| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 281, Issue 50, 38854-38866, December 15, 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chain to Induce Innate Immune Responses*
12
3
From the
Department of Dermatology, the University of Texas Southwestern Medical Center and Dermatology Section (Medical Service), Dallas Veterans Affairs Medical Center, Dallas, Texas 75390, ||Institute for Systems Biology, Seattle, Washington 98103, the ¶Department of Cell Biology, the University of Texas Southwestern Medical Center, Dallas, Texas 75390, and Division of Clinical Immunology and Rheumatology, Department of Medicine, University of Alabama at Birmingham, Birmingham, Alabama 35294
Received for publication, July 10, 2006 , and in revised form, October 12, 2006.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
(FcR) chain can bind to dectin-2. Second, ligation of dectin-2 on RAW cells induced tyrosine phosphorylation of FcR, activation of NF-
B, internalization of a surrogate ligand, and up-regulated secretion of tumor necrosis factor 
and interleukin-1 receptor antagonist. Finally, these dectin-2-induced events were blocked by PP2, an inhibitor of Src kinases that are mediators for FcR chain-dependent signaling. We conclude that dectin-2 is a PRR for fungi that employs signaling through FcR to induce innate immune responses. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
-glucan on yeasts (15, 16).
Binding of pathogens to particular PRR transduce intracellular signals and biologic consequences that may overlap, even synergize, with those of other PRR. For example, ligation of TLR2 alone on macrophages by zymosan (containing -glucan) led to secretion of IL-12 and TNF, and ligation of dectin-1 alone by zymosan resulted in production of reactive oxygen species (but not of IL-12 nor TNF), whereas coligation of TLR-2 and dectin-1 by zymosan enhanced secretion of IL-12 and TNF at levels higher than those induced by TLR-2 alone (17). On the other hand, ligation of DC-SIGN on dendritic cells (DC) inhibited TLR-induced IL-12 expression, while stimulating IL-10 expression (12).
Subtractive cDNA cloning of the XS52 line of epidermal Langerhans cell-like DC (18) minus J774 macrophages led us to discover dectin-1 (19) and dectin-2 (20). Both are type II-configured transmembrane proteins with extracellular domains containing a carbohydrate recognition domain highly conserved among C-type lectins (19, 20). Dectin-1 is expressed widely by APC (21) and is a PRR for -glucan in yeasts (15). Dectin-2 is constitutively expressed at very high levels by mature DC and can be inducibly expressed on macrophages after activation (20, 22). Here we report that dectin-2 is a PRR for fungi that employ Fc receptor (FcR) chain signaling to induce internalization, activate NF-B, and up-regulate production of TNF and IL-1ra.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
from Invitrogen; Staphylococcus aureus without protein A from Molecular Probes Inc. (Eugene, OR); Saccharomyces cerevisiae Y187 from Clontech; and group A Streptococci from the Section of Infectious Disease, Department of Pediatrics, the University of Texas Southwestern Medical Center (Dallas, TX). Each microbial strain was grown in media recommended by the ATCC. C. albicans yeast transformed to pseudohyphae (herein referred to as hyphae) as follows. Freshly prepared yeast was resuspended in Hanks' balanced salt solution (HBSS) containing 1.25 mM CaCl2, 1 mM MgCl2, 10 mM HEPES, pH 7.2, and 10% heat-inactivated FCS, seeded on 96-well plates or ELISA plates (2-4 x 105 cells/well), and then incubated at 37 °C for 90 min. Construction of Expression Vectors—To produce soluble dectin-1 and dectin-2 receptors, we inserted a nucleotide fragment encoding the extracellular domain of either molecule into an expression vector, pSTB-Fc (23), that allows secretion of the Fc portion of human IgG1 into the culture supernatant of mammalian cells. Respective nucleotide fragments encoding for extracellular domains of dectin-1 and dectin-2 were obtained by PCR amplification of the full-length cDNA with primers containing BamHI (forward primer) and XbaI (reverse primer) restriction enzyme sites at the 5'-end for dectin-1 or containing HindIII and XbaI sites for dectin-2. PCR fragments remaining after digestion with restriction enzymes were linked separately in-frame to the 5'-end of a nucleotide for the Fc in pSTB-Fc (pSTB-Dec1-Fc or pSTB-Dec2-Fc).
Lentiviral vectors encoding dectin-2 or dectin-1 tagged with the C-terminal V5 epitope were also constructed. Full-length dectin-2- or dectin-1-coding sequence was excised from an original cDNA clone (20) by PCR amplification with the forward primer containing a HindIII (or BamHI) restriction site and the reverse primer containing an ApaI site linked to a sequence (TACCCCTACGACGTGCCCGACTACGCC) encoding for a V5 epitope (GKPIPNPLLGLDST) at the 5'-end. Using these restriction sites, the PCR product was inserted into a mammalian expression vector, pcDNA3.1 (Invitrogen) (pcDNA-Dec2V5 or pcDNA-Dec1V5). The nucleotide sequence for dectin-2-V5 (or dectin-1-V5) was excised from pcDNA-Dec2V5 (or pcDNA-Dec1V5) by restriction enzyme digestion with PmeI (a blunt end cutter) and NotI. The lentiviral vector plasmid, pHR-SIN-CSGW dlNotI (24) (gift from Y. Ikeda, Mayo Clinic, Rochester, MN), was digested with BamHI and NotI restriction enzymes to remove a nucleotide encoding enhanced green fluorescent protein. After end-filling the BamHI site with Klenow fragments, the lentiviral vector was ligated to the nucleotide for dectin-2-V5 (or dectin-1-V5) using the blunt end and the NotI site. Preparation of infectious particles and their titration were performed according to established protocols (25).
Mouse FcR chain expression vector (pcDNA-mchain) was constructed as follows. Total RNA prepared from RAW264.7 macrophages was reverse-transcribed to the cDNA form and amplified using upper (5'-ATCGGATCCATGATCTCAGCCGTGATCTTG-3', where boldface letters indicate EcoRI site) and lower (5'-GAATTCCTACTGGGGTGGTTTTTCATGC-3', BamHI) primers. The resulting PCR product (260 bp) was inserted into pcDNA3.1 using EcoRI and BamHI sites.
To determine how dectin-2 associates with the FcR chain, we constructed dectin-2 mutants as follows. Mutant R17V with arginine replaced by valine (point mutation) at amino acid 17 of the transmembrane domain was generated following instructions from the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) using the forward primer (5'-GGAGTCTGCTGGACCCTGGTACTCTGGTCAGCTGCTGTG-3', boldface letter indicates the mutated nucleotide), and the reverse primer (5'-CACAGCAGCTGACCAGAGTACCAGGGTCCAGCAGACTCC-3'). Mutant 
ICD lacking the entire intracellular domain (amino acids 1-14) was generated by PCR amplification using the forward primer (5'-CGAAGCTTGCCACCATGACCCTGAGACTCTGGTCA-3') containing the HindIII site (in boldface) and the reverse primer (5'-TGTGTCCTCGAGTAGGTAAATCTTCTTCATTTC-3') containing the XhoI site. The resulting PCR fragment was ligated to the HindIII and XhoI sites of pcDNA-V5 vector that encodes the C-terminal V5 epitope. The same strategy using a different forward primer (5'-CCCAAGCTT (HindIII) GCCACCATGCAAGGGAAGGGAGTC-3') was used to generate mutant 1/2ICD in which half the N-terminal intracellular domain (amino acids 1-7) is deleted. Finally, the chimeric mutant 40LECD was generated by fusing the intracellular and transmembrane domains of dectin-2 to the extracellular domain of CD40 ligand (CD40L). A nucleotide fragment coding for the two domains of dectin-2 was extracted from dectin-2 cDNA by PCR amplification using the forward primer (5'-CGGCTAGC(NheI site)GCCACCATGGTGCAGGAAAGACAA-3') and the reverse primer (5'-CGAAGCTT(HindIII)TTGGTAAGTCACCACACAGCT-3'). A fragment for the extracellular domain of CD40L was prepared using the forward primer (5'-CGAAGCTT(HindIII) ATAGAAGATTGGATAAGGTC-3') and the reverse primer (5'-TGTGTCCTCGAG(XhoI)GAGTTTGAGTAAGCC-3'). The two fragments were then subcloned in the NheIXhoI sites of pcDNA-V5 vector. Nucleotide sequences of all mutants were confirmed by sequencing.
Gene Delivery to Mammalian Cells—COS-1 cells (5 x 105 cells/dish) were treated with an expression vector DNA (2 µg) and 6 µg of FuGENE 6 (Roche Applied Science) and then cultured for 2-3 days.
RAW264.7 cells (5 x 105) were infected with lentivirus encoding dectin-2-V5 (or dectin-1-V5) at a multiplication of infection (m.o.i.) of 20. The next day, the infected cells were enriched for surface expression of dectin-2-V5 (or dectin-1-V5) using immuno-magnetic beads. After blocking Fc receptors with 5 µg/ml Fc block (Pharmingen), infected RAW cells (5 x 105) were incubated with mouse anti-V5 Ab (2 µg/ml; Serotec, Raleigh, NC) and biotinylated goat anti-mouse IgG (5 µg/ml, Jackson ImmunoResearch, West Grove, PA) on ice for 60 min and treated with streptavidin-coated magnetic beads (Miltenyi, Auburn, CA). Bead-bound cells were collected and cultured in RPMI 1640 supplemented with 10% FCS. This enrichment was repeated 3-4 times, followed by analysis of the purity of the cell suspension by FACS. Greater than 90% of RAW cells expressed dectin-2-V5 (or dectin-1-V5) on their surfaces (Fig. 3B).
Purification of Fc Fusion Proteins—Three days after transfecting COS-1 cells with expression vectors for Fc fusion proteins, the culture supernatant was recovered, and Fc fusion proteins were purified by affinity chromatography as described previously (23). The protein concentrations of Fc fusion preparations were measured using the Bradford method and purity assessed by SDS-PAGE/Coomassie Brilliant Blue staining (single band) and by Western blotting (reactivity for anti-dectin-2 Ab).
Binding Assays for Microbes—Aliquots of freshly cultured bacteria (0.1 OD600), S. cerevisiae and C. albicans yeasts (0.5-1 x 106 cells each), or hyphae (4 x 105 cells) were washed with Dulbecco's PBS (DPBS) and incubated with staining buffer (0.1% BSA, 2 mM CaCl2, DPBS) containing 20 µg/ml Fc proteins on ice for 1 h. After extensive washing with buffer, cells were resuspended in 5 µg/ml of biotinylated goat anti-human IgG F(ab')2 Ab (Jackson ImmunoResearch) on ice for 30 min, followed by incubation with 1:200-diluted FITC-avidin (Vector Laboratories Inc., Burlingame, CA). We also stained filamentous fungi (M. audouinii, and T. rubrum) as follows. Single colonies of fungi were grown on Sabouroud's agar plates, harvested, and suspended in DPBS. After washing with DPBS and with water, small aliquots were spotted on slide glass, air-dried, and stained with Fc proteins as before. Binding of Fc proteins to microbes was examined using a Zeiss LSM510 laser scanning confocal microscope with 488 nm excitation and transmitted light detection (Carl Zeiss Microimaging, Thornwood, NY).
Quantitative Binding Assays—Fc protein (20 or 40 µg) was iodinated with 200 or 400 µCi of Na125I (ICN Biomedicals, Aurora, OH) at room temperature for 10 min in the presence of a rehydrated IODO-BEADs (Pierce). The reaction was stopped by removing the beads and diluting with 0.1% BSA/DPBS, followed by dialysis with CaCl2/DPBS until background levels of radioactivity were detected in the dialysis buffer. Radioactivity incorporated into Fc protein was measured by 125I cpm in the trichloroacetic acid-insoluble fraction. Specific activity was expressed as incorporated cpm/total input/µg (typically 1-2 x 106 cpm/µg).
Iodinated Fc proteins were used to quantitate binding of Fc proteins to C. albicans. Freshly cultured yeasts (5 x 105 cells) or hyphae (4 x 105 cells) were incubated with different doses of 125I-labeled Fc protein on ice for 1 h (two sets in triplicate). After extensive washing with CaCl2/DPBS, one set was left untreated, air-dried, and measured for radioactivity bound to C. albicans using a -counter. The other set was incubated with acidic buffer (0.15 M NaCl, 0.1 M glycine-HCl buffer, pH 2.3) or 10 mM EDTA (for Ca2+-dependent binding) on ice for 5 min, followed by washing. Residual radioactivity was regarded as background. Specific binding was expressed as the counts/min left after subtracting average background counts/min from untreated counts/min. The amount of Fc proteins bound to C. albicans was calculated as specific binding cpm/specific activity of 125I-Fc protein.
For experiments measuring specific binding of Dec2-Fc to hyphae, hyphae (2 x 105 cells) were pretreated with various concentrations of Fc protein on ice for 1 h (triplicate). After removing unbound Fc proteins by washing, 1 µg/ml of 125I-Dec2-Fc was added to pretreated and untreated hyphae and then incubated on ice for another 1 h. A set of tubes was incubated with 125I-Dec2-Fc in the presence of 10 mM EDTA, and Ca2+-dependent binding activity was calculated as before. The ability of polysaccharide to inhibit Dec1-Fc or Dec2-Fc binding to hyphae or yeasts was assayed as follows: yeast or hyphae (1 x 106 or 2 x 105 cells/ELISA well) were washed with 0.1% BSA/DPBS/CaCl2 and incubated with 125 I-Dec1-Fc or 125I-Dec2-Fc (1 µg/ml) in the presence of laminarin or mannan (both from Sigma) on ice for 1 h. After extensive washing, C. albicans-bound and background radioactivities were measured as before.
Binding of Transfectants to C. albicans—The following procedures were followed for binding of COS-1 transfectants to C. albicans hyphae. A day after transfecting COS-1 cells with expression vectors for full-length dectin-1-V5 or dectin-2-V5, or an empty vector, cells were re-seeded on 60-mm culture dishes (5 x 105 cells/dish) and metabolically labeled with [3H]thymidine (ICN Biochemicals, 1 µCi/dish) for 16 h. Cells were then harvested by pipetting in 0.02% EDTA/DPBS. After washing with 10% FCS/RPMI (cRPMI), specific activity of labeled cells (cpm/cell) was determined. Cells in increasing numbers were added to hyphae grown in 96-well plates (2 x 105 cells/well, in triplicate) and cultured in a CO2 incubator at 37 °C for 1 h. Amphotericin B (Sigma) was added to block fungal growth (final concentration of 2.5 µg/ml). Unbound COS-1 cells were removed by washing with cRPMI 10 times; cells bound to hyphae were lysed by incubation with 0.3% Triton X-100/PBS (200 µl/well) at room temperature for 20 min.
For binding of RAW cells to C. albicans hyphae, the RAW parental cells or those expressing dectin-1-V5 or dectin-2-V5 were metabolically labeled with [3H]thymidine (1 µCi/culture) by overnight incubation. After measuring specific radioactivity (cpm/cell), labeled cells (3 x 104 cells/well) were incubated in ELISA wells just treated with 0.1% BSA/PBS or where hyphae were grown (104 cells/well). After culturing at 37 °C for 30 min, wells were washed with 0.1% BSA/PBS 10 times and lysed with 100 µl of 0.3% Triton X-100/PBS, and 3H counts were determined. The number of cells adherent to a well was computed by dividing 3H counts/min from a well by specific activity.
For binding of RAW cells to C. albicans yeasts (26), freshly grown yeasts were washed twice with PBS and resuspended in 0.1 mg/ml FITC (Sigma) at room temperature for 1 h. After extensive washing, FITC-labeled yeasts were resuspended in 10% FCS-HBSS. RAW cells (5 x 105) were incubated with FITC-labeled yeasts at indicated m.o.i. values for 30 min at room temperature. After removing unbound yeasts by extensive washing, cells were fixed with 1% paraformaldehyde for 1 h at 4 °C, washed, and then analyzed using FACSCalibur (BD Biosciences). Histograms were made from fluorescent signals after removal of free FITC-yeasts by gating out the small sized population using forward/side scatter analysis.
|
For protein tyrosine phosphorylation, RAW cells (2.5 x 106) were starved by culturing for 1 h in serum-free DMEM, incubated at 37 °C for 1 h, and cocultured with yeast or hyphae (7.5 x 106 each) in 24-well plates. At different time points after incubation at 37 °C, cells were chilled on ice and lysed by addition of 10x lysis buffer (20 mM Tris-HCl, pH 7.6, 10% Triton X-100, 10 mM sodium orthovanadate, 10 mM EDTA) to terminate phosphorylation. The clear lysate was prepared by centrifugation at 14,000 rpm for 20 min and subjected to Western blot analysis using 1:1,000-diluted horseradish peroxidase anti-phosphotyrosine Ab (PY-plus, Zymed Laboratories Inc.).
To examine association of dectin-2 with the FcR chain, whole cell extracts were prepared from Dec2V5-RAW or parental macrophages (1 x 106 cells) using a lysis buffer (1% Brij 55, 50 mM Tris-HCl, pH 7.6, 1 mM Na2VO4, 50 mM NaF, proteinase inhibitor mixture (Sigma)) and incubated with mouse anti-V5 (2 µg) or mouse anti-human FcR chain 7D3.5 mAb (Note: the mAb we originally developed has cross-reactivity to mouse FcR) (3 µg) at 4 °C for 16 h, followed by precipitation with 10 µl of 50% slurry protein G-agarose (Roche Applied Science). After washing the agarose beads, the immunoprecipitates were dissociated from the beads by boiling and then subjected to Western blotting using anti-FcR Ab or rat anti-dectin-2 mAb (each 2 µg/ml). The interaction was also examined in COS-1 cells (1 x 106 cells) cotransfected with two expression vectors encoding for dectin-2-V5 and FcR (pcDNA-mchain), respectively.
To measure phosphorylation of the FcR chain, Dec2V5-RAW or RAW parental cells (1 x 106 cells in 100 µl of PBS) were incubated with anti-V5 Ab (5 µg/ml) at 4 °C for 40 min. After extensive washing, cells were treated with goat antimouse IgG (20 µg/ml) at 37 °C at various time periods and lysed using 100 µl of 2x lysis buffer (1% Triton X-100, 50 mM Tris-HCl, pH 7.6, 1 mM Na2VO4, 50 mM NaF, proteinase inhibitor mix (Sigma)). In some experiments, RAW cells were pretreated with PP2 or PP3 kinase inhibitor at 37 °C for 2 h. Protein extracts were prepared, immunoprecipitated with anti-FcR chain Ab, and then blotted with anti-phosphotyrosine Ab 4G10 (1 µg/ml) (Upstate Cell Signaling Solutions, Lake Placid, NY) or anti-FcR chain Ab. RAW cells (2.5 x 106) were also treated with C. albicans hyphae or yeasts (3 x 106) at 37 °C at different time periods. Tyrosine phosphorylation was examined as described previously.
Immunofluorescence Staining—Binding of Dec2V5-RAW cells to hyphae was also studied using microscopy. Hyphae (3 x 105 cells/well) grown in 2-well chamber slides (Lab-Tek Products, Naperville, IL) were labeled with 100 µg/ml TRITC (Sigma) in 0.1 M sodium bicarbonate, pH 8.3, at room temperature for 30 min. Free TRITC was removed completely by extensive washing with PBS. Dec2V5-RAW cells (5 x 106 cells/ml) were pretreated with 1% mouse serum (Jackson ImmunoResearch) in 10% FCS/HBSS on ice for 10 min and surfacelabeled with 2 µg/ml FITC-anti-V5 Ab on ice for 1 h. After washing three times with 10% FCS/HBSS, surface-labeled RAW cells (3 x 105 cells/ml) were resuspended in complete DMEM containing 2.5 µg/ml amphotericin B and then cultured with TRITC-labeled hyphae (3 x 105 RAW cells/well). At different time points after incubating at 37 °C, media were removed, and the cells fixed immediately with 10% formaldehyde/PBS. Finally, immunofluorescence microscopy was performed at the Live Cell Imaging Facility at the University of Texas Southwestern Medical School. Fluorescence images were taken under confocal microscopy and analyzed using 488 nm excitation for FITC and 543 nm for TRITC.
|
, RAW cells (5 x 105) were incubated with polyclonal rabbit anti-V5 Ab (10 µg/ml) (Chemicon International, Temecula, CA) at 4 °C for 30 min. After washing with PBS, cells were fixed with 4% paraformaldehyde/PBS for 20 min at room temperature, cytospun to a slide glass, and permeabilized with 0.2% Triton X-100/PBS for 2 min. The slide glass was incubated with mouse anti-FcR chain Ab (1 µg/ml) at room temperature for 1 h and stained with Alexa488-conjugated goat anti-mouse or 594-conjugated goat anti-rabbit IgG (each 1:1,000 dilution) (Molecular Probes). Fluorescence images were taken under confocal microscopy using 488 nm (for FcR) or 594 nm excitation (for dectin-2). In the case of COS-1 cells, cells (1 x 104) were seeded on a coverslip (12 mm diameter) in 24-well plates. Two days after transfection, cells were treated and analyzed in a similar manner. Internalization and Its Inhibition by Tyrosine Kinase Inhibitor—Dec2V5-RAW cells were seeded on a 2-well chamber slide (LabTek) (1 x 105 cells/well) and cultured overnight. After washing cell layers once with PBS, RAW cells were pretreated with 2.5 µg/ml Fc block in 10% FCS/PBS on ice for 10 min and processed for surface labeling with 2 µg/ml FITC-anti-V5 or isotypic control Ab (Invitrogen). After eliminating unbound Ab, FITC-labeled dectin-2 was cross-linked with 10 µg/ml anti-mouse IgG F(ab')2 (Jackson ImmunoResearch) on ice for 30 min, washed, and labeled with 200 nM LysoTracker Red (Molecular Probes) for 1 h at 37°C. Cells were washed three times with 1% FCS/PBS and fixed with 10% formaldehyde. Optical sections were acquired using a Leica TCS SP1 laser scanning confocal microscope (Leica Micro-systems, Bannockburn, IL) as described previously.
For inhibition of endocytosis (27), RAW cells (1 x 106) were pretreated with fresh complete DMEM containing 0.5% Me2SO (control) or the indicated concentrations of PP2 or PP3 (Calbiochem) at 37 °C for 30 min. After removing medium, cells were incubated with 2 µg/ml FITC-anti-V5 Ab (Invitrogen) on ice for 1 h, followed by staining with 20 µg/ml goat anti-mouse IgG F(ab')2. After surface labeling with the Ab, cells were allowed to internalize cross-linked Ab by incubating at 37 °C for 1 h in the continuous presence of an inhibitor at the same concentration. Treated cell samples were then examined for FITC intensity by flow cytometry before and after treating with 0.2% trypan blue/PBS for 1-2 min to quench the surface FITC. The value of internalized FITC was computed by subtracting background fluorescence (surface staining of cells treated with trypan blue but without incubation) from mean fluorescence of cells treated with trypan blue. Finally, the effect of a tyrosine kinase inhibitor on internalization was evaluated by the internalization value of a sample treated with an inhibitor relative to untreated control (set at 100%).
Electromobility Shift Assay (EMSA)—RAW cells (3 x 107 cells/dish) were infected with C. albicans yeast or hyphae at a m.o.i. of 3. After incubating at 37 °C for 1 h, cells were washed twice with ice-cold PBS and then lysed by incubating in ice-cold 0.6% Nonidet P-40-containing buffer A (10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 1 mM dithiothreitol) for 5 min. Cell lysates were collected and centrifuged at 14,000 rpm at 4 °C for 20 s. The supernatant containing cytosolic proteins was aspirated, and pellets were resuspended in 1 ml of ice-cold buffer A without Nonidet P-40. Following centrifugation at 14,000 rpm at 4 °C for 20 s, the pellet was resuspended in 50 µl of ice-cold buffer C (20 mM HEPES, pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 1 mM dithiothreitol) and incubated on ice for 1 h. Clear lysates (nuclear extracts) were prepared by centrifugation at 14,000 rpm for 30 min. Protein concentration was determined by the Bradford method (normally, 2-4 mg/ml), snap-frozen in liquid nitrogen, and stored at -85 °C until needed. Activation of NF-B was examined by EMSA using an aliquot (4 µg) of prepared nuclear extract and a gel-shift assay kit (Promega, Madison, WI).
|
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
-glucan on yeasts (30), we questioned whether dectin-2 also recognized microbial organisms. We created soluble receptors of dectin-2 and dectin-1, in which the respective extracellular domain was fused to the Fc portion of human IgG1 (Dec2-Fc; Dec1-Fc). We then performed binding assays to assess the ability of fluorescence-labeled Dec2-Fc, Dec1-Fc, or Fc alone (control) to recognize microbes. None of the probes bound to S. aureus, group A streptococci, P. aeruginosa, or E. coli (data not shown). As reported previously (26), Dec1-Fc bound to C. albicans yeasts especially at budding sites (data not shown). By contrast, Dec2-Fc bound to hyphal (but not yeast) components of C. albicans (Fig. 1A). We next questioned whether differences in the ability of dectin-1 and dectin-2 to recognize yeast versus hyphal forms extended to other fungi (Fig. 1B). Dec2-Fc bound to the filamentous (hyphal) but not conidial (yeast) form of the dermatophytes, M. audouinii and T. rubrum, whereas Dec1-Fc bound preferentially or predominantly to the conidial form (Fig. 1B). To quantify binding activity, Candida yeast or hyphae were incubated with 125I-labeled Dec2-Fc in increasing doses (Fig. 2). After washing, Candida-bound 125I radioactivity (counts/min) was determined and nonspecific binding regarded as radioactivity left after treatment with acid buffer. Specific binding was expressed as counts/min after subtracting nonspecific binding from untreated counts/min. Using Candida-bound Dec2-Fc protein, calculated from specific activity of 125I-Fc proteins (cpm/µg), we observed binding of dectin-2 to hyphal components in a dosedependent manner, whereas binding to yeast components was minimal, even at the highest dose tested (Fig. 2A).
Because dectin-2 contains an EPN motif required for Ca2+-dependent carbohydrate binding by C-type lectins (31), we examined the effect of the calcium inhibitor, EDTA, on binding of Dec2-Fc to C. albicans hyphae (Fig. 2B). EDTA treatment (10 mM) abrogated such binding as strongly as did acid treatment. Moreover, incubation of a constant number of hyphae with increasing doses of 125I-Dec2-Fc in the presence of calcium revealed saturation of binding at a range of 30-100 µg/ml (Fig. 2C). These results suggest that putative ligands of dectin-2 are expressed abundantly on hyphae.
Because hyphae are larger than yeasts, we controlled for fungal size by culturing C. albicans yeast or hyphae (increasing numbers) with 125I-Dec2-Fc (constant dose) (Fig. 2D). At a dose range of less than 1 x 106 cells, hyphae bound Dec2-Fc in a dose-dependent manner. By contrast, yeast bound to Dec2-Fc only minimally, if at all (Fig. 2D). To more rigorously evaluate specificity of Dec2-Fc binding to hyphae, we saturated putative ligands for dectin-2 on hyphae by pretreatment with cold Dec2-Fc or Fc control at increasing doses before measuring binding of 125I-labeled Dec2-Fc (Fig. 2E). Pretreatment with Dec2-Fc, but not Fc control, blocked binding in a dose-dependent manner, up to 80% at the highest dose tested (100 µg/ml) in which putative ligands of dectin-2 were presumed to be saturated with cold Dec2-Fc (Fig. 2C).
Because -glucan is a ligand of dectin-1, we examined whether dectin-2 also recognizes -glucan or its structurally related polysaccharide. Consistent with a previous report (26), laminarin almost completely blocked binding of Dec1-Fc to yeast but had almost no effect on binding of Dec2-Fc to hyphae (Fig. 2F). By contrast, mannan, a polysaccharide purified from S. cerevisiae, blocked binding of Dec2-Fc to hyphae in a dosedependent manner while only minimally blocking binding of Dec1-Fc to yeast (Fig. 2F). These results indicate that dectin-2 and dectin-1 have disparate ligands.
|
Binding of Hyphae to Dectin-2 Leads to Protein Tyrosine Phosphorylation—Because dectin-2 lacks a tyrosine-based signal motif in its intracellular domain, we questioned whether ligand-bound dectin-2 receptor was capable of transducing intracellular signals. We subjected whole cell extracts of RAW cells cultured with C. albicans yeast or hyphae to Western blotting using anti-phosphotyrosine Ab to detect tyrosine-phosphorylated proteins (Fig. 4). Compared with correspondingly treated parental RAW cells, hyphae (but not yeast)-treated Dec2V5-RAW cells yielded increased amounts of tyrosinephosphorylated proteins as early as 10 min after incubation (Fig. 4A). To evaluate specificity for dectin-2, we cross-linked dectin-2 with anti-V5 Ab plus secondary Ab (Fig. 4B); this treatment also induced tyrosine phosphorylation, albeit to a lesser degree than was achieved by hyphae. These results indicate that ligation of dectin-2 can transduce tyrosine-based signals in the absence of an intracellular signal motif.
Dectin-2 Associates with the Fc Receptor Chain—DCAR is a C-type lectin shown recently to associate with the FcR chain via an arginine in its transmembrane domain (32). Because dectin-2 shows 96% amino acid identity to the transmembrane of DCAR (25 of 26 amino acids, including the arginine connector (32)), we posited that dectin-2 also associates with FcR.We used anti-V5 Ab to immunoprecipitate Dec2V5 protein from extracts of Dec2V5-RAW (Fig. 5A) and then blotted it with anti-dectin-2 or anti-FcR Ab. We found dectin-2 and FcR proteins in precipitates from anti-V5 Ab (but not control Ab)-treated Dec2V5-RAW cells (Fig. 5A); dectin-2 was not detected in precipitates from RAW parental cells. We also used reverse immunoprecipitation to show that anti-FcR Ab coprecipitated Dec2V5 protein. In addition, we employed COS-1 cells cotransfected with Dec2V5 and FcR genes to confirm that dectin-2 associates with FcR (Fig. 5B). Finally, we used confocal microscopic analysis to locate dectin-2 and FcR proteins within Dec2V5-RAW and cotransfected COS-1 cells (Fig. 5C). These cells were surface-labeled with phycoerythrin-anti-V5 Ab (Fig. 5C, red fluorescence), fixed, and then stained with FITC-anti-FcR Ab (Fig. 5C, green). In RAW cells, the majority of endogenous FcR protein resided on the cell surface colocalizing with surface-labeled dectin-2 (Fig. 5C, yellow). In cotransfected COS-1 cells, similar colocalization was observed, although the majority of FcR resided intracellularly (Fig. 5C).
|
|
chain, we assayed the binding of an R17V mutant, in which the positively charged arginine was replaced by the neutrally charged valine (Fig. 6). FcR protein was immunoprecipitated from extracts of COS-1 cells cotransfected with the R17V mutant (tagged with the C-terminal V5) and FcR, and then immunoblotted with anti-V5 to detect dectin-2 (Fig. 6B). Wild-type dectin-2 and the R17V mutant each coprecipitated FcR efficiently, indicating that transmembrane arginine is not essential for the association. We next examined the importance of the intracellular and extracellular domains of dectin-2 by constructing three other mutants as follows: ICD mutant with the entire intracellular domain (amino acids 1-14) deleted; 1/2 ICD lacking the N-terminal half of the intracellular domain (amino acids 1-7); and 40LECD in which the extracellular domain is replaced by the CD40 ligand (CD40L) (33), a type II transmembrane receptor that does not associate with FcR. Immunoprecipitation revealed binding of 1/2 ICD or 40LECD with FcR as avidly as that of the wild type, whereas ICD mutant bound poorly, indicating that a short stretch of the intracellular domain of dectin-2 (amino acids 8-14) proximal to the transmembrane domain is required for associating with FcR.
Dectin-2 Transduces Tyrosine Phosphorylation of Fc Receptor Chain—We next questioned whether ligation of dectin-2 leads to tyrosine phosphorylation of the FcR chain (Fig. 7). At different time points after cross-linking dectin-2 on RAW cells with anti-V5 Ab or control IgG, whole cell extracts were prepared from treated RAW cells; FcR protein was immunoprecipitated, and tyrosine phosphorylation of FcR was examined by immunoblotting with anti-phosphotyrosine Ab (to detect phosphorylation levels) or anti-FcR Ab (to measure precipitated FcR). A single band immunoreactive to anti-phosphotyrosine Ab was detected as early as 2 min, and it peaked at 5 min followed by a rapid decrement (Fig. 7A). The phosphorylated form, which migrated slower than the unphosphorylated form (34), was also detected in immunoblots with anti-FcR (Fig. 6A). Absence of phosphorylation in parental cells treated with anti-V5 Ab and in Dec2V5-RAW cells treated with control Ab confirmed specificity for dectin-2. We next determined whether ligation of dectin-2 by hyphae (versus yeast as control) leads to FcR phosphorylation (Fig. 7B). Rapid phosphorylation was observed in hyphae (but not in yeast)-treated Dec2V5-RAW cells.
|
|
is phosphorylated by the Src kinases, Lyn and Fyn (35), we examined whether PP2, an inhibitor of Src kinases, can block dectin-2-induced FcR phosphorylation; the biologically inert derivative, PP3, was used as control. Pretreatment of RAW cells with PP2 (but not PP3) blocked FcR phosphorylation by 60% (Fig. 7C). Altogether, our results indicate that dectin-2 can associate with FcR and that such association is likely to transduce Src-dependent phosphorylation. Ligation of Dectin-2 Triggers Internalization Likely through Src Family Kinases—We next used confocal microscopy to study internalization and intracellular trafficking after cross-linking of dectin-2 on Dec2V5-RAW cells with FITC-anti-V5 Ab (as a surrogate ligand) plus a secondary Ab (Fig. 8A). As early as 15 min after cross-linking, ligandloaded dectin-2 was internalized and formed endosomes, most of which were not fused to lysosomes (stained by LysoTracker). We then examined whether the Src family kinases are involved in the internalization (Fig. 8B). PP2 (50 µM) pretreatment blocked internalization by 70%, whereas PP3 had little effect. Thus, internalization of ligated dectin-2 is achieved through activation of Src family kinases.
Ligation of Dectin-2 Activates NF-kB—NF-B is a major transcription pathway utilized by many immunoregulatory receptors to mediate their downstream biologic effects (36). Because FcR can activate NF-B, we examined the effects of ligated dectin-2 on NF-B activation using the EMSA on nuclear extracts from transfected or parental RAW cells infected with C. albicans (hyphae versus yeasts) or LPS as a nonspecific control. Parental RAW cells failed to induce NF-B activation beyond steady-state levels (Fig. 9A). By contrast, Dec2V5-RAW cells activated NF-B in response to hyphal infection but not yeasts. Moreover, specificity for hyphae-ligated dectin-2 was confirmed by the finding of close to equal nuclear translocation of NF-Bin parental and Dec2V5 RAW cells treated with LPS (Fig. 9B).
Hyphae-bound Dectin-2 Up-regulates IL-1ra and TNF Expression—To determine whether ligated dectin-2 stimulates RAW cells to produce cytokines, we again cocultured parental and Dec2V5-RAW cells with C. albicans hyphae or yeast, and we examined cytokine gene expression by multiple RNase protection assay (Fig. 10, A and B). Among the cytokine genes tested (TNF was unintentionally not included), IL-1ra was most markedly up-regulated, 7-fold increase in Dec2V5-RAW cells treated with hyphae versus 2-fold increase induced by yeast (Fig. 10, A and B). IL-6 and IL-18 gene expression was up-regulated minimally in hyphae-treated cells. We next measured production of five cytokines by RAW cells at 6 and 16 h after infection with C. albicans (Fig. 10C). Consistent with mRNA results, hyphae induced considerable secretion of IL-1ra protein, whereas yeast did so only minimally. Hyphaeinduced TNF production was even more greatly induced. A time course study revealed hyphae-induced augmentation as early as 2 h for TNF and 6 h for IL-1ra (Fig. 10, D and E). Finally, to determine whether Src kinase played a role, we assayed the inhibitory effect of PP2 on TNF and IL-1ra secretion (Fig. 10F). PP2 blocked hyphae-induced TNF production completely, whereas it inhibited IL-1ra secretion by 80%. These results indicate that hyphae-ligated dectin-2 stimulates RAW cells to produce IL-1ra and TNF likely through activation of Src kinases.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
B, and up-regulates expression of TNF and IL-1ra. Transduction of these events after recognition of hyphae is achieved by coupling of dectin-2 with the signal adaptor, FcR, which bears an immunoreceptor tyrosinebased activation motif (ITAM). Because ITAM-dependent signaling in leukocytes appears critical to the differentiation, proliferation, regulation, and survival of several immune effector cells (27), we speculate that dectin-2 on APC contributes to the initiation and modulation of anti-fungal immunity.
Selective binding of dectin-2 to hyphae led us to screen carbohydrates unique to hyphae (not found in yeasts) as candidates for the dectin-2 ligand, including chitin (37, 38); -(1-3)- and -(1-2)-linked glucans (39, 40); high molecular weight mannoproteins like CaCYC3 (41, 42); other mannoproteins (43, 44); and other lipids (45). However, neither chitin, its carbohydrate unit (N-acetylglucosamine), nor any of the glucans blocked binding of dectin-2 to hyphae (data not shown). We also tested simple hexose carbohydrates for their ability to bind to dectin-2 and found none to do so significantly (data not shown). Rather, we discovered that high dose mannan blocks binding of dectin-2 to hyphae, a result consistent with those from a glycan array analysis that employed synthetic carbohydrates to show that dectin-2 can recognize high mannose structure (46).
However, several caveats prevent us from declaring mannan as the dectin-2 ligand. Mannan is a polymer of mannose consisting of various oligomannosides, and the dectin-2 ligand may be a minor oligomannoside of this polysaccharide preparation. C. albicans yeasts and hyphae both contain mannan in their cell walls, yet dectin-2 binds preferentially to the latter. Thus, it is possible that one of the minor oligomannosides is synthesized more abundantly by hyphae (versus yeast) or that its presence in hyphae (versus yeast) is more accessible for binding to dectin-2. For example, dectin-1 binds preferentially to yeasts at budding sites, where -glucan is more accessible (26). Transformation of yeasts to pseudohyphae may alter the three-dimensional structure of the cell wall (44) that better displays the putative dectin-2 ligand.
Type II-configured CLR on APC can be sorted into the following two groups based on the presence/absence of signaling motifs in the intracellular domain: CLR having the motif include dectin-1 which carries a YXXL (an ITAM-like sequence) (19, 47), and DCIR which has an immunoreceptor tyrosine-based inhibitory motif (48). CLR without the motif include DCAR and dectin-2. Recently, it has been reported that DCAR associates with the FcR chain, enabling it to induce signals leading to Ca2+ influx (32). The same authors claimed that dectin-2 was unable to couple with the FcR in COS-1 cells cotransfected with FcR and dectin-2 genes (32). Our results are at odds with this report; not only is dectin-2 capable of binding with the FcR chain (coprecipitation of endogenous or genetically engineered FcR from RAW cells or from cotransfected COS-1 cells using anti-V5 Ab) (Fig. 5, A and B) but also dectin-2 and FcR chain colocalize within these cells (Fig. 5C). Furthermore, ligation of dectin-2 by hyphae or V5-cross-linked Ab induces phosphorylation of the FcR chain (Fig. 7). Note that both dectin-2 and DCAR possess transmembrane domains with almost identical amino acid sequence (one miss-match among 26 amino acids), including a positively charged arginine residue essential for interaction of many Ig superfamily members with the FcR chain (49). In contrast to DCAR (32) and other Ig-like receptors (49), the association of dectin-2 with FcR was achieved via the intracellular domain proximal to the transmembrane and not through transmembrane arginine. Relevant to this finding is platelet receptor GPVI, which was also shown to associate with FcR through its intracellular domain (50).
To study the function of dectin-2 in innate immunity, we used dectin-2-overexpressing RAW cells as a model of inflammatory macrophages and DC expressing high levels of dectin-2 (22). Expression levels by the RAW cells are likely to be more abundant than levels physiologically expressed by those inflammatory cells. Thus, some of our data may not reflect precisely the real significance of dectin-2 on DC. Recognition of pathogens by DC is not achieved by a single receptor. Rather, DC employ concurrently multiple receptors. In this regard, we speculate that inflammatory macrophages and DC employ dectin-2 to recognize hyphae, with the dectin-2-induced downstream events we found contributing in part to overall changes induced by DC.
Interaction between particular microbes and PRR on APC leads to intracellular and secretory events that may govern whether effector responses generated against infection are protective or promiscuous. Ligation of dectin-1 by zymosan (containing -glucan) led to phosphorylation of the ITAM-like motif of dectin-1, activation of Syk tyrosine kinase, and up-regulated secretion of IL-2 and IL-10 (47). By contrast, we showed that ligation of dectin-2 by hyphae led to phosphorylation of FcR and up-regulated secretion of TNF and IL-1ra. This disparity between cytokines produced by each pathway may account at least partially for differences in the biologic outcome of infection by dimorphic fungi, with yeast-dominant infections fostering protective immunity and hyphae-dominant infections engendering greater tissue invasion.
|
FOOTNOTES |
|---|
1 Present address: Dept. of Pathology, Graduate School of Veterinary Medicine, Hokkaido University, Kita 18 Nishi 9, Kita-ku, Sapporo 060-0818, Japan.
2 Present address: Dept. of Dermatology, Kinki University School of Medicine, 377-2, Ohno-Higashi, Osaka-Sayama, Osaka 589-8511, Japan.
3 To whom correspondence should be addressed: Dept. of Dermatology, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9069. Tel.: 214-648-7552; Fax: 214-648-0280; E-mail: Kiyoshi.Ariizumi{at}UTSouthwestern.edu.
4 The abbreviations used are: APC, antigen presenting cells; Ab, antibody; mAb, monoclonal antibody; CLR, C-type lectin-like receptors; DC, dendritic cells; EMSA, electromobility shift assay; FcR, Fc receptor ; IL-1ra, interleukin-1 receptor antagonist; ITAM, immunoreceptor tyrosine-based activation motif; m.o.i., multiplication of infection; PRR, pattern recognition receptors; TLR, toll-like receptor; TNF, tumor necrosis factor ; FITC, fluorescein isothiocyanate; TRITC, tetramethylrhodamine isothiocyanate; BSA, bovine serum albumin; PBS, phosphate-buffered saline; DPBS, Dulbecco's PBS; FCS, fetal calf serum; FACS, fluorescence-activated cell sorter; LPS, lipopolysaccharide; HBSS, Hanks' balanced salt solution.
|
ACKNOWLEDGMENTS |
|---|
) or those transfected with dectin-1 or dectin-2 tagged with the C-terminal V5 epitope (Dec1V5 or Dec2V5). Aliquots (each 1 x 105 cells eq) were examined for protein expression of Dec1V5 or Dec2V5 by Western blotting using anti-V5 Ab. Two arrows (31 and 42 kDa) indicate bands corresponding to Dec1V5 and Dec2V5, respectively. B, RAW cells were pretreated with Fc block before staining with FITC/anti-V5 Ab. Surface expression of Dec1V5 (open histogram) or Dec2V5 (closed histogram) was assayed by flow cytometry and compared with parental cells (dashed lines). C, binding to yeast. RAW cells were cocultured with fluorescence-labeled live yeasts at varying m.o.i. values. Frequency (%) of fluorescently labeled RAW cells was determined by flow cytometry. D, binding to hyphae. RAW cells metabolically labeled with [3H]thymidine were incubated in the 96-well plate covered with/without hyphae (4 x 105 cells/well) at 37 °C for 30 min. After washing, cells were lysed and measured for 3H counts, and cell numbers adhered to a well were computed. Binding of RAW cells to hyphae is expressed as fold difference (hyphae versus culture well). E, COS-1 cells were transfected with an empty vector (open triangles) or expression vector for dectin-1-V5 (open circles) or dectin-2-V5 (closed circles). [3H]Thymidine-labeled COS-1 cells at increasing cell numbers were incubated with a constant number of hyphae (2 x 105 cells/well in triplicate). After washing, hyphae-adhered COS-1 cells were lysed and measured for 3H counts/min. The number of cells that bound to hyphae was calculated as well bound cpm/specific activity of 3H-labeled cells (0.24 - 0.32 cpm/cell). F, dectin-2 protein on RAW cells was fluorescently labeled with FITC/anti-V5 Ab and then cocultured with pseudohyphae labeled with rhodamine (red fluorescence). Green (anti-V5 Ab) and red (hyphae) fluorescence images were separately taken and merged (Merge). Surface distribution of dectin-2 before coculturing with hyphae was also shown (Before). All data shown are representative of three independent experiments.
