication and transcription machinery.
FitA-DNA ContactsFitA makes few specific contacts to the DNA and all contacts to base pairs are mediated by its residues from the conserved sheet. As predicted, the highly conserved RHH residue Arg7 is crucial for DNA recognition (Fig. 4). The guanidinium side chain of Arg7 from each FitA subunit hydrogen bonds with the O6 and N7 atoms of the most 5'-guanine base of the inverted repeat sequence (Fig. 4b) as well as the thymine base on the 5'-side of this guanine. In subunits I and IV, this thymine base forms a water-mediated hydrogen bond to Asn8 as well (Fig. 4). The only other specific contact is a van der Waals interaction between the side chain of Val5 and the thymine from the T/A sequence central to each inverted repeat (Fig. 4a). In addition to these base contacts, a number of residues from the N-terminal end of FitA helix 2 contact the phosphate-sugar backbone of the DNA molecule. The side chains of Arg33 and Ser27 from all FitA subunits are involved in such interactions, as are the amide nitrogens of Thr28 and Glu29 (Fig. 4a).
FitB Contains a PIN DomainFitB has a high degree of structural homology to the PIN domain containing protein PAE2754. 93 corresponding C In an initial attempt to identify a nuclease activity for FitB, several in vitro assays were carried out using a variety of nucleic acid substrates, including single and double-stranded RNA and DNA and Flap structures. However no nucleic acid cleavage was detected in the context of the FitAB complex. Unlike some homologous PIN domain containing exonucleases, FitB has a dimerization partner, FitA. Intriguingly, an arginine residue, Arg68, at the C terminus of FitA is located in the FitB acidic pocket, potentially blocking access of potential substrates and thus, inhibiting any enzymatic function (Fig. 5c). The guanidinium group of Arg68 interacts with the carboxyl groups of residues Asp5, Glu42, and Asp104 from FitB, forming strong electrostatic interactions that would not be easily displaced by a competing nucleic acid substrate. These negatively charged residues form the Mg2+ binding pocket in PAE2754 (29) and may similarly bind Mg2+ in FitB when Arg68 from FitA is not present. Indeed, the trypsinized FitcAB molecule, the structure of which was solved as a part of this work, bound two solvent molecules in this acidic pocket that are very likely magnesium ions ("Experimental Procedures" and data not shown). A FitB(Mg2+)-dependent nuclease might be activated in the cell when the FitA-FitB complex dissociates in response to some unknown signal, allowing Mg2+ to bind in the place of Arg68 from FitA. This dissociation event is proposed to release the FitA antitoxin and allow the induction of a bacteriostatic action by the FitB toxin, by analogy to other proposed toxin-antitoxin systems (42-44). A common feature of toxin-antitoxin structures is that an otherwise unstructured peptide from the antitoxin blocks the activity of the toxin (35, 36, 45). Preliminary experiments with FitcAB or FitB alone, which it should be noted is highly insoluble in vitro, have also failed to reveal any nuclease activity. However, at this point these studies have been limited to use of the IR36 sequence and there is a strong possibility that the FitB nuclease requires a specific DNA or RNA substrate that meets certain structural requirements. While the YoeB and RelE toxins have been shown to act as nucleases, their structure and active site residues are very different from those seen in FitB and thus they are not suitable as models for the putative FitB nuclease activity (35, 45). The identity of the putative FitB substrate(s) is the subject of ongoing biochemical and biological studies.
In conclusion, FitA and FitB form a heterodimer in which FitA is the DNA binding subunit and FitB contains a nuclease activity that is blocked by the presence of FitA and activated by an as yet unidentified intracellular signal, which dissociates the FitAB complex. Four such FitAB heterodimers associate into a novel tetrameric structure that binds to the IR36 sequence from the fitAB promoter region with high affinity. Many PIN domain-containing proteins are involved in nucleic acid metabolism and/or remodeling, with the prokaryotic FitAB and its homologues responsible for controlling rates of DNA replication and/or plasmid maintenance (3, 27, 28). This structure illustrates the mechanism by which antitoxins with RHH motifs are able to block the activity of PIN domain toxins in prokaryotes (46). Future studies on the activity of FitB will help us understand both generally how PIN domains control such diverse processes as replication and nonsense-mediated mRNA decay and specifically the role of FitAB in GC virulence (3, 11).
The atomic coordinates and structure factors (code 2H1C and 2H1O) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).
* This work was supported by National Institutes of Health Grant AI47260 (to M. S.) and funds from the Robert A. Welch Foundation (G-0040). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 A postdoctoral fellow of the American Heart Association, Pacific Mountain Affiliate. Present address: Bureau of Microbial Hazards, Health Products and Food Branch, Health Canada, Ottawa, ON K1A 0K9, Canada. 2 The Robert A. Welch Distinguished University Chair in Chemistry at UT MDACC. To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, University of Texas MD Anderson Cancer Center, Unit 100, 1515 Holcombe Blvd., Houston, TX 77030. Tel.: 713-834-6390; Fax: 713-834-6397; E-mail: rgbrenna{at}mdanderson.org.
3 The abbreviations used are: GC, N. gonorrhoeae; FitAB, fast intracellular trafficking; FitcAB, the FitAB complex in which the RHH domain of FitAB has been removed by limited proteolysis; RHH, ribbon-helix-helix; PIN, PilT N terminus; SeMet, selenomethionine; PEG, polyethylene glycol; RMSD, root mean-square deviation.
We thank Drs. Hans Peter Bächinger, Kerry Maddox, and Cory Bystrom for N-terminal sequencing and mass spectroscopy analysis of proteins and Dr. Corie Ralston for help with data collection. The Advanced Light Source is supported by the Director, Office of Science, Office of Basic Energy Sciences, Materials Sciences Division, of the United States Department of Energy under Contract No. DE-AC03-76SF00098 at Lawrence Berkeley National Laboratory.
This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||