Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M509017200 on November 29, 2005

J. Biol. Chem., Vol. 281, Issue 5, 2624-2630, February 3, 2006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/5/2624    most recent
M509017200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, B.-F.
Right arrow Articles by Liang, J. J.-N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, B.-F.
Right arrow Articles by Liang, J. J.-N.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Domain Interaction Sites of Human Lens betaB2-Crystallin*

Bing-Fen Liu and Jack J.-N. Liang1

From the Center for Ophthalmic Research/Surgery, Brigham and Women's Hospital, and Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts 02115

Received for publication, August 16, 2005 , and in revised form, October 17, 2005.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
betaB2-crystallin, the major component of beta-crystallin, is a dimer at low concentrations but can form oligomers under physiological conditions. The interaction domains have been speculated to be the beta-sheets, each of which is formed by two or more beta-strands. betaB2-crystallin consists of 16 beta-strands, 8 in the N-terminal domain and 8 in the C-terminal domain. Domain interaction sites may be removed by destroying the beta-strands, which can be done by site-specific mutations, substituting the beta-formers (Val, Phe, Leu) with Glu or Asn, strong beta-breakers. We have cloned the following beta-strand-deleted mutants, I20E, L34E, V54E, V60E, V73E, L97E, I109E, I124E, V144E, V152E, L162E, L165E, and V187E and their corresponding X -> Asn mutants. We also made two mutants, V46E and V129E, that were not on the beta-strand as controls. Disruption of protein-protein interactions was screened by a mammalian two-hybrid system assay. Protein-protein interactions decreased for all beta-strand-deleted mutants except I20E, L34E, and L162E mutants; this effect was not seen in the two mutant controls, V46E and V129E. The sequences around Val-54, Val-60, Val-73, and Leu-97 in the N-terminal region and Ile-109, Ile-124, Val-144, Val-152, Leu-165, and Val-187 in the C-terminal region that formed beta-strands appear to be important in dimerization. Some selected mutant proteins that showed strong (V46E and V129E) and reduced (V60E, V144E, V60N, and V144N) interactions were expressed in bacterial culture and were studied with spectroscopy and chromatography. The V60E and V144E mutants were found to be partially unfolded and incapable of forming a complete dimer.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
betaB2-crystallin is the major component of beta-crystallin and is a dimer at low concentrations (1–3). At high concentrations or in the lens, betaB2-crystallin forms hetero-oligomers with other beta-crystallins. These oligomeric beta-crystallins further participate in the formation of a supramolecular assembly that is important in lens function-lens transparency. A posttranslational or mutational modification in the interaction domain will disrupt the complex formation and the supramolecular assembly. Therefore, the determination of the interaction domains is essential for understanding crystallin functions. For a dimer or oligomeric proteins, the interaction sites or domains are usually beta-sheets formed by two or more beta-strands. betaB2-crystallin was reported to have a high beta-sheet content (2). Based on the structure from x-ray refraction studies for homodimer betaB2-crystallin (4, 5), each subunit includes 16 beta-strands. Table 1 gives the distribution of those 16 beta-strands along with that predicted from the PHD method (6). The distribution for {gamma}B-crystallin is also included for comparison (7). Each subunit has four Greek key motifs, and each motif contains four beta-strands. Using site-specific mutation and a two-hybrid system assay, one can determine which beta-strands are involved in the dimerization. It has been reported, based on x-ray structures of 29 proteins (8, 9), that amino acids such as Val and Ile are strong beta-formers and Leu and Phe are beta-formers but that Glu and Pro are strong beta-breakers and Asn, Lys, and Asp are beta-breakers. Using site-specific mutation, one can eliminate the beta-strands that are responsible for dimerization. We have prepared many X (Val or Ile or Leu) -> Glu or Asn mutants for the two-hybrid system screening assays (Table 2) and found that most beta-strand-deleted mutants, especially those in the C-terminal domain, have reduced protein interactions. The results are consistent with our recent study of the Q155* betaB2-crystallin mutant (10); the Q155* mutation decreased protein-protein interactions (dimerization), and the expressed mutant protein became partially unfolded. The truncation of 51 amino acid residues in the C-terminal region removes three beta-strands that participate in intermolecular domain interactions. To study the effects of the beta-strand-deleted mutations on biophysical properties, we cloned two such mutants (V60E or V60N and V144E or V144N) and two controls (V46E and V129E) and observed that beta-strand-deleted mutant genes resulted in conformational change (partial unfolding) and inability to form complete dimers.


View this table:
[in this window]
[in a new window]
  		TABLE 1
Sequence alignment and distribution of beta-strand of beta B2- and {gamma} B-crystallin

 


View this table:
[in this window]
[in a new window]
  		TABLE 2
The forward and reverse primers for subcloning beta B2-crystallin mutants of X -> Glu substitution The primers for the corresponding mutants of X -> Asn substitution were prepared by substituting GAG or GAA with AAC in the forward primers and CTC or TTC with GTT.

 

   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Subcloning Mutant Genes into the Two-hybrid System Vectors—We used the Clontech Mammalian Two-Hybrid System Assay Kit 2 (Clontech, Palo Alto, CA). The test protein (bait) was fused into the GAL4 DNA-BD in the pM vector, and the second test protein (prey) was fused into the VP16-AD in the pVP16 vector. The third vector, pG5SEAP, contains a reporter construct and is encoded with secreted alkaline phosphatase (SEAP),2 an enzyme that enables sampling of culture medium without cell lysis.

We used the previously constructed plasmids pM-betaB2 and pVP16-betaB2 (11, 12) to prepare 14 mutants of X -> Glu substitution using the QuikChange mutagenesis kit (Stratagene, La Jolla, CA). The primers used were custom synthesized (Invitrogen) (Table 2). The corresponding mutants of X -> Asn substitution were also prepared.

Cotransfection and SEAP Assay—HeLa cells were used in the cell culture, and Lipofectamine 2000 (Invitrogen) was used in cotransfection as previously reported (10–12). HeLa cells were grown at 37 °C with 5% CO2 with 10% serum and were seeded at 2 x 105 cells in 500 µl of medium/well in a 24-well plate. Plasmids pM-X (0.3 µg) and pVP16-Y (0.3 µg) and pG5SEAP reporter vector (0.3 µg) were added to the wells containing 2 µl of Lipofectamine 2000 reagent.

SEAP activity was detected 48 h after transfection using the BD Great EscAPe SEAP fluorescence detection kit (Clontech). The detailed protocol for SEAP detection is provided in the kit and was used in our recently reported study (10). The fluorescence substrate MUP (4-methylumbelliferyl phosphate) provides an easy assay of SEAP by reading fluorescence at 360/449 nm. A standard linear curve was obtained using the positive placental alkaline phosphatase. The expression of GAL4 DNA-BD/protein fusion was verified by Western blot with the GAL4 DNA-BD monoclonal antibody (11, 12). To see whether expression levels were a factor for different SEAP activities, protein concentrations in the soluble protein extracts were determined using the Pierce BCA assay. The results indicated that protein expression levels varied very little among the various culture cells.

Expression of betaB2-Crystallin Mutants—The use of the QIAexpression Type IV kit (Qiagen, Valencia, CA) in the cloning, expression, and purification of His6-tagged betaB2-crystallin has been described elsewhere (10). Briefly, the betaB2-crystallin mutant genes in pM plasmids (e.g. pM-betaB2WT) were amplified by PCR using Pfu DNA polymerase (Stratagene) with the forward/reverse primers: CGGGGTACCCCGGCCTCAGATCACCAG/CCCAAGCTTGGGGTTGGAGGGGTGGAA. Two restriction sites, KpnI and HindIII, were included in the primers. The PCR products and pQE-30 vector were doubly digested by KpnI and HindIII. The digested genes and vector were then ligated by DNA ligase under standard conditions. The betaB2 cDNA inserts were verified by sequencing analysis.

The expression constructs containing various betaB2-crystallin genes were transformed into Escherichia coli strain M15 (pREP4). Cell culture was performed to induce expression of various proteins by a standard protocol. The His6-tagged betaB2-crystallins, either wild-type or mutant, were purified by nickel-nitrilotriacetic acid affinity chromatography.

SDS-PAGE and Immunoblotting—SDS-PAGE was performed in a slab gel (15% acrylamide) under reducing conditions according to the method of Laemmli (13). Western blotting was performed with polyclonal anti-beta-crystallin antibodies (a gift from Sam Zigler of NEI/National Institutes of Health). Protein concentrations were determined by measuring absorption at 280 nm: A0.1% = 1.74 for both WT and mutant betaB2-crystallins (14).


Figure 1
View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 1.
Protein-protein interactions between betaB2-crystallin mutants of X -> Glu substitution as expressed by the fold increase of SEAP activity over that in the controls (plasmids without DNA inserts): N-terminal region (A) and C-terminal region (B). The betaB2-crystallin genes were fused into the pM containing the DNA binding domain (BD) and a pVP16 vector containing the transcript activity domain (AD) and cotransfected to HeLa cells with pG5SEAP reporter vector. The culture medium was assayed for SEAP activity. Statistical significance was calculated by the paired t-test. Significant decreases were observed for the mutants from WT (*, p <0.05; **, p <0.005).

 
FPLC Gel Filtration—Size-exclusion chromatography was carried out in fast protein liquid chromatography (FPLC) with a Superose-12 column.

Spectroscopic Studies—CD spectra were obtained with an Aviv circular dichroism spectrometer (model 60 DS; Aviv Associates, Lakewood, NJ). Five scans were recorded and averaged and followed by a polynomial-fitting program. The CD was expressed as deg-cm2-dmol-1.

Fluorescence was measured with a Shimadzu spectrofluorometer (model RF-5301PC; Shimadzu Instruments, Columbia, MD). Trp emission was scanned with an excitation wavelength at 295 nm. Bis-ANS fluorescence emission spectra were scanned between 460 and 560 nm with an excitation wavelength of 395 nm.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Protein-Protein Interactions Involving betaB2-Crystallin Mutants—The SEAP activities as detected by 4-methylumbelliferyl phosphate fluorescence between betaB2-crystallin mutants themselves are shown in Fig. 1. The majority of the mutations in the beta-strands, including V54E, V60E, V73E, L97E, L109E, I124E, V144E, V152E, L165E, and V187E, decreased SEAP activities relative to the wild-type betaB2-crystallin. The mutations that did not decrease SEAP activities included I20E, L34E, V46E, V129E, and L162E. In general, mutations in the C-terminal region reduced SEAP activity more than did those in the N-terminal region. The two control mutations, V46E and V129E, which are not in the beta-strand, did not decrease the SEAP activity. These results indicated that disruption of particular beta-strands that might participate in dimerization was responsible for the reduction of SEAP activity. Those mutations that resulted in low SEAP activities between themselves (e.g. V54E-V54E) also showed low SEAP activities with WT (e.g. V54E-WT) (Fig. 2).

The corresponding SEAP activities for the mutants with an X -> Asn substitution are shown in Fig. 3. The results are basically the same as those of mutants of X -> Glu substitution, indicating that substitution of either the charged glutamic acid or the neutral asparagines yielded the same result.


Figure 2
View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 2.
The corresponding protein-protein interactions between beta-strand-deleted betaB2-crystallin mutants and WT betaB2-crystallin: N-terminal region (A) and C-terminal region (B). Significant decreases were observed for the mutants from WT (*, p <0.05 in panel A and p <0.005 in panel B).

 
Biophysical Studies of betaB2-Crystallin Mutants—Four betaB2-crystallin mutants with a Val -> Glu substitution (V46E, V54E, V129E, and V144E), two in the N- and two in the C-terminal region, as well as WT were prepared as His6-tagged proteins. The two mutants V46E and V129E did not involve destruction of beta-strands, and the two mutants V54E and 144E did involve destruction of beta-strands. The His6 tagging did not change protein conformation, as the His6-tagged WT betaB2-crystallin did not show any difference in Trp fluorescence and CD from non-His-tagged WT betaB2-crystallin (10). For mutation of Val -> Asn substitution, V60N and V144N mutants were prepared.

SDS-PAGE, Western Blot, and FPLC Size-exclusion Chromatography—SDS-PAGE and Western blot are shown in Fig. 4. The His6-tagged betaB2-crystallin is located at a higher molecular weight than the non-tagged betaB2-crystallin.


Figure 3
View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 3.
The corresponding protein-protein interactions between betaB2-crystallin mutants of X -> Asn substitution as expressed by the fold increase of SEAP activity over that in the controls (plasmids without DNA inserts): N-terminal region (A) and C-terminal region (B). Significant decreases were observed for the mutants from WT (*, p <0.05; **, p <0.005).

 


Figure 4
View larger version (40K):
[in this window]
[in a new window]
  		FIGURE 4.
SDS-PAGE (A) and Western blot (B)of betaB2-crystallin and mutants. Lane 1, marker; lane 2, non-tagged WTbetaB2-crystallin; lane 3, His6-tagged WT betaB2-crystallin; lanes 4–7, His6-tagged V46E, V60E, V129E, and V144E betaB2-crystallin mutants.

 
The elution profiles of the V46E and V129E mutants on FPLC are the same as that of the WT, but those of V60E and V144E mutants appeared to contain a mixture of dimers and monomers (Fig. 5). A rerun of collected fractions between 18 and 21 ml for V144E mutant showed the same profile. The corresponding mutants V60N and V144N did not show the effect.

CD and Fluorescence—Both far-UV and near-UV CD changed greatly for the V60E and V144E mutants (Figs. 6 and 7), indicating an alteration occurs not only in the secondary structure but also the tertiary structure. The change is similar for the two mutants, but the other two control mutants, V46E and V129E, did not show these changes. The CD data indicate that the mutations (Val -> Glu) involving the addition of charge change CD more than those mutations (Val -> Asn) involving no change of charge.


Figure 5
View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 5.
FPLC size-exclusion chromatography of beta-strand-deleted mutants on a Superose-12 column: V46E and V60E mutations in the N-terminal region (A), V129E and V144E mutations in the C-terminal region (B), and V60N and V144N mutations (C). The wild-type betaB2-crystallin is included for comparison. Protein concentrations are at 0.1–0.5 mg/ml, and the elution rate is 0.5 ml/min. The markers indicated in the upper x-axis are from profile of calf lens soluble LMW proteins ({alpha}-, betaH-, betaL-, and {gamma}-crystallin).

 
Trp and Bis-ANS Fluorescence—Trp fluorescence showed no shift in emission maximal wavelength and only a small change in intensity for V46E and V129E mutants but a large red shift (from 331 to 345 nm) for V60E and V144E or V60N and V144N mutants (Fig. 8), suggesting that Trp residues in these mutants are in a more hydrophilic environment than are those in V46E, V129E, and WT.

In comparison with {alpha}A-crystallin, WT betaB2-crystallin gave a relatively low bis-ANS fluorescence intensity (2), but the intensity increased greatly for the V60E and V144E or V609N and V144N mutants (Fig. 9), indicating that the buried hydrophobic surfaces became accessible to the bis-ANS probe in these mutants.


Figure 6
View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 6.
Far-UV CD of beta-strand-deleted betaB2-crystallin mutants: V46E and V60E mutations in the N-terminal region (A), V129E and V144E mutations in the C-terminal region (B), and V60N and V144N mutations (C). WT betaB2-crystallin is included for comparison. Protein concentrations are 0.2 mg/ml, and the cell path length is 1 mm.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The crystallographic structure of betaB2-crystallin has been determined for a homodimer of a fragment of a 181-amino acid sequence without the N- and C-terminal extensions (5, 15) and a tetrameric WT (16). The distribution of the beta-strand in each subunit is different in dimers and tetramers. For the purpose of our study, the use of the crystallographic structure of homodimer betaB2-crystallin should be adequate. Both the dimer and tetramer structures were determined with bovine lens betaB2-crystallin. Because we used human lens betaB2-crystallin, we used a PHD program to predict the secondary structure (6). The predicted secondary structure is in good agreement with that from crystallography (Table 1). It is reasonable to assume that the structure of human betaB2-crystallin is similar to that of bovine betaB2-crystallin, because they share a high sequence homology (91%). We also included the distribution of beta-strands for {gamma}B-crystallin for comparison because the structures of betaB2- and {gamma}B-crystallin are similar. Both betaB2- and {gamma}B-crystallin structures are characterized by having four Greek key motifs: two (1 and 2) in the N-terminal domain and two (3 and 4) in the C-terminal domain (5, 7). Each motif consists of four beta-strands, and four motifs form four beta-sheets. Each beta-sheet contains four beta-strands that do not correspond exactly to those in the particular motif. The beta1-sheet consists of three beta-strands in motif-1 (beta1-, beta2-, and beta4-) and one beta-strand in motif-2 (beta7-). The corresponding beta-strands in the other three beta-sheets are: beta2-sheet (beta3-, beta5-, beta6-, and beta8-), beta3-sheet (beta9-, beta10-, beta12-, and beta15-), and beta4-sheet (beta11-, beta13-, beta14-, and beta16-). In {gamma}B-crystallin, the two domains are connected by a flexible linker peptide and organized so that two beta-sheets (sheet-1 and sheet-3) lie on the outside of the molecule and the other two (sheet-2 and sheet-4) are in partial contact (intramolecular domain association). betaB2-crystallin has a structure similar to that of {gamma}-crystallin except that the linker peptide is extended in a way favoring an intermolecular association; the two subunits associate in a dimer in a swap form such that the N-terminal domain of the first subunit is adjacent to the C-terminal domain of the second subunit. The other major difference is that betaB2-crystallin contains an N-extension and a C-extension, reported to be responsible for preventing oligomerization (association of dimers) (17, 18). Domain interactions in the betaB2-crystallin may be similar to those in the {gamma}B-crystallin, i.e. between sheet-2 of the first subunit and sheet-4 of the second subunit and between sheet-4 of the first subunit and sheet-2 of the second subunit. The sheet-2 consists of the beta3-, beta5-, beta6-, and beta8-strand in the N-terminal region of the first subunit, and the sheet-4 consists of the beta11-, beta13-, beta14-, and beta16-strand in the C-terminal region of the second subunit. The mutations in Val-60, Val-73, Leu-97 destroyed beta5-, beta6-, and beta8-strands located in motif-2, and the mutations in Val-152, Leu-165, and Val-187 destroyed beta13-, beta14-, and beta16-strands located in the motif-4. The destruction of beta-strand was reflected in the large reduction in SEAP activity. The results of mutations at beta2- and beta4-sheets confirm that they play an important role in dimerization. However, the results of some mutations in beta1- and beta3-sheets were mixed: mutation in Val-54, Ile-109, Ile-124, and Val-144 decreased SEAP activities and in Ile-20 and Leu-34 did not decrease SEAP activities. The mutation sites of Val-46 and Val-129 are not in the beta-strand, and the SEAP activities were not affected. Apparently, the association of the beta2-sheet of the first subunit and the beta4-sheet of the second subunit was not entirely responsible for the dimerization. The Val -> Glu substitution introduced a negative charge; we made some Val -> Asn substitutions to see whether the decrease of SEAP activity might be due to the introduction of the charge and found that the changes in SEAP activities were basically the same as that of mutants with the X -> Glu substitution. The disruption of key beta-strands is the critical mechanism for the decrease of SEAP activity.


Figure 7
View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 7.
Near-UV CD of beta-strand-deleted betaB2-crystallin mutants: V46E and V60E mutations in the N-terminal region (A), V129E and V144E mutations in the C-terminal region (B), and V60N and V144N mutations (C). WT betaB2-crystallin is included for comparison. Protein concentrations are 0.5 mg/ml, and the cell path length is 10 mm.

 


Figure 8
View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 8.
Trp fluorescence of beta-strand-deleted betaB2-crystallin mutants. Protein concentration is 0.08 mg/ml. The excitation wavelength is 295 nm: Val -> Glu mutants (A) and Val -> Asn mutants (B).

 
The observation that V60E (V60N) and V144E (V144N) mutations greatly reduced SEAP activity indicated that the beta5- and beta12-strands were two of the many dimerization sites, which was further confirmed by their inability to form complete dimers. The control mutants V46E and V129E, in which mutations were in the non-beta-strand, did not show these effects. The partial unfolding in the V144E mutant was also seen in the V144N mutant, indicating that disruption of the beta-strand by either a Val -> Glu or a Val -> Asn substitution gave the same result.


Figure 9
View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 9.
Bis-ANS fluorescence of beta-strand-deleted betaB2-crystallin mutants. Protein and bis-ANS concentrations are 0.08 mg/ml and 5 x 10-5 M, respectively. The excitation wavelength is 395 nm: Val -> Glu mutants (A) and Val -> Asn mutants (B).

 
As dimerization is the initial step in the formation of beta-crystallin complexes seen in the human lens, to maintain the integrity of the subunit interaction domains is thus important in sustaining their stability. Any disruption of the domain structures by either posttranslational modification or mutation will disturb the complex formation that is critical for lens transparency. This was demonstrated in the congenital cataract CRYBB2 gene product Q155*, in which 51 amino acid residues were truncated, removing all beta-strands in the motif-4 critical in dimerization and resulting in a partially unfolded and unstable protein (10). We believe that these events are primary effects and that the secondary effect is an inability of the protein to participate in complex formation. The determination of the dimerization domain is thus important not only for betaB2-crystallin but also for {alpha}A- and {alpha}B-crystallin, whose three-dimensional structures have not been established. It is possible to obtain data about dimerization domains similar to those of betaB2-crystallin by extending the present study to {alpha}-crystallin, with its beta-strand distribution predicted by the PHD program. The sites of both R116C {alpha}A-crystallin and R120G {alpha}B-crystallin mutations, associated with various autosomal dominant congenital cataracts, are located in the beta7-strand and were found to change protein-protein interactions profoundly (11), although the mechanism might not be related to disruption of the beta-strand. Two recent studies reported the interaction domains for {alpha}B-crystallin, with their results not in complete agreement; one used a peptide scan (19), and the other used a protein pin array (20). The latter report indicates that interaction domains are accessible to solvent and consist primarily of beta-strands in the core region with a minor helical structure in the N-terminal region and a nonstructural sequence in the C-terminal region. An earlier study using site-directed spin labeling identified an interface consisting of two beta-sheets of seven beta-strands at {alpha}-crystallin domain that mediates the formation of dimeric {alpha}A-crystallin (21). The other relevant study was reported by J. King and coworkers (22) on human {gamma}D-crystallin. Using site-specific mutagenesis on {gamma}D-crystallin and an unfolding-refolding study, they found that some hydrophobic residues (Phe-56, Ile-81, Val-132, and Leu-145) are important in the domain interactions and they are in the beta-strands that contribute to intra-domain interactions.

In summary, we have demonstrated that the two-hybrid system could be used to determine the subunit interaction domains for betaB2-crystallin. Our studies confirm the key beta-strands that play an important role in the dimerization.


   FOOTNOTES
 
* This work was supported by National Institutes of Health Grant EY13968 and by the Massachusetts Lions Eye Research Fund. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

1 To whom correspondence should be addressed: Center for Ophthalmic Research/Surgery, Brigham and Women's Hospital, 221 Longwood Ave., Boston, MA 02115. Tel.: 617-278-0559; Fax: 617-278-0556; E-mail: jliang{at}rics.bwh.harvard.edu.

2 The abbreviations used are: SEAP, secreted alkaline phosphatase; WT, wild-type; FPLC, fast protein liquid chromatography; Bis-ANS, 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lampi, K. J., Ma, Z., Shih, M., Shearer, T. R., Smith, J. B., Smith, D. L., and David, L. L. (1997) J. Biol. Chem. 272, 2268-2275[Abstract/Free Full Text]
  2. Fu, L., and Liang, J. J. (2001) Mol. Vis. 7, 178-183[Medline] [Order article via Infotrieve]
  3. Hejtmancik, J. F., Wingfield, P. T., and Sergeev, Y. V. (2004) Exp. Eye Res. 79, 377-383[CrossRef][Medline] [Order article via Infotrieve]
  4. Driessen, H. P., Bax, B., Slingsby, C., Lindley, P. F., Mahadevan, D., Moss, D. S., and Tickle, I. J. (1991) Acta Crystallogr. Sect. B Struct. Crystallogr. 47, Pt. 6, 987-997
  5. Bax, B., Lapatto, R., Nalini, V., Driessen, H., Lindley, P. F., Mahadevan, D., Blundell, T. L., and Slingsby, C. (1990) Nature 347, 776-780[CrossRef][Medline] [Order article via Infotrieve]
  6. Rost, B., and Sander, C. (1993) J. Mol. Biol. 232, 584-599[CrossRef][Medline] [Order article via Infotrieve]
  7. Kumaraswamy, V. S., Lindley, P. F., Slingsby, C., and Glover, I. D. (1996) Acta Crystallogr. Sect. D Biol. Crystallogr. 52, 611-622[CrossRef][Medline] [Order article via Infotrieve]
  8. Chou, P. Y., and Fasman, G. D. (1978) Annu. Rev. Biochem. 47, 251-276[CrossRef][Medline] [Order article via Infotrieve]
  9. Chou, P. (1989) in Prediction of Protein Structure and the Principles of Protein Conformation (Fasman, G. D., ed) pp. 549-586, Plenum Press, New York
  10. Liu, B. F., and Liang, J. J. (2005) Mol. Vis. 11, 321-327[Medline] [Order article via Infotrieve]
  11. Fu, L., and Liang, J. J. (2003) Investig. Ophthalmol. Vis. Sci. 44, 1155-1159[Abstract/Free Full Text]
  12. Fu, L., and Liang, J. J. (2002) J. Biol. Chem. 277, 4255-4260[Abstract/Free Full Text]
  13. Laemmli, U. K. (1970) Nature 227, 680-685[CrossRef][Medline] [Order article via Infotrieve]
  14. Mach, H., Middaugh, C. R., and Lewis, R. V. (1992) Anal. Biochem. 200, 74-80[CrossRef][Medline] [Order article via Infotrieve]
  15. Bax, B., and Slingsby, C. (1989) J. Mol. Biol. 208, 715-717[CrossRef][Medline] [Order article via Infotrieve]
  16. Nalini, V., Bax, B., Driessen, H., Moss, D. S., Lindley, P. F., and Slingsby, C. (1994) J. Mol. Biol. 236, 1250-1258[CrossRef][Medline] [Order article via Infotrieve]
  17. Trinkl, S., Glockshuber, R., and Jaenicke, R. (1994) Protein Sci. 3, 1392-1400[Medline] [Order article via Infotrieve]
  18. Sergeev, Y. V., Hejtmancik, J. F., and Wingfield, P. T. (2004) Biochemistry 43, 415-424[CrossRef][Medline] [Order article via Infotrieve]
  19. Sreelakshmi, Y., Santhoshkumar, P., Bhattacharyya, J., and Sharma, K. K. (2004) Biochemistry 43, 15785-15795[Medline] [Order article via Infotrieve]
  20. Ghosh, J. G., and Clark, J. I. (2005) Protein Sci. 14, 684-695[CrossRef][Medline] [Order article via Infotrieve]
  21. Koteiche, H. A., and McHaourab, H. S. (1999) J. Mol. Biol. 294, 561-577[CrossRef][Medline] [Order article via Infotrieve]
  22. Kosinski-Collins, M. S., Flaugh, S. L., and King, J. (2004) Protein Sci. 13, 2223-2235[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
R. Gupta and O. P. Srivastava
Identification of Interaction Sites between Human {beta}A3- and {alpha}A/{alpha}B-crystallins by Mammalian Two-hybrid and Fluorescence Resonance Energy Transfer Acceptor Photobleaching Methods
J. Biol. Chem., July 3, 2009; 284(27): 18481 - 18492.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
J. Zhang, J. Li, C. Huang, L. Xue, Y. Peng, Q. Fu, L. Gao, J. Zhang, and W. Li
Targeted Knockout of the Mouse {beta}B2-crystallin Gene (Crybb2) Induces Age-Related Cataract
Invest. Ophthalmol. Vis. Sci., December 1, 2008; 49(12): 5476 - 5483.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
281/5/2624    most recent
M509017200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, B.-F.
Right arrow Articles by Liang, J. J.-N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, B.-F.
Right arrow Articles by Liang, J. J.-N.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2006 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement