|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 281, Issue 5, 2533-2542, February 3, 2006
The Unique NH2-terminally Deleted (
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
N) p63 variant, transcribed from a cryptic promoter in intron 3, lacks such an activation domain. Thus, the TAp63 and
Np63 variants possess a wide ranging ability to up-regulate p53 target genes. Consequentially, the disparity in transactivation potential between p63 variants has given rise to the hypothesis that the
Np63 variant can serve as oncoprotein by opposing the activity of the TAp63 variant and p53. However, recent studies have revealed a transcriptional activity for
Np63. This study was undertaken to address the transcriptional activity of the
Np63 variant. Here, we showed that all NH2-terminally deleted p63 isoforms retain a potential in transactivation and growth suppression. Interestingly,
Np63
possesses a remarkable ability to suppress cell proliferation and transactivate target genes, which is consistently higher than that seen with
Np63
. In contrast,
Np63
has a weak or undetectable activity dependent upon the cell lines used. We also demonstrate that an intact DNA-binding domain is required for
Np63 function. In addition, we found that the novel activation domain for the
Np63 variant is composed of the 14 unique
N residues along with the adjacent region, including a PXXP motif. Finally, we demonstrated that a PPXY motif shared by
Np63
and
Np63
is required for optimal transactivation of target gene promoters, suggesting that the PPXY motif is requisite for
Np63 function. | INTRODUCTION |
|---|
|
|
|---|
p63, a member of the p53 family of transcription factors, was identified in 1998 (2, 3). Like p53, p63 contains a proline-rich domain, a DNA-binding domain, and a tetramerization domain, all of which share strong sequence similarity with p53 (reviewed in Ref. 4). Accordingly, p63 is able to regulate many p53 target genes. However, due to two transcriptional start sites, the TP63 locus is capable of expressing two major variants, called TA2 and
N, both of which have multiple isoforms as a result of alternative splicing at the COOH terminus. Transcribed from the upstream promoter, the TA variant contains an acidic, transcriptional activation domain (AD) similar to p53 and is able to transactivate p53 target genes as well as inhibit cell proliferation and induce apoptosis. In contrast, the
Np63 variant, transcribed from the cryptic promoter in intron 3, lacks the activation domain encoded by exons 2 and 3 but gains 14 unique residues in its NH2 terminus. Alternative splicing of p63 transcripts results in expression of at least three COOH-terminal isoforms,
,
, and
. Thus, the TP63 gene is capable of producing at least six transcripts: p63
, p63
, p63
,
Np63
,
Np63
, and
Np63
(Fig. 1A).
The discovery of p53 family members, p73 in 1997 (5) and p63 in 1998 (2, 3), was first thought to introduce two new tumor suppressors in the fight against cancer. Although enthusiasm was initially tempered by findings that p63 and p73 do not function as classic tumor suppressors, recent evidence suggests that p63 might serve an important role in tumor suppression. Amplification and overexpression of p63 has been linked to increased survival rates in lung cancer patients (6), and loss of p63 expression has been linked to an increase in metastasis in bladder (79) and breast cancers (10). Likewise, fibroblasts derived from p63 knock-out mice were shown to be defective in the p53-mediated apoptotic response (11). In addition, a follow up study has demonstrated that mice heterozygous for p63 developed an increased tumor burden and metastasis rate, which was compounded in mice harboring heterozygous alleles of p53 and/or p73 (12).
Among all p63 isoforms,
Np63
is the most predominantly expressed. Our laboratory and others have demonstrated that
Np63
retains transcriptional activity and is competent to induce growth suppression (13). When expressed in H1299 cells,
Np63
is able to inhibit cell proliferation, induce cell death, and up-regulate GADD45 (growth arrest and DNA damage-45) and p21. Importantly, these activities are dependent on the presence of the NH2 terminus, since the 
Np63
construct lacking the first 26 amino acids was nonfunctional. These findings have forced the scientific community to reconsider the role of
Np63
in tumor formation and development. Evidence supporting a transcriptional activity for
Np63
has been demonstrated by others. For example,
Np63
was shown to function both as a positive regulator of p53-responsive promoters and as a negative regulator of maturation-specific genes during Ca2+-induced keratinocyte differentiation (14). Similarly, small interfering RNA knockdown of
Np63
in immortalized mammary epithelial cells revealed that
Np63
promotes transcription of PUMA and NOXA but negatively regulates the P21 and P53 promoters (15). Finally,
Np63
activates the HSP70 promoter, as well as induces hsp70 protein expression (16).
Whereas a tumor suppressor function has recently been ascribed to p63, previous studies have suggested that p63 might function as an oncogene. For example,
Np63
was characterized as transcriptionally incompetent and shown to be a dominant negative to TAp63 and p53 in luciferase reporter assays (3, 17). In addition, loricrin promoter-driven expression of
Np63
in the epidermis of transgenic mice hindered apoptosis induced by UV-B but did not alter epithelial cell proliferation or stratification (18). Furthermore, chromosomal arm 3q, which contains the TP63 locus, is amplified, and the
Np63
transcript is overexpressed in lung cancer and squamous cell carcinomas of the head and neck (19). Likewise, TAp63 isoforms are overexpressed in certain lymphomas (20).
Debate on the function of
Np63
will continue until regulation of p63-mediated target gene expression is elucidated. To gain a better understanding of the diverse activities found in the p63 isoforms, we mutated or deleted specific regions in p63. By comparing the transcriptional activity of wild-type and mutant p63 proteins in stable, inducible cell lines and in transient expression studies, we have characterized several functional domains that regulate
Np63 transactivation potential. Our results demonstrated that
Np63
and
Np63
are capable of inducing target gene expression and inhibiting cell proliferation. We showed that these activities are dependent upon DNA binding, since DNA-binding domain mutants were inactive. In addition, we have defined the activation domain in
Np63, which includes the 14 unique
N residues and the adjacent proline-rich domain. Finally, our results demonstrate that a PPXY motif, present in
Np63
and
Np63
, modulates
Np63 function.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
-actin antibody and horseradish peroxidase-conjugated secondary antibodies were purchased from Sigma. Unless otherwise indicated, all remaining reagents were purchased from Sigma.
Plasmids and MutagenesisVarious
Np63 constructs were generated by PCR amplification using Myc-tagged
Np63
or
Np63
cDNA as a template. To generate
Np63
(
214), a cDNA fragment encoding residues 15211 was amplified using 5' end primer p6358 (5'-GAATTCCTCGAGCCACAGTACACGAACCTGGG-3') and 3' primer p63-2 (5'-TTGTACAGGACTGTTGTGAATTCAG-3'). To generate
Np63
(
219), a cDNA fragment encoding residues 20211 was amplified using 5' end primer p63-67 (5'-ACTCGAGCTGGGGCTCCTGAACAGC-3') and the 3' primer p63-2. To generate
Np63
(N6H), a cDNA fragment encoding residues 2211 was amplified using 5' end primer p63-26 (5' CCTCGAGTTGTACCTGGAACACAATGCCCAGACTC 3') and the 3' primer p63-2. These cDNA fragments were digested with XhoI and BsrGI and used to replace the corresponding region in the wild-type construct.
To generate
Np63(
457-ter), a cDNA fragment encoding residues 199456 was amplified using 5' end primer p63-59 (5'-CCACAGGTTGGCACTGAATTCACAACAGTCC-3') and 3' primer p63-60 (5'-TGGATCCTCAGACAATGCTGCAGTCTGTGG-3'). To generate
Np63(
431-ter), a cDNA fragment encoding residues 199430 was amplified using the 5' end primer p63-59 and 3' primer p63-61 (5'-TGGATCCTCAAGCTTGGGTAGGGCTGAGTCC-3'). To generate
Np63(
406-ter), a cDNA fragment encoding residues 199405 was amplified using the 5' end primer p63-59 and 3' primer p63-62 (5'-TGGATCCTCACATGCCCTCAGGCATGG-3'). To generate
Np63(
381-ter), a cDNA fragment encoding residues 199380 was amplified using the 5' end primer p63-59 and 3' primer p63-63 (5'-TGGATCCTCAGACAATGCTGCAGTCTGTGG-3'). To generate
Np63(
356-ter), a cDNA fragment encoding residues 199355 was amplified using 5' end primer p63-59 and 3' primer p63-355 (5'-ACGGATCCTCATTTCTGAAGTAGGTGCTG-3'). To generate
Np63
(Y449A), a cDNA fragment encoding residues 199456 was amplified using the 5' end primer p63-59 and 3' primer p63-71 (5'-TGGATCCTCAGACTTGCCAAATCCTGACAATGCTGCAGTCTGTGGGGGCGGGCGGTGGTGGGGT-3'). To generate
Np63
(Y449D), a cDNA fragment encoding residues 199456 was amplified using the 5' end primer p63-59 and 3' primer p63-72 (5'-TGGATCCTCAGACTTGCCAAATCCTGACAATGCTGCAGTCTGTGGGGTCGGGCGGTGGTGGGGT-3'). To generate
Np63
(
445449), a cDNA fragment encoding residues 199456 was amplified using the 5' end primer p63-59 and 3' primer p63-73 (5'-TGGATCCTCAGACTTGCCAAATCCTGACAATGCTGCAGTCTGTGGGGGTGCAGTGGGAGG-3'). These cDNA fragments were digested with BamHI and BsrGI and used to replace the corresponding region in the wild-type construct.
To generate
Np63
(R149W), a cDNA fragment encoding residues 135215 was amplified using 5' end primer p63-1 (5'-CCTGTCTACAAGAAAGCTGAGCATGTCACCGAGGTTGTGAAATGGTGCCCTAACCAT-3') and the 3' primer p63-2. This cDNA fragment was digested with AccI and BsrGI and used to replace the corresponding region in the wild-type construct.
To generate
Np63
(L22Q,L23S), a cDNA fragment encoding residues 35215 was amplified using 5' end primer p63-5QS (5'-TTCAGAACGGATCCTCGTCCACCAGCC-3') and the 3' primer p63-2. An additional cDNA fragment encoding residues 134 with point mutations at residues 22 and 23 (L22Q,L23S) was amplified from wild-type
Np63
in pcDNA3 using 5' end primer T7 (5'-TAATACGACTCACTATAGGG-3') and 3' primer p63-3QS (5'-GGACGAGGATGGGTTCTGAATCTGCTGGTCCATGCTGTTCGACTGCCCCAGGTTC-3'). Following digestion with EcoRI and BamHI, a three-piece ligation was used to replace the corresponding region in the wild-type construct.
Site-directed mutagenesis was performed using the Stratagene QuikChange kit. To generate
Np63
(R243Q), the entire construct was amplified using 5' end primer (5'-GCAAGTCCTGGGCCAACGGTGCTTTGAGG-3') and 3' end primer (5'-CGTTCAGGACCCGGTTGCCACGAAACTCC-3'). To generate
Np63
(R249W), the entire construct was amplified using 5' end primer (5'-CGGTGCTTTGAGGCCTGGATCTGTGCTTGCCCA-3') and 3' end primer (5'TGGGCAAGCACAGATCCAGGCCTCAAAGCACCG-3'). To generate
Np63
(P72A), the entire construct was amplified using 5' end primer (5'-CTCCATCCCCTGCCATTGCCTCCAACACAGATTACCCG-3') and 3' end primer (5'-CGGGTAATCTGTGTTGGAGGCAATGGCAGGGGATGGAG-3'). To generate
Np63
(
PXXP), in which residues thus allowing for deletion of residues 6972 are deleted, the entire construct was amplified using 5' end primer (5'-GCCCTCTCTCCATCCTCCAACACAGATTACCCG-3') and 3' end primer (5'-CGGGTAATCTGTGTTGGAGGATGGAGAGAGGGC-3'). All mutations were confirmed by DNA sequencing.
The reporter constructs, pGL2-basic-p21 (full-length promoter), pGL2-Fos-GADD45 (intron 1 RE), and pGL2-basic-FDXR (ferredoxin reductase) (56 to +11 promoter) were described in previous studies (2123).
Cell Culture and Stable TransfectionsStable cell lines were generated using the tetracycline-off system as previously described (24). Transfections were carried out using the calcium phosphate precipitation method (25).
Growth Curve AnalysisThe overall viability of each cell line was addressed by growth curve analysis, as previously described (26). Briefly, 5 x 104 H1299 and 1 x 105 MCF-7 cells were plated per 6-cm dish and either induced (without tetracycline) or uninduced (with tetracycline). Adherent cells were counted at 24-h intervals over 5 days in culture using a Coulter cell counter. Medium was changed at day 3 for both control and experimental cell groups.
DNA Histogram AnalysisThe assay was carried out using a FACS-Caliber cell sorter (BD Biosciences) as previously described (24). Briefly, 3 x 105 cells were plated per 10-cm dish. H1299 and MCF-7 cells were induced or uninduced to express various
Np63 proteins for 3 days. Trypsinized, adherent cells and floating cells were combined, washed with phosphate-buffered saline, pH 7.4 (PBS), and fixed in 100% ethanol. When ready to stain, cells were washed with PBS and resuspended in staining buffer with 100 µg/ml RNase A and 50 µg/ml propidium iodine (Molecular Probes, Inc., Eugene, OR). RNA was digested, and cells were stained for 30 min at room temperature. The percentage of cells in each phase of the cell cycle (G1, S, and G2-M) was analyzed using Cell Quest software, with sub-G1 accumulation being used as a marker for apoptosis.
Trypan Blue Dye ExclusionH1299 and MCF-7 cells were induced or uninduced to express various
Np63 proteins for 3 days. Trypsinized, adherent cells and floating cells were collected and stained with trypan blue dye for 5 min. Both live (unstained) and dead (stained) cells were counted two times using a hemocytometer. Results are expressed as a percentage of dead cells over total cells counted.
Western Blot AnalysisCells were plated at a density of 2.5 x 106 cells/10-cm dish and incubated for 24 h. Following induction, plates were washed with cold PBS (pH 7.4) and collected in 500 µlof2x SDS sample buffer and heated for 7 min at 95 °C. SDS-PAGE and Western blots were carried out as previously described (27). Nitrocellulose membranes were blocked with 5% dry milk in PBS with 0.1% Tween 20 (PBST) for 30 min, incubated in primary antibody overnight at 4 °C or for 2 h at room temperature, and washed three times for 10 min in PBST, and then the membrane was incubated in horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature and washed four times in PBST. Blots were developed using Pierce Pico-West reagents, followed by exposure to x-ray film. All antibody dilutions were carried out with 2% dry milk in PBST.
Northern Blot AnalysisCells were plated at a density of 2.5 x 106 cells/10-cm dish and incubated for 24 h. Following induction, plates were washed with cold PBS (pH 7.4) and collected in 1.0 ml of Trizol reagent (Invitrogen). Total RNA was isolated following the manufacturer's instructions. Northern blots were prepared using 10 µg of total RNA. The P21, DKK1 (DICKKOPF-1), PIG3 (p53-induced gene-3), GADD45, FDXR, and GAPDH probes were prepared as previously described (27, 28). Blots were exposed to x-ray film and quantified by densitometry.
Luciferase AssaysTransient transfections were carried out using the calcium phosphate precipitation method (25). Briefly, p53-null H1299 cells were plated at 5 x 104 cells/well in 12-well plates and allowed to recover overnight. Using the calcium phosphate method, cells were co-transfected with 100 ng of wild-type or mutant p63 construct in pcDNA3 and 100 ng of pGL2 reporter vector/well. As an internal control, 5 ng of pRL-CMV, a Renilla luciferase vector (Promega), was also co-transfected per well. 36 h post-transfection, cells were washed with cold PBS and lysed in 150 µl of passive lysis buffer. Luciferase activity was measured using the Promega dual luciferase kit and a Turner Designs luminometer. The -fold increase in relative luciferase activity was the product of the luciferase activity induced by pcDNA3 constructs expressing wild-type or mutant p63 divided by that induced by a pcDNA3 empty control vector.
| RESULTS |
|---|
|
|
|---|
Np63 Isoforms Have the Potential to Inhibit Cell ProliferationTo determine the role of
Np63 isoforms in cell cycle progression and cell death, stable cell lines were created using the tetracycline-off system. H1299, a p53-null lung cancer cell line, was utilized to determine the p53-independent function of
Np63 isoforms. Previously published data from our laboratory demonstrate that tetracycline does not alter H1299 cell proliferation (29). Multiple cell lines were generated, and two representative cell lines for each
Np63 isoform were selected for further study. As shown in Fig. 1B, these cell lines were able to inducibly express
Np63
,
Np63
, or
Np63
. In addition, the protein level of each isoform was comparable (Fig. 1B). To determine the transcriptional activity of each isoform, we monitored the level of p21WAF1, a known p53 target gene. Similar to our previous finding (13),
Np63
was able to induce a modest increase in p21 expression. Whereas p21 expression was weakly induced by
Np63
,
Np63
was highly active in inducing this p53 target gene. To determine the ability of
Np63 isoforms to inhibit cell proliferation, growth rate analysis was performed (Fig. 1C). Consistent with our previous report,
Np63
reduced the proliferation potential of H1299 cells by day 3 (13). Furthermore, we showed that
Np63
and
Np63
were capable of inhibiting cell proliferation, with
Np63
displaying the greatest ability to induce growth suppression, followed by
Np63
and then
Np63
(Fig. 1C).
To characterize the decreased proliferative potential of H1299 cells seen in our growth curve assay, trypan blue dye exclusion studies were performed as an indicator of cell viability (Fig. 1D). Following induction of
Np63
, we observed a significant increase in the number of trypan blue-positive, nonviable cells over that seen for uninduced controls. Likewise, we observed a moderate increase in nonviable cells upon induction of
Np63
. In contrast, there was no difference in the viability of control cells and those induced to express
Np63
. In addition, DNA histogram analysis was performed to determine the cell cycle profile of these cells in the presence or absence of each
Np63 isoform (Fig. 1E). We found that sub-G1 accumulation, associated with apoptotic cell death, was increased upon induction of
Np63
and
Np63
. We also found that
Np63
and
Np63
induced cell cycle arrest, primarily in G1 phase. Upon induction of
Np63
, cell cycle arrest in G1 phase, but not significant apoptosis, was detected in both
Np63
-expressing cell lines. Taken together, these results demonstrate that
Np63
and
Np63
can induce cell death.
To rule out the possibility that these
Np63 activities are cell type-specific, we used MCF-7 breast adenocarcinoma cells to produce additional stable cell lines. Unpublished results from our laboratory have demonstrated that tetracycline does not alter MCF-7 cell proliferation. Multiple cell lines inducibly expressing
Np63
,
Np63
, or
Np63
were generated, and two representative clones were chosen for further studies. Western blot analysis was performed to determine the level of protein expressed (Fig. 2A). We found that these
Np63 isoforms were expressed at a comparable level and that p21 was up-regulated by
Np63
but not by
Np63
and
Np63
. Similar to our results observed in H1299 cells, growth curve analysis demonstrated that
Np63
and
Np63
inhibited cell proliferation, whereas
Np63
was almost inert (Fig. 2B). It is noteworthy that p21 induction was low in
Np63
, suggesting that a target gene other than p21 was responsible for mediating
Np63
-dependent growth suppression.
|
,
Np63
, TAp63
, and
Np63
for 1 and 7 days (Fig. 3). As expected, TAp63
possessed the greatest potential to up-regulate PIG3, a proapoptotic gene, and P21, a cyclin-dependent kinase inhibitor, whereas TAp63
had reduced transactivation potential due to its inhibitory COOH terminus. In addition,
Np63
was able to induce expression of GADD45 in MCF-7 cells similar to our previously published results seen in H1299 cells (13). Interestingly,
Np63
was able to induce DKK1, an inhibitor of Wnt signaling. These data effectively demonstrate the differential transcriptional activity of the p63 isoforms and highlight the need for additional studies involving isoform-specific gene activation.
DNA Binding Is Essential for p63 FunctionMost hotspot mutations found in TP53 are located in the DNA-binding domain. These mutations, characterized as either contact site or conformational mutants, are often associated with loss of tumor suppressor function. Similar mutations, associated with EEC syndrome (reviewed in Ref. 30), have been identified in the DNA-binding domain of TP63. To test the effect of DNA-binding domain mutations on p63 function, we established MCF-7 cell lines inducibly expressing
Np63
(R149W), carrying a point mutation corresponding to arginine 204 in TAp63 and to arginine 175 in p53 (Fig. 4A). Multiple cell lines were generated, and two representative clones were used for further study. Western blot analysis was performed and revealed that the level of
Np63
(R149W) was equal to or greater than wild-type
Np63
(Fig. 4B). Consistent with our earlier published reports (13), Northern blot analysis demonstrated that
Np63
was transcriptionally active in MCF-7 cells and induced expression of the FDXR, GADD45, and P21 genes (Fig. 4C). However, contrary to wild-type
Np63
, the transcriptional activity of the R149W mutant was abrogated (Fig. 4C). Consequentially,
Np63
(R149W) were unable to suppress cell proliferation (Fig. 4D). These results suggest that an intact DNA-binding domain is required for
Np63
function.
|
Np63
FunctionA patient diagnosed with ADULT syndrome was found to have a mutation in exon 3' of the TP63 gene resulting in the substitution of an asparagine with a histidine at codon 6 in all
Np63 isoforms (31). To date, the N6H mutation is the only naturally occurring mutation discovered in the unique NH2-terminal region of
Np63, but its effect on
Np63 function is unclear. To address this, multiple stable cell lines expressing
Np63
(N6H) were generated in MCF-7 cells. Western blot analysis demonstrated that the level of
Np63
(N6H) expressed was comparable with that of the wild-type (Fig. 5A). To examine the effect of this mutation on p63 function, growth curve analysis was performed. Following induction of
Np63
(N6H), cell proliferation was inhibited (Fig. 5B), but to a lesser extent compared with wild-type
Np63
in MCF-7 cells (Fig. 2B).
|
Np63 Transcriptional ActivitySrc homology 3 domains have been shown to function as protein-protein interaction motifs in various signaling pathways (reviewed in Ref. 32). PXXP motifs, identified in the proline-rich regions of p53 and p73, serve as ligand binding sites for Src homology 3 domain-containing proteins and regulate the transcriptional activity of these p53 family members (reviewed in Ref. 33). To explore the effect of the proline-rich domain on
Np63 function, we mutated the PXXP motif at residues 6972 to PXXA. Since
Np63
exhibited a strong growth suppression in MCF-7 cells (Fig. 2C), cell lines expressing
Np63
(P72A) were generated, and two representative clones were selected for further study. As demonstrated in Fig. 6A, Western blot analysis revealed that the mutant
Np63
(P72A) protein was expressed at levels equal to or greater than that of the wild-type. Growth curve analysis was performed and showed that, in comparison with
Np63
,
Np63
(P72A) had a diminished ability to inhibit cell proliferation (Fig. 6B).
Np63 Isoforms Differ in Their Ability to Activate the p53 Target Gene PromotersTo better understand the contribution of specific amino acid sequences to p63 function, we characterized the ability of wild-type and mutant p63 constructs to activate p53-responsive promoters. As determined by Western blot analysis,
Np63
and
Np63
were expressed at equivalent levels, whereas the level of
Np63
was slightly higher following transient transfection in H1299 (Fig. 7A). To measure the transactivation potential of the wild-type
Np63 isoform, each
Np63-expressing vector was co-transfected with a luciferase reporter construct into the p53-null H1299 cells (Fig. 7B). We showed that
Np63
,
Np63
, and
Np63
differentially regulated the P21, GADD45, and FDXR reporters (Fig. 7B). Similar to the results obtained in the stable cell line studies, luciferase reporter assays demonstrated that
Np63
was highly potent, whereas
Np63
was limited, to transactivate P21, GADD45, and FDXR promoters. However, transiently expressed
Np63
was unable to transactivate these promoters.
Np63
DNA-binding Domain Mutants Exhibit Loss of FunctionAmong
Np63 isoforms,
Np63
is the most potent in transactivation and in inducing cell cycle arrest and apoptosis. Thus, the remaining studies to analyze the domain and function of
Np63 were carried out with the
Np63
isoform. Since mutations in the DNA-binding domain of p63 have been identified in several developmental disorders, we utilized these mutants to demonstrate a requirement for DNA binding for p63 function (reviewed in Refs. 30 and 34). For example, codons corresponding to arginine 149 and arginine 249 were found to be mutated in EEC syndrome, whereas arginine 243 was found to be mutated in ADULT syndrome (Fig. 4A). These mutants were generated and used for luciferase assay. As revealed in Fig. 8A, both wild-type and mutant
Np63
constructs were expressed at comparable levels. To determine their transactivation potential, these DNA-binding domain mutants were analyzed for their ability to activate the P21, GADD45, and FDXR reporter constructs (Fig. 8B). Consistent with data obtained from
Np63
(R149W)-expressing cell lines (Fig. 4),
Np63
(R149W) showed a complete lack of transcriptional activity for all reporter constructs (Fig. 8B). Likewise,
Np63
(R243Q) was inactive. Surprisingly, we found that
Np63
(R249W) was able to activate the P21, GADD45, and FDXR reporters, albeit less than the wild-type protein (Fig. 8B). These data suggest that the DNA-binding domain is necessary for
Np63 activity and that some critical residues in the p53 DNA-binding domain are conserved in p63, whereas others are not.
|
|
|
N Residues and Adjacent Proline-rich Domain Constitute the Activation Domain for
Np63Previously, we showed that a deletion construct lacking the first 26 residues in the NH2 terminus of
Np63
, termed 
Np63
, lost the ability to induce P21WAF1 and GADD45 (13). In order to extend this observation, additional NH2-terminal mutants were constructed to uncover the residues required for transactivation by
Np63 (Fig. 9A). Following transfection into H1299 cells, Western blot analysis revealed that all NH2-terminal constructs were expressed at similar levels (Fig. 9B). The P21 reporter construct was used to measure the transactivation potential for these mutant constructs. As shown in Fig. 9C, we found that the luciferase activity induced by
Np63
(
214) was substantially reduced. In addition, subsequent deletion of additional NH2-terminal residues, as in
Np63
(
219), led to a further reduction in its transactivation potential. Consistent with our previous finding that 
Np63
is inert (13), deletion of the first 26 residues of
Np63
completely abolished its transcriptional activity.
|
N activation domain, we generated point mutations at residues deemed likely to contribute to
Np63 function. First, we generated
Np63
carrying the N6H mutation associated with ADULT syndrome (31). Although the N6H mutation consistently decreased the ability of
Np63
to transactivate the P21 reporter, the data failed to rise to the level of statistical significance (Fig. 9C). However, when taken together with the ability of the
Np63
(N6H) mutation to attenuate growth suppression (Fig. 4B), it is likely that the N6H mutation can alter p63 function, thus accounting for the ADULT syndrome phenotype (31). Mutation of hydrophobic residues in the NH2-terminal activation domain (AD1) has been shown to reduce the transcriptional activity of p53 (35). Therefore, the presence of two analogous hydrophobic residues in the NH2 terminus of
Np63 led us to construct the
Np63
(L22Q,L23S) mutant. As measured in a luciferase reporter gene assay, the (L22Q,L23S) mutation resulted in a small, but reproducible, decrease in promoter activation (Fig. 9C).
|
Np63
is necessary for inducing growth suppression (Fig. 6B). To determine the effect of the PXXP motif on the transcriptional activity of
Np63
, we constructed
Np63
(P72A), in which the PXXP motif was mutated to PXXA, and
Np63
(
6972), in which the PXXP motif was deleted (Fig. 9A). Although
Np63
(P72A) and
Np63
(
6972) were expressed at a higher level than wild-type
Np63
(Fig. 9B), we found that the ability of these mutants to activate the P21 promoter was greatly reduced compared with wild-type
Np63
(Fig. 9C). To further analyze the function of the PXXP motif, cell lines expressing the
Np63
(P72A) mutant were created in the H1299 background. Multiple clones were collected, and two clones were selected for further study. Western blot analysis revealed that the mutant was expressed at levels comparable with that of wild-type
Np63
(Fig. 9D). To determine the transcriptional activity of
Np63
(P72A), endogenous p21 protein levels were monitored. Consistent with the transient transfection assay, p21 was not up-regulated in cells induced to express
Np63
(P72A) (Fig. 9D, p21 panel). Coincidentally, a commonly used p63 monoclonal antibody (p63 Ab-1; Oncogene) only partially recognized the P72A mutant and did not recognize the
6972 mutant. Taken together, these data suggest that the 14 unique residues in the NH2 terminus and adjacent residues, including the PXXP motif, are required for transactivation by all
Np63 isoforms.
|
|
Np63
and
Np63
, but Not
Np63
, Contributes to Their Transcriptional ActivityThe data above clearly indicate that
Np63
is the most potent transcription factor among the
Np63 isoforms, suggesting that a positive regulatory domain exists in the COOH terminus of
Np63
. Therefore, five COOH-terminal truncation mutants were generated to map this domain in
Np63
(Fig. 10A). Western blot analysis showed that when transfected into H1299 cells, these constructs were expressed at equivalent levels (Fig. 10B). Of importance, the transcriptional activity of
Np63(
457-ter), which lacks the unique residues associated with the
isoform, and
Np63(
356-ter), which lacks the unique residues associated with the
isoform, was not altered compared with wild-type
Np63
and
Np63
, respectively (Fig. 10C). Therefore, the five unique
and 39 unique
residues present in their COOH termini do not appear to have any effect on
Np63 activity. However, the ability of
Np63(
431-ter),
Np63(
406-ter), and
Np63(
381-ter) to activate the P21 promoter was diminished compared with that of
Np63
. In sum, these data suggest that residues 431455 are responsible for the differential transcriptional activities exhibited by the three
Np63 isoforms.
A COOH-terminal PPXY Motif Confers Increased Transactivation Potential to
Np63
PPXY motifs serve as ligands for WW domain-containing proteins. Recently, studies showed that p73, another p53 family member, contains a PPXY motif that can be regulated by WW domain-containing proteins (3639). Thus, we searched for such a motif between residues 431 and 455 and found a PPXY motif present in the
and
isoforms (Fig. 11A). To explore the role of the PPXY motif in p63 function, three mutants, which disrupt the PPXY motif, were generated (Fig. 11B). Western blot showed that both wild-type and mutant
Np63
constructs were expressed at equivalent levels (Fig. 11C). Interestingly, these mutants exhibited a reduced ability to activate the P21 promoter (Fig. 11D). Nevertheless, the PPXY mutants of
Np63
were still more potent than
Np63
to activate the P21 promoter (Fig. 11D). These data suggest that the PPXY motif and additional amino acids between residues 431 and 455 are capable of enhancing the transcriptional activity of
Np63
.
|
| DISCUSSION |
|---|
|
|
|---|
Np63 in cancer is highly debatable. Previous studies have suggested that
Np63
is dominant negative toward p53 and TAp63, since it is capable of inhibiting these proteins in reporter assays (3). However, we and others have demonstrated a role for
Np63
in the induction of gene expression (1316). In addition, some studies have suggested that
Np63
is a potential oncoprotein, because it is overexpressed in lung cancer and squamous cell carcinomas of the head and neck (19), whereas others have observed a correlation between loss of p63 expression and an increase in tumorigenesis and metastasis (9, 12). To clarify the ambiguous role of p63 in cancer, we further characterized the
Np63 isoforms. We found that all three
Np63 isoforms, although lacking an activation domain similar to p53 or TAp63, retain the ability to induce target genes and inhibit cell proliferation. Of significance, the ability of
Np63
to induce target gene expression is the strongest among
Np63 isoforms, followed by
Np63
and then
Np63
.
Having demonstrated a transcriptional activity for the
N variants, we searched for the activation domain. Previous work in our laboratory demonstrated that
Np63
requires residues 126 to be transcriptionally active (13). Here, we found that the first 26 residues in
Np63
were also required for transactivation of P21. Interestingly, deletion of the 14 unique
N residues (
114) or of additional residues reaching into the proline-rich domain (
119) diminished, but did not abolish, the activity of
Np63
. Of interest, we observed that an intact PXXP motif is required for
Np63
to suppress cell proliferation and for
Np63
to transactivate the P21 gene. Thus, the 14 residues unique to the
N variant and the adjacent region, including the PXXP motif, comprise an activation domain for the
N variant.
Our data indicate that a COOH-terminal proline-rich domain within residues 431455, including a PPXY motif found at residues 446449, is to some extent responsible for the differential biochemical and biological activities associated with the
Np63 isoforms. Supporting our hypothesis, deletion of the COOH-terminal proline-rich domain or mutation of the PPXY motif revealed that this domain is required for optimal transactivation of the P21 promoter. Additionally,
Np63
and
Np63
, which contain the COOH-terminal proline-rich domain, are effective in suppressing cell proliferation. In contrast,
Np63
, which lacks the COOH-terminal proline-rich domain, possesses a much weaker potential in growth suppression. Of relevance to these latter results, fusion of TP63 exons 11 or 12 to the DNA-binding domain of GAL4 revealed a weak transcriptional activity associated with the COOH-terminal proline-rich domain (40). These findings suggest that the COOH-terminal proline-rich domain augments the transcriptional activity of the
N variant. However, it is unlikely that this COOH-terminal region constitutes an independent activation domain, since deletion of the NH2-terminal activation domain makes
Np63 transcriptionally inactive. Thus, alternative splicing confers an enhanced transactivation potential to
Np63
and
Np63
, which is not extended to
Np63
.
The question remains as to how the COOH-terminal PPXY motif modulates the transcriptional activity of
Np63. Instead of functioning as an activation domain, we hypothesize that the PPXY motif within the COOH-terminal proline-rich domain is likely to alter p63 function by promoting interaction with WW domain-containing proteins. Several studies have demonstrated that WW domain-containing proteins can alter the function of transcription factors. For example, Strano et al. (41) observed that yes-associated protein binds to a PPXY motif in TAp73
and enhances p73-mediated Bax promoter activation. In addition, WW-containing ubiquitin ligases, including Itch and NEDL2, can interact with the PPXY motif in p73 and regulate p73 protein stability (38, 39). Since mutation of the PPXY motif in
Np63
reduced its ability to transactivate the P21 reporter, it is likely that WW domain-containing proteins modulate
Np63
function in a manner similar to that seen with p73.
We have established that following inducible expression in stably transfected cells,
Np63
is able to induce growth suppression and transactivate target genes. In contrast, following transient transfection, we and others demonstrated that
Np63
is unable to transactivate known p53 target gene reporters (3, 17) but can transactivate the HSP70 reporter, a non-p53 target gene (16). In addition, several recent studies have described a positive and negative role for
Np63
in the transcriptional regulation of endogenous target genes (14, 15). Given these observations, the transcriptional activity of
Np63
is likely to require complex regulation found at the level of chromatin DNA, which is not extended to the naked DNA utilized in most reporter assays. Furthermore, it is apparent that the effect of the
COOH terminus on transcription is context-specific, since some genes are induced whereas others are repressed in the presence of the
COOH terminus. However, it is still unclear how the
COOH terminus modulates p63 function. Previous studies have demonstrated that the transcriptional activity of TAp63
is inhibited by its COOH terminus (40, 42). One hypothesis suggests that transactivation by TAp63
is inhibited through an interaction between the
COOH terminus and the TA variant activation domain (42). Importantly, our data indicate that
Np63
is less active than
Np63
to induce growth suppression, suggesting that the
COOH terminus can also attenuate the activity of the
N variant (Figs. 1 and 2). Thus, the currently accepted model cannot be applied to
Np63
, since the
N variant does not encode the residues required for this inhibitory interaction. Therefore, at least for the
N variant, the inhibitory effect of the
COOH terminus must function through an unknown mechanism. These observations point to a complex regulation of
Np63 transcriptional activity, which may account for the differential activities attributed to
Np63
(1215, 19).
In conclusion, this study demonstrates a transcriptional activity for all three
Np63 isoforms and defines the activation domain for the
N variant to include the 14 unique
N residues and the adjacent region, including the proline-rich domain. We found that the DNA-binding domain is necessary for
Np63 activity and that some critical residues in the p53 DNA-binding domain are conserved in p63, whereas others are not. Interestingly, our results suggest that regulation of and by the PPXY motif is likely to confer isoform-specific function to the
N variant. Furthermore, it is probable that regulation of proteins interacting with the PXXP and PPXY motifs accounts for the paradoxical functions attributed to p63 in cancer.
| FOOTNOTES |
|---|
1 To whom correspondence should be addressed: MCLM 660, 1530 3rd Ave. S., Birmingham, AL 35294-0005. Tel.: 205-975-1798; Fax: 205-934-0950; E-mail: xchen{at}uab.edu.
2 The abbreviations used are: TA, transcriptional activation; ADULT, acro-dermato-ungual-lacrimal-tooth; EEC, ectrodactyly-ectodermal dysplasia-cleft lip/palate;
N, NH2-terminally deleted; AD, activation domain; PBS, phosphate-buffered saline. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Li, M. J. Peart, and C. Prives Stxbp4 Regulates {Delta}Np63 Stability by Suppression of RACK1-Dependent Degradation Mol. Cell. Biol., July 15, 2009; 29(14): 3953 - 3963. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Rinne, S. E. Clements, E. Lamme, P. H.G. Duijf, E. Bolat, R. Meijer, H. Scheffer, E. Rosser, T. Y. Tan, J. A. McGrath, et al. A novel translation re-initiation mechanism for the p63 gene revealed by amino-terminal truncating mutations in Rapp-Hodgkin/Hay-Wells-like syndromes Hum. Mol. Genet., July 1, 2008; 17(13): 1968 - 1977. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Petitjean, C. Ruptier, V. Tribollet, A. Hautefeuille, F. Chardon, C. Cavard, A. Puisieux, P. Hainaut, and C. Caron de Fromentel Properties of the six isoforms of p63: p53-like regulation in response to genotoxic stress and cross talk with {Delta}Np73 Carcinogenesis, February 1, 2008; 29(2): 273 - 281. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Truong, M. Kretz, T. W. Ridky, R. Kimmel, and P. A. Khavari p63 regulates proliferation and differentiation of developmentally mature keratinocytes. Genes & Dev., November 15, 2006; 20(22): 3185 - 3197. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xu and X. Chen Glyoxalase II, a Detoxifying Enzyme of Glycolysis Byproduct Methylglyoxal and a Target of p63 and p73, Is a Pro-survival Factor of the p53 Family J. Biol. Chem., September 8, 2006; 281(36): 26702 - 26713. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |