| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 281, Issue 50, 38365-38375, December 15, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Signaling*
¶1¶¶2¶||3
From the
Michael E. DeBakey Department of Surgery, the Department of Molecular and Cellular Biology, ¶Dan L. Duncan Cancer Center, and ||Interdepartment Graduate Program in Cell and Molecular Biology, Baylor College of Medicine, Houston, Texas 77030 and **Center for Advanced Biotechnology and Medicine, Susan Lehman Cullman Laboratory for Cancer Research, Ernest Mario School of Pharmacy, Rutgers, State University of New Jersey, Cancer Institute of New Jersey, Piscataway, New Jersey 08854
Received for publication, July 31, 2006 , and in revised form, October 10, 2006.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
(TGF-) controls a diverse set of cellular processes, and its canonical signaling is mediated via TGF--induced phosphorylation of receptor-activated Smads (2 and 3) at the C-terminal SXS motif. We recently discovered that PPM1A can dephosphorylate Smad2/3 at the C-terminal SXS motif, implicating a critical role for phosphatases in regulating TGF- signaling. Smad2/3 activity is also regulated by phosphorylation in the linker region (and N terminus) by a variety of intracellular kinases, making it a critical platform for cross-talk between TGF- and other signaling pathways. Using a functional genomic approach, we identified the small C-terminal domain phosphatase 1 (SCP1) as a specific phosphatase for Smad2/3 dephosphorylation in the linker and N terminus. A catalytically inactive SCP1 mutant (dnSCP1) had no effect on Smad2/3 phosphorylation in vitro or in vivo. Of the other FCP/SCP family members SCP2 and SCP3, but not FCP1, could also dephosphorylate Smad2/3 in the linker/N terminus. Depletion of SCP1/2/3 enhanced Smad2/3 linker phosphorylation. SCP1 increased TGF--induced transcriptional activity in agreement with the idea that phosphorylation in the Smad2/3 linker must be removed for a full transcriptional response. SCP1 overexpression also counteracts the inhibitory effect of epidermal growth factor on TGF--induced p15 expression. Taken together, this work identifies the first example of a Smad2/3 linker phosphatase(s) and reveals an important new substrate for SCPs. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
4 signaling, largely mediated via the transcriptional functions of Smad proteins, controls diverse developmental processes and the pathogenesis of many diseases, including cancer, autoimmune, and fibrotic diseases. A key step in TGF- signaling is ligand-induced phosphorylation of R-Smads (Smads 2 and 3 in TGF- signaling; Smads 1, 5, and 8 in BMP signaling) in the distal C-terminal SXS motif, which is mediated by the type I receptor kinase (TRI) (1–4). Smad SXS phosphorylation controls a cascade of downstream events, which include hetero-oligomeric complex formation with Smad4, and the nuclear import of this complex which regulates gene transcription in conjunction with a variety of transcriptional cofactors (3, 5). Although C-terminal SXS phosphorylation by TRI is key in Smad activation, Smad signaling is fine-tuned for diverse biological responses by further post-translational modifications, including ubiquitination and SUMOylation (6, 7), as well as phosphorylation by other intracellular protein kinases (8, 9).
R-Smads contain two conserved polypeptide segments, the MH1 (N) and MH2 (C) domains, joined by a less conserved linker region. R-Smad linker regions are serine/threonine-rich and contain multiple phosphorylation sites for proline-directed kinases. They are phosphorylated by mitogen-activated protein kinases (MAPKs) and cyclin-dependent kinases (CDKs), which exhibit some preference for specific serine residues in the linker (3, 8, 9). CDK2/4-mediated phosphorylation occurs mostly at Thr-8, Thr-179, and Ser-213 (10). CDK-dependent phosphorylation of Smad3 inhibits its transcriptional activity, negating the anti-proliferative action of TGF- and serving as a novel means by which CDKs promote aberrant cell cycle progression and confer cancer cell resistance to growth-inhibitory effects of TGF-.
MAPK-mediated linker phosphorylation appears to have a dual role in Smad2/3 regulation. Mitogens and hyperactive Ras result in extracellular signal-regulated kinase (ERK)-mediated phosphorylation of Smad3 at Ser-204, Ser-208, and Thr-179 and of Smad2 at Ser-245/250/255 and Thr-220. Mutation of these sites increases the ability of Smad3 to activate target genes, suggesting that MAPK phosphorylation of Smad3 is inhibitory (11, 12). However, in contrast, ERK-dependent phosphorylation of Smad2 at Thr-8 enhances its transcriptional activity (13). Phosphorylation of Smad3 by p38 MAPK and ROCK (Ser-204, Ser-208, and Ser-213) and c-Jun N-terminal kinase (JNK) (Ser-208 and Ser-213; analogous Ser-250 and Ser-255 in Smad2) may enhance Smad2/3 transcriptional activity, suggesting that Smads and the p38/ROCK/JNK signaling pathways might cooperate in generating a more robust TGF- response (14–16). A significant increase in Ser-208/Ser-213 phosphorylation of Smad3 is associated with late stage colorectal tumors, suggesting that the linker-phosphorylated Smad3 may mediate the tumor-promoting role of TGF- in late tumorigenesis (17).
Additional kinases, e.g. MEKK-1, CaMKII, protein kinase C, and CK
, target R-Smads and regulate Smad-dependent transcriptional responses (18–21), and TGF- may also induce Smad phosphorylation in the linker region as well as at the SXS motif (15, 16). Thus, the Smad linker region is emerging as an important and critical regulatory platform in TGF- signaling.
Phosphorylation state and the subsequent activity of many proteins are controlled by dynamic interplay between kinases and phosphatases. Protein-serine/threonine phosphatases (PS/TPs) cleave phosphate molecules from serine and threonine residues in target proteins and can largely be grouped into the PPM, PPP, or FCP/SCP families (22).
TFIIF-associating C-terminal domain (CTD) phosphatase (FCP1) and small CTD phosphatases (SCP1, SCP2, and SCP3) are characterized by a conserved DXDX(T/V) motif that is essential for their activity and that they share with a superfamily of phosphotransferases and phosphohydrolases (23–26). FCP/SCPs are well known for their ability to negatively regulate RNA polymerase II (RNAPII) by dephosphorylating its CTD at Ser-2 and Ser-5 (25–27). SCPs have also been shown to silence neuronal genes in non-neuronal tissues (28) and to attenuate androgen-dependent transcription (29). Recently, SCPs were reported to dephosphorylate Smad1 in the BMP pathway (30). It is likely that other as yet unidentified proteins involved in gene regulation are also targeted by SCPs.
We recently discovered that Smad2/3 can be dephosphorylated by the PPM family phosphatase PPM1A at the C-terminal SXS motif, to terminate Smad signaling, implicating a critical role for Smad2/3 dephosphorylation in the regulation of TGF- signaling (31). Using a similar functional genomic approach and taking advantage of phospho-Smad2/3-specific antibodies, we undertook a screen for PS/TPs whose expression reduced Smad2/3 linker/N-terminal phosphorylation. Here we present data identifying SCPs as specific Smad2/3 linker/N-terminal phosphatases, and we show that SCP1 functions to enhance TGF- signaling and counteract the inhibitory effect of EGF on TGF--induced p15 expression. In addition to providing the first example of a Smad2/3 linker phosphatase(s), we reveal an important new SCP substrate and identify the first scenario in which an SCP positively regulates gene transcription.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Expression Plasmids—pCDNA3-FLAG-SCP1, pCDNA3-FLAG-dnSCP1, and pCDNA3-FLAG-SCP2 were a generous gift from Dr. Soo-Kyung Lee (Baylor College of Medicine). HA-Smad2/3 and FLAG-Smad2/3 plasmids were described previously (32, 33). pXF2F and pXF3H are derived from the cytomegalovirus-driven vector pRK5 (Genentech).
Cell Transfection, Immunoprecipitation, and Western Blotting—Cell transfection, immunoprecipitation, and Western blotting were performed essentially as described previously (34, 35). In brief, for phosphatase screening HEK293T cells were co-transfected with tagged Smad2/3 and the relevant phosphatase using Lipofectin (Invitrogen). After 48 h cells were lysed in FLAG lysis buffer (25 mM Tris-HCl (pH 7.5), 300 mM NaCl, 1% Triton X-100, with the addition of protease (aprotinin, leupeptin, and phenylmethylsulfonyl fluoride) and phosphatase inhibitors (NaF, Na3VO4)), and subjected to anti-FLAG or anti-HA immunoprecipitation. Products were analyzed by Western blotting using phospho-Smad2/3-specific antibodies. Phospho-Smad3 sera (anti-pS204, anti-pS208, and anti-pS213) and sera recognizing both pSmad2 and pSmad3 (anti-pT8 and anti-pT179/T220) were described previously (10). The anti-pSmad2 pS245/250/255 antibody was purchased from Cell Signaling Technology®. Smad SXS motif phosphorylation was assessed using anti-P-Smad2 (Cell Signaling) or anti-P-Smad3 sera, which was a kind gift from Ed Leof (Mayo Clinic). Total Smad2/3 levels were assessed by using anti-HA (Mouse 1.1; Babco), anti-FLAG (M2; Sigma), or anti-Smad2/3 antibody (E20; Santa Cruz Biotechnology) as per the manufacturer's instructions. Equal protein loading was assessed using an anti--actin antibody (Sigma).
Immunoprecipitation of endogenous proteins was performed as described (35) using anti-SCP1 sera (a generous gift from Dr. Soo-Kyung Lee, Baylor College of Medicine). Precipitated proteins were subjected to Western blotting using an anti-Smad2 monoclonal antibody (Cell Signaling).
For growth factor treatment, cells were treated with 2 ng/ml TGF- and/or 50 ng/ml EGF (in Dulbecco's modified Eagle's medium with 0.2% fetal bovine serum), for the indicated times, prior to harvest for immunoprecipitation, Western blotting, and/or in vitro phosphatase assay. EGF activity was confirmed by Western blot analysis of lysates with anti-ERK (M12320
[GenBank]
; Transduction Laboratories) and anti-P-ERK (9106; Cell Signaling) antibodies. TGF- activity was confirmed by assessing Smad2/3 SXS phosphorylation as described above.
Nucleofection was used to examine the effect of SCP1 expression on endogenous TGF- target gene expression. HaCaT cells were nucleofected with GFP or FLAG-SCP1 DNA using the Amaxa Biosystems NucleofectorTM with solution V and program U-020 (Amaxa Inc.). After 24 h, cells were treated with TGF- and/or EGF for 20 h prior to harvest. Samples were subject to Western blotting using anti-p15 (C-20; Santa Cruz Biotechnology) and antibodies as described above.
|
In Vitro Phosphatase Assays—FLAG-Smad2/3 and FLAG-SCPs (or negative control FLAG-SnoN) were immunoprecipitated from separately transfected HEK293T cells. FLAG-SCPs (or SnoN) were eluted from protein A-Sepharose using FLAG peptide (Sigma) and incubated with protein A-Sepharose-bound FLAG-Smad2/3 in phosphatase buffer (50 mM Tris (pH 7.5), 60 mM MgCl2, 2.5 mM dithiothreitol) for 1.5 h at 37 °C. Alternatively, protein A-Sepharose-bound FLAG-Smad2/3 was incubated with recombinant GST-SCP1 or GST-dnSCP1, in phosphatase buffer, for 1.5 h at 37 °C. Assay products were analyzed for Smad2/3 phosphorylation by Western blotting.
In Vitro Kinase Assay/SCP1 Phosphatase Assay—Recombinant GST-Smad3 and GST-SCP1/dnSCP1 were generated by purification of bacterially expressed GST fusion proteins. Glutathione-Sepharose-bound GST-Smad3 (1 µg per reaction) was incubated in kinase buffer (20 mM MOPS (pH 7.4), 10 mM MgCl2, 1 mM EGTA, 0.5 µM ATP) in the presence or absence of recombinant activated ERK2 (Upstate; 15 ng per 1 µg of GST-Smad3) for 30 min at 30 °C. Glutathione-Sepharose-bound GST-Smad3 was subsequently washed twice in phosphate-buffered saline, and once in phosphatase buffer, prior to incubation with recombinant GST, SCP1, or SCP1dn for 1.5 h at 37 °C. Assay products were analyzed by Western blotting using phospho-Smad2/3-specific antibodies.
RNA Interference and RT-PCR—siRNA duplexes were commercially synthesized (Sigma-Proligo). Sense strands (5' to 3') for the indicated targets are as follows: SCP1 (siSCP1, GCCGGUUGGGUCGAGACCUTT; published previously (30)), SCP2 (siSCP2, GGAUCUGUGUGGUCAUUGAUU), and SCP3 (siSCP3, CUGCCAGCUUGGCCAAGUAUU). HaCaT cells were nucleofected with 3 µg each of siSCP1, siSCP2, and siSCP3 siRNA oligonucleotides or 9 µg of control siRNA, using the Amaxa Biosystems NucleofectorTM as described above for DNA. Cells were harvested for Western blot analysis or for RNA extraction (Trizol®, Invitrogen) and RT-PCR using MultiScribeTM reverse transcriptase (Applied Biosystems) as per the manufacturer's instructions. The SCP primers (5' to 3') are as follows: SCP1 (forward, ATCCCTAAGCAGACCCCAGT; reverse, GTGGAAGACGCAGGACTCTC), SCP2 (forward, CGCTGCGTATAAGGAGGAAG; reverse, GTCACAGGGTCGGCATACTT), and SCP3 (forward, CTGCTGCTTCCGTGATTACA; reverse, TTCCCACGATGAAAAACACA).
Transcription Reporter Assays—Plasmid SBE-luc (containing the luciferase gene under the control of Smad-binding elements (SBE)), p15-luc, and p21-luc were used to assess TGF--induced transcription in HaCaT cells. Transfections were carried out using DEAE-dextran, and TGF- treatment and reporter assays were performed as described (32, 34).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
signaling. As Smad2/3 linker phosphorylation occurs on serine/threonine residues, we screened 40 PS/TPs, including 5 SCPs, 13 PPPs, 18 PPMs, and 4 DUSPs (Table 1), all of which were assessed for Smad SXS motif phosphatase activity in our previous screen (31). HEK293T cells were co-transfected with FLAG-tagged Smad2/3 and the specified phosphatase for 48 h, and cells were lysed for anti-FLAG immunoprecipitation. Samples were subject to Western blotting with antibodies specific for the linker/N-terminal Smad phosphorylation sites. As shown in Fig. 1C (lane 7), Smad2/3 were phosphorylated in the linker/N terminus in HEK293T cells cultured in regular growth medium alone. SCP1 was clearly able to dephosphorylate Smad2 at Ser-245/250/255 and Thr-8, and Smad3 at Ser-204/208/213 and Thr-8 (Fig. 1C, lane 6). Interestingly, SCP1 was unable to dephosphorylate Smad2 or Smad3 at Thr-220 or Thr-179 respectively. GFP as a negative control (lane 7) and other phosphatases such as PPP1CC (lane 2) and PPP2CB (lane 4) were unable to dephosphorylate Smad2/3 at the linker/N terminus (Fig. 1C; Table 1). All of the phosphatases screened were untagged to ensure no interference with their phosphatase activity, although a tagged set was also made to examine and normalize their expression level in cells (31).
|
for 1 h prior to harvest, to stimulate SXS phosphorylation, and lysed for immunoprecipitation and Western blotting as described above. PPM1A failed to dephosphorylate Smad2/3 in the linker/N terminus, in the presence or absence of TGF-, as determined by immunoblotting with phospho-specific Smad2/3 antibodies (Fig. 2A, lanes 4 and 5). The FLAG-PPM1A protein was active as judged by its ability to dephosphorylate Smad2/3 at the SXS motif (Fig. 2A, lanes 4 and 5). Conversely, SCP1 was unable to dephosphorylate the Smad2/3 SXS motif but was efficient at dephosphorylating the other Smad2/3 Ser(P)/Thr(P) residues, with the exception of Thr(P)-220 (Smad2) and Thr(P)-179 (Smad3) (Fig. 2A, lanes 6 and 7). The ability of SCP1 to dephosphorylate Smad2/3 at linker/N-terminal Ser/Thr residues was independent of SXS motif phosphorylation (Fig. 2A, lanes 6 and 7). Equal levels of FLAG-Smad2/3 immunoprecipitated product, and expression levels of FLAG-PPM1A and FLAG-SCP1, were confirmed by immunoblotting with an anti-FLAG antibody. Smad Linker Dephosphorylation Requires the Catalytic Activity of SCP1 and Is Independent of the Proteasome—SCP1 is a class 2 phosphatase whose activity is dependent on acidic residues in the conserved DXD motif (25). To confirm that SCP1 phosphatase activity is essential for Smad2/3 linker/N-terminal dephosphorylation, we took advantage of a catalytically inactive SCP1 mutant, dnSCP1, which has an Asp-Glu substitution at residue 96 (D96E) and an Asp-Asn at residue 98 (D98N) (25). We found that unlike its wild type counterpart, FLAG-dnSCP1 had no ability to dephosphorylate Smad2 at Ser(P)-245/250/255 and Thr(P)-8, and Smad3 at Ser(P)-204/208/213 and Thr(P)-8 (Fig. 2B, compare lanes 3 and 4). The wild type and phosphatase-inactive SCP1 proteins were similarly expressed, as determined by anti-FLAG immunoblotting of whole cell lysates. We next determined whether the ability of SCP1 to dephosphorylate Smad2/3 is dose-dependent. Almost no linker Smad2/3 phosphorylation was detected on co-transfection with 0.5 µg of SCP1, as represented by immunoblots for pS245/250/255 (Smad2) and pS213 (Smad3) in Fig. 2C (lane 3). However, phosphorylation levels increased with decreasing concentrations of SCP1 (Fig. 2C, lanes 4–6), providing more evidence that SCP1 is a Smad2/3-specific phosphatase. Finally, to confirm that the SCP1-induced decrease in pSmad2/3 is because of phosphatase activity and not because of pSmad2/3 degradation, we examined the effect of SCP1 on Smad2 linker/N-terminal phosphorylation in the presence or absence of the proteasome inhibitor MG132. MG132 treatment did not block the SCP1-induced decrease in linker/N-terminal phosphorylated Smad2 (Fig. 2D, lane 4), suggesting that SCP1 reduces pSmad2/3 levels independently of degradation via the 26 S proteasome.
|
SCP1 Dephosphorylates Smad2/3 Linkers in Vitro—To rule out the possibility that SCP1 activates another phosphatase in the cell, which in turn dephosphorylates the Smad2/3 linker, we carried out several in vitro cell-free dephosphorylation assays. In the first assay, HEK293T cells were transfected separately with FLAG-SCP1/dnSCP1, FLAG-SnoN (which should not harbor phosphatase activity), or HA-Smad2/3. After 48 h, cells were lysed, and anti-FLAG and anti-HA immunoprecipitations were carried out for SCP1/dnSCP1 or SnoN and Smad2/3, respectively. The ability of SCP1/dnSCP1 and SnoN to dephosphorylate immunopurified Smad2/3 was analyzed. Equal levels of total HA-Smad2/3 were used in each assay reaction, as determined by anti-HA Western blotting, and incubation with SCP1 led to a decrease in linker/N-terminal Smad2/3 phosphorylation as compared with SnoN control and the catalytically inactive dnSCP1 (Fig. 4A).
|
Dephosphorylation of Smad2/3 Linkers by SCP2 and SCP3—We next examined other members of the FCP/SCP family and found that SCP2 and SCP3 could also dephosphorylate Smad2/3 at all non-SXS sites apart from Thr-220/Thr-179 (Table 1; Fig. 5A). A putative additional member of the FCP/SCP family, CTD small phosphatase like 2 (CTDSPL2), has also been identified recently (36, 37). We also tested this protein, which we refer to as SCP4 in this study, in parallel with SCP2 and SCP3 and found that SCP4 expression did not result in dephosphorylation of the linker/N terminus (Fig. 5A, lane 7). FLAG-SCP phosphatase expression was confirmed by immunoblotting with anti-FLAG. The founding member of the FCP/SCP family, FCP1, was also unable to dephosphorylate Smad2/3 (Fig. 5B, lane 3) when assayed in parallel with FLAG-SCP1 as a positive control.
To further establish the function of SCPs as Smad2/3-specific phosphatases, we examined the effect of SCP overexpression and SCP depletion on endogenous Smad2/3 linker/N-terminal phosphorylation. First, FLAG-SCP1 and FLAG-SCP3 significantly reduced endogenous Smad2 phosphorylation at Ser-245/250/255 and Thr-8 (Fig. 5C, lanes 2 and 4). As expected and consistent with our data presented in Fig. 5, A and B, FLAG-dnSCP1 and FLAG-SCP4 expression had no effect on endogenous Smad2 linker phosphorylation, as is the case for the negative control FLAG-SnoN (Fig. 5C, lanes 1, 3, and 5). Total immunoprecipitated endogenous Smad2 was determined by immunoblotting with an anti-Smad2 antibody, and FLAG-SnoN and FLAG-SCP expression levels were determined by anti-FLAG immunoblotting. Second, as SCP1, SCP2, and SCP3 could all dephosphorylate the Smad2/3 linker, to perform loss-of-function analysis we nucleofected HaCaT cells with siRNA oligonucleotides targeting all three SCPs. Combinatorial knockdown of SCP RNA resulted in the reduction of SCP2 and SCP3 RNA levels by 
70 and 100%, respectively, although the SCP1 RNA level was only marginally reduced (Fig. 5D, lower panel). Despite only partial depletion of SCP1/2/3, endogenous Smad2 (Ser-245/250/255) and Smad3 (Ser-208) linker phosphorylation was increased in siSCP1/2/3 nucleofected cells as compared with control cells (Fig. 5D, upper panel). Thus, SCP1, SCP2, and SCP3 appear to be genuine Smad2/3 phosphatases that are specific for the linker region and N terminus.
SCP1 Enhances TGF- Transcriptional Responses—We next sought to determine the effect of SCP1-mediated dephosphorylation of the Smad2/3 linker on TGF- transcriptional responses. We first used SBE-luc, a TGF--responsive synthetic reporter gene dependent on Smad activation. SCP1 was able to increase SBE-luc activity in HaCaT cells (Fig. 6A). Smad2/3 mediates the transcriptional regulation of p15 (38) and p21 (39, 40); thus we next compared the effects of SCP1 and dnSCP1 on these natural TGF--responsive promoters. TGF- induced an 35-fold increase in p15-luc activity in HaCaT cells, and expression of SCP1 further increased TGF--induced activity by 2-fold, whereas dnSCP1 was unable to enhance TGF--induced activity, suggesting that the ability of SCP1 to increase the TGF- response is because of its phosphatase activity (Fig. 6B). SCP1 was also able to induce 1.5-fold more p21-luc activity than TGF- alone (Fig. 6C). Taken together, these data suggest that SCP-induced dephosphorylation of Smad2/3 can function to potentiate the Smad-mediated TGF- response. This is in agreement with previous studies demonstrating that mutation of Smad2/3 linker phospho-sites increases the TGF- response in Smad-specific transcriptional assays (10, 12).
|
and EGF—Smad2/3 linker phosphorylation can be stimulated by EGF via the activation of ERK, which may attenuate the Smad-mediated TGF- response (11). Our data in Fig. 6 further suggest that the absence of linker phosphorylation may enhance the Smad-mediated TGF- response. With this in mind, we sought to determine whether EGF or TGF- growth factors might regulate the phosphatase activity of SCPs toward the Smad2/3 linker, and consequently impact TGF--induced up-regulation of endogenous gene expression.
To determine whether the R-Smad-SCP1 interaction is TGF-- or EGF-regulated, HEK293T cells were co-transfected with FLAG-SCP1 and Myc-Smad3, treated with TGF- or EGF, and subjected to co-immunoprecipitation. We found that FLAG-SCP1 co-immunoprecipitated Myc-Smad3 regardless of growth factor treatment (Fig. 7A, lanes 3–5), as did the catalytically inactive mutant dnSCP1 (lanes 7–9). The EGF and TGF- ligands were functionally active in this experiment, as judged by the presence of endogenous pERK (Fig. 7A, lanes 5 and 9) and pSmad2-SXS (Fig. 7A, lanes 4 and 8), respectively. We then immunoprecipitated Myc-Smad3 from the same cell lysates and assessed its linker dephosphorylation in the absence or presence of TGF- and EGF. SCP1 was clearly able to dephosphorylate Smad3 at the representative linker/N-terminal sites Ser-208 and Thr-8, regardless of growth factor treatment (Fig. 7B, lanes 3–5). The dnSCP1 mutant was unable to dephosphorylate Smad3 at Ser-208 and Thr-8 under all conditions, as expected (Fig. 7B, lanes 7–9).
To confirm that TGF- and/or EGF do not regulate the phosphatase activity of SCP1, we carried out an in vitro dephosphorylation assay using immunoprecipitated FLAG-SCP1/dnSCP1 and HA-Smad2/3 from separately transfected HEK293T cells. Cells transfected with FLAG-SCP1 were cultured in the absence or presence of TGF- and/or EGF prior to anti-FLAG immunoprecipitations. An in vitro phosphatase assay was then performed as described for Fig. 4A. Equal levels of total HA-Smad2/3 were used in each assay reaction. SCP1 was able to dephosphorylate the Smad2/3 linker in vitro, and this was not affected by TGF- or EGF treatment (Fig. 7C). Taken together the data in Fig. 7, A–C, suggest that TGF- and EGF do not regulate R-Smad-SCP1 interactions and the ability of SCP to dephosphorylate Smad2/3 in the linker/N-terminal region. SCP1 expression level was also unchanged in the absence or presence of TGF- and/or EGF treatment.
Finally, it has been reported that EGF can inhibit TGF--induced up-regulation of p15 mRNA and the TGF- anti-proliferative effect (41). The authors found that this was not because of the abrogation of SXS phosphorylation of R-Smads. As EGF is known to stimulate R-Smad linker phosphorylation, we sought to determine whether SCP1 could counteract the inhibitory effect of EGF on TGF--mediated p15 induction. In control cells (GFP-transfected) EGF treatment, both alone or in conjunction with TGF-, resulted in a higher degree of Smad2 phosphorylation at Ser-245/250/255 and Thr-8 and Smad3 phosphorylation at Ser-208 and Thr-8, as predicted (Fig. 7D, compare lanes 1 and 2 with 3 and 4). In addition, EGF co-treatment greatly reduced TGF--induced p15 up-regulation in these cells (Fig. 7D, lane 4). Notably, expression of SCP1 induced higher levels of endogenous p15 than control cells when treated with EGF alone (compare lanes 3 and 7), and p15 levels were also partially restored in TGF-/EGF co-treated cells overexpressing SCP1 (Fig. 7D, compare lanes 4 and 8). The increase in endogenous p15 in SCP1 overexpressing cells correlated with a decrease in Smad linker/N-terminal phosphorylation (Fig. 7D). Thus, these data suggest that the EGF-mediated inhibition of TGF--induced p15 up-regulation may be due, at least in part, to an EGF-mediated increase in Smad2/3 linker phosphorylation.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
-induced SXS motif phosphorylation, which is essential for Smad activation, Smad signaling is fine-tuned for diverse biological responses by phosphorylation in the linker region and N terminus. As Smad linker/N-terminal phosphorylation results from interaction with a variety of intracellular protein kinases, the Smad linker/N terminus also serves as a critical platform for modulating cross-talk between TGF- and other signaling pathways. As a consequence, dephosphorylation of the Smad2/3 linker might also serve as an important mechanism for modulating signal cross-talk within cells. Here we present several lines of evidence to identify SCP1 as the first example of a Smad2/3 linker/N-terminal-specific phosphatase. First, of the 40 phosphatases screened, only SCP1, SCP2, and SCP3 were capable of dephosphorylating Smad2/3 in the linker region at sites Ser-245/250/255 (Smad2) or Ser-204/208/213 (Smad3) and at the N-terminal Thr-8. Second, recombinant SCP1, but not its catalytically inactive counterpart dnSCP1, was capable of dephosphorylating in vitro phosphorylated recombinant Smad3 in a cell-free assay. Third, SCP1 physically interacts with Smad2/3. Fourth, partial knockdown of endogenous SCP1/2/3 enhances Smad2 and Smad3 linker phosphorylation.
It is surprising, given that Thr-220 (Smad2) and Thr-179 (Smad3) can be phosphorylated by the same kinases as other linker/N-terminal Thr/Ser sites, that Smad2/3 Thr(P)-220/Thr(P)-179 was not dephosphorylated by SCP1 (or SCP2/3) in vivo or in vitro. Phosphorylation at Thr-220 in Smad2 and Thr-179 in Smad3 could have a unique role, as compared with Ser-245/250/255 (Smad2) and Ser-204/208/213 (Smad3), which excludes it from dephosphorylation by SCPs. In fact, of the 40 phosphatases screened, none had phosphatase activity toward Smad2/3 Thr(P)-220/Thr(P)-179. Thus, it is likely that Smad2/3 can be dephosphorylated at this site by a phosphatase outside the scope of our screen. While this manuscript was under review, Knockaert et al. (30) reported that SCP1/2/3 dephosphorylate BMP-induced C-terminal SXS motif phosphorylation of Smad1. It is interesting to note that we did not find SCP1 to be an efficient phosphatase at the SXS motif of Smad2/3 (31) and Smad1 (42), but we found it was specific for Smad2/3 linker dephosphorylation with the exception of Thr(P)-220/Thr(P)-179 (Fig. 2A). Additionally, we did not find the Smad2/3 C-terminal SXS phosphatase PPM1A to be a Smad2/3 linker phosphatase. We also did not find the SCP1-Smad3 interaction, or the Smad2/3-linker phosphatase activity of SCP1, to be regulated by TGF- (which stimulates SXS motif phosphorylation) or EGF (which can stimulate linker phosphorylation) (Fig. 7, A–C).
|
|
Our data suggest that SCP1-meditated dephosphorylation of Smad2/3 can function to potentiate the Smad-meditated TGF- response. SCP1 expression increased transcription from a TGF--responsive synthetic reporter gene dependent on Smad activation and also from p15 and p21 gene-specific promoters. The dnSCP1 mutant was unable to enhance TGF--induced activity, suggesting the SCP1-mediated increase in TGF- response is because of its phosphatase activity and, based on our data in this paper, likely a result of Smad2/3 dephosphorylation. This is in agreement with previous studies showing that mutation of CDK2/4 and ERK2 phosphorylation sites in the Smad2/3 linker increases the TGF- response in Smad-specific transcriptional assays (10–12). However, as others find Smad2/3-linker phosphorylation enhances TGF--induced transcription (14–16), it is possible that the role of Smad2/3 linker phosphorylation is cell type/context-dependent, dependent on the phosphorylating kinase, and/or even dependent on the combination of linker Thr/Ser sites phosphorylated. In general, in this study SCP1-mediated Smad2/3 dephosphorylation in vivo cannot be linked to a specific kinase as the phosphorylation is stimulated under physiologically relevant conditions by growth medium, which could contain factors to activate all relevant kinases. However, SCP1 can be linked to in vitro dephosphorylation of ERK2 kinasephosphorylated sites as recombinant ERK2 was used to phosphorylate Smad3 in this experiment. We also noticed that SCP1 could dephosphorylate EGF-induced endogenous Smad2/3 linker phosphorylation in HaCaT cells. This correlated with a higher level of TGF--induced p15 in the presence of EGF (Fig. 7D), suggesting that SCP1, and thus Smad2/3 linker dephosphorylation, results in a more robust TGF- response.
FCP/SCPs are well known for their ability to dephosphorylate the CTD of RNAPII at serines 2 and 5 (25–27), and until recently this appeared to be the only true target of FCP/SCPs identified. SCPs are transcriptional regulators that negatively regulate RNAPII (25–27), neuronal gene expression (28), androgen-dependent transcription (29), and BMP signaling (30). It has also been shown that SCP1 inhibits transcription from a variety of promoter-reporter gene constructs, while expression of the dnSCP1 mutant lacking phosphatase enhances transcription (25). Our finding that SCP1, but not the catalytically inactive dnSCP1, led to an enhanced TGF- transcriptional response may be the first example of SCP positively regulating transcription. Thus, there appears to be specificity for SCP1 on TGF- signaling, as we see the opposite effect to what is expected from the negative regulation of global gene transcription through dephosphorylating RNAPII.
SCP2 was initially identified (and called OS4) in a chromosomal region frequently amplified in sarcomas and brain tumors (43) and was subsequently linked to TGF- superfamily signaling in Xenopus (44). Xenopus SCP2/OS4 (XSCP2) was shown to dorsalize the ventral mesoderm, resulting in a pheno-type similar to that initiated by activation of Activin (TGF- family) signaling or the inhibition of BMP signaling. Recently, published data suggest that secondary axis formation by XSCP2 is because of inhibition of BMP signaling via its ability to dephosphorylate the Smad1 SXS motif (30). Our identification of SCP2 as a Smad2/3 linker phosphatase that can enhance Smad2/3 signaling is also consistent with the role of XSCP2 in promoting dorsalization of the ventral mesoderm. Thus, it seems possible that on some level SCPs could have a dual function in promoting secondary axis development in Xenopus embryos, simultaneously promoting Activin signaling (via dephosphorylation of the Smad2/3 linker) and inhibiting BMP signaling (via dephosphorylation of the Smad1-SXS motif).
In conclusion, SCP1/2/3 are true phosphatases for the linker/N-terminal region of Smad2/3 and are likely to be involved in modulating cross-talk between signaling pathways that converge on R-Smads. The combination of linker (de)phosphorylation events is likely to contribute to the final gene responses to Smad signaling, and thus may ultimately be important in cancer and other diseases. To this end a significant increase in Ser-208/S213 phosphorylation of Smad3 is associated with late stage colorectal tumors (17), suggesting that understanding how (de)phosphorylation of the Smad2/3 linker occurs in normal cells could be clinically relevant. Our identification of Smad2/3 as a critical new substrate for SCPs opens the door to the possibility that these phosphatases may have many, as yet unidentified, key targets in cell signaling.
|
FOOTNOTES |
|---|
The on-line version of this article (available at http://www.jbc.org) contains supplemental Fig. 1.
1 Recipient of an American Heart Association (Texas Affiliate) postdoctoral fellowship.
2 Recipient of the National Institutes of Health Breast SPORE career development award.
3 Leukemia and Lymphoma Society Scholar. To whom correspondence should be addressed: Dept. of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Rm. 137D, Houston, TX 77030. Tel.: 713-798-4756; Fax: 713-798-4093; E-mail: xfeng{at}bcm.edu.
4 The abbreviations used are: TGF-, transforming growth factor-; SCP, small C-terminal domain phosphatase; EGF, epidermal growth factor; CTD, C-terminal domain; HA, hemagglutinin; WCL, whole cell lysate; GST, glutathione S-transferase; SBE, Smad-binding element; siRNA, small interfering RNA; RT, reverse transcription; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; JNK, c-Jun N-terminal kinase; MOPS, 4-morpholinepropanesulfonic acid; GFP, green fluorescent protein; CDK, cyclin-dependent kinase; RNAPII, RNA polymerase II; BMP, bone morphogenetic protein.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
